Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

The primer sequence, repeat motif, and annealing temperature of the four SSR markers used to analyze genetic variation in ‘Goha’ cultivars treated with BA

Markera Forward primer Reverse primer Repeat motif Tm (°C)
FxaHGA02P13 F:ccaggcgcttggtcttgtactact R:cccatttcccccaaatctaacaat - 59
FxaAGA21F11 F:caattcacaatggctgatgacgat R:gcactcagacatattttgggaggg - 59
EMFv104 F:tggaaacattcttacatagccaaa R:cagacgagtccttcatgtgc (AG)17 53
EMFvi136 F:gagcctgctacgcttttctatg R:cctctgattcgatgatttgct (TC) Direct 54

aSSR markers have been cited in Govan et al. (2008) and Honjo et al. (2011)

J Plant Biotechnol 2020;47:46-52 https://doi.org/10.5010/JPB.2020.47.1.046
© 2020 J Plant Biotechnol