Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

Specific primers used, for real-time quantitative PCR

Primer namePrimer sequence
DREB-RT FGCTCCTTCCCTACTGCTGTG
DREB-RT RCACTAGATGCCAGCAACGAA
Sc-GADPH FCACGGCCACTGGAAGCA
Sc-GADPH RTCCTCAGGGTTCCTGATGCC
Sc-Eef-1a FTTTCACACTTGGAGTGAAGCAGAT
Sc-Eef-1a RGACTTCCTTCACAATCTCATCATAA
J Plant Biotechnol 2019;46:97-105 https://doi.org/10.5010/JPB.2019.46.2.097
© 2019 J Plant Biotechnol