Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 2.

Table. 2.

Primers and restriction enzymes used to develop S. chacoense specific markers

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SC3_InDel_11rps4 (Intragenic)FTTGTATCTTTATCCCGGAGC300as
RGTTGTTAGTAAAATGTTGTTAG
SC3_InDel_16accD (Intragenic)FCTTTGTTCCGTGTTGAAATA334as
RAAGCATAGAAATCCAGTGTT
SC3_SNP_7rpoB (Intragenic)FCTAGCAGACTCCCTGCTAAC397MboII
RGTGAAAGAATCTTCGTATGC
SC3_SNP_15accD (Intragenic)FTATAGGAGAGGACAAATCTC406MaeI
RTTTCAATAGGACCAAGACTG

F and R indicate forward and reverse strand of primers.

The expected size of PCR fragments are measured based on the sequence of S. chacoense.

Restriction enzymes generating S. chacoense specific markers. ‘as’ indicates allele specific marker.

J Plant Biotechnol 2019;46:79-87 https://doi.org/10.5010/JPB.2019.46.2.079
© 2019 J Plant Biotechnol