Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

Primer sequences used for real-time gene expression analysis in this study

F R Reference
TaNAC2a GGTAGTGCGGTGCTTCCAAT TGAATGTTGTTGCTCGTCCC Tang et al. 2012
TaNAC7 ATCGCCAAGCCACCCACAGG GGAGGGGCCATTGGAGAAGC Tang et al. 2012
TaNAC69-1 TGCCTCCCGAAAACCCA TTGTTCACGTAGCCGTTGTTGT Xue G. et al. 2011
TaNAC69-3 AACAATGGCTACGTGAACATCGA AAACTGCCGCTGGACCTCTT Xue G. et al. 2011
TaActin CTTGTATGCCAGCGGTCGAACA CTCATAATCAAGGGCCACGTA Wang et al. 2013
J Plant Biotechnol 2020;47:1-14 https://doi.org/10.5010/JPB.2020.47.1.001
© 2020 J Plant Biotechnol