Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

The Primer sequences, repeat motif, and annealing temperature of 4 SSR markers used in the analysis of genetic variation plants

MarkeraForward primerReverse primerRepeat motifTm (°C)
FxaHGA02P13F:ccaggcgcttggtcttgtactactR:cccatttcccccaaatctaacaat-59
FxaAGA21F11F:caattcacaatggctgatgacgatR:gcactcagacatattttgggaggg-59
EMFv104F:tggaaacattcttacatagccaaaR:cagacgagtccttcatgtgc(AG)1753
EMFvi136F:gagcctgctacgcttttctatgR:cctctgattcgatgatttgct(TC) Direct54

SSR markers have been cited in Govan et al. (2008) and Honjo et al. (2011)

J Plant Biotechnol 2019;46:106-13 https://doi.org/10.5010/JPB.2019.46.2.106
© 2019 J Plant Biotechnol