Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 2.

Table. 2.

Oligonucleotides used for RT–PCR and RT–qPCR analysis in this study

Gene nameGene IDPrimers (5' to 3')Direction
HvCHS1AK248641TTTCATCATGGACGAGATGCF
TGTGGAGGACGACGGTCT R
CGCGACACAGACTAACAGGAR
HvCHS2AK357384TTTCATCATGGACGAGATGCF
TCAAACGACCACGATCTCAAR
HvCHS3AK354067TTTCATCATGGACGAGATGCF
GGAATGCGTAAGCCAAGAGAR
HvCHIAK374952AACTGTGTCGCGTACTGGAAF
GGGGAGTGCGTGAAGAGTATR
HvOGT1AK375231TGTCGAGATAGTTTGTCGGGTGTGF
ATCACGCCGTCGGATGGATATCTG R
HvOGT2AK371730CAGCAGGAGGAACCTGGATAF
CTGGCACCAAGCAGCAGATR
HvPP2AA3AK251150ACATCCCTCTGCTGGCTAGTF
GCCAGTCGCTTCAAGTTGTTR
J Plant Biotechnol 2019;46:247-54 https://doi.org/10.5010/JPB.2019.46.4.247
© 2019 J Plant Biotechnol