Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

Primers used for the qRT-PCR analysis

GenePrimer nameSequence (5‘ to 3‘)
OsTPS30OsTPS30-FATGAAAGAACGGGTTCAAGTTGTGA
OsTPS30-RAATGTTATACGGCTCCATATAGAGCGAT
OsTPS30-qRT-FACCACCACCATGCTTCTACA
OsTPS30-qRT-RACTCCTTTATCCCAACGCAT
OsNAC10OsNAC10-qRT-FTACACAACACCTCATCCAA
OsNAC10-qRT-RATGATCTAGGCGTGACTC
OsActinOsACT-qRT-FTGAAGTGCGACGTGGATATTAG
OsACT-qRT-RCAGTGATCTCCTTGCTCATCC
AtActin2AtACT2-qRT-FGCCATCCAAGCTGTTCTCTC
AtACT2-qRT-RGCTCGTAGTCAACAGCAACAA
J Plant Biotechnol 2019;46:88-96 https://doi.org/10.5010/JPB.2019.46.2.088
© 2019 J Plant Biotechnol