Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

Oligonucleotides used in PCR assay (Karmawan et al. 2009)

PrimerSequence (5’- 3’)
 ACS1 F CCGAGACTGGATGAAGAAGAA 
 ACS1 R GTCTGGGTCAAATCTGGCTC
 ACO FCGAGATGCTTGCGAGAAATGG
 ACO RTGCAGCAAATTCCTTCATCGC
J Plant Biotechnol 2018;45:36-44 https://doi.org/10.5010/JPB.2018.45.1.036
© 2018 J Plant Biotechnol