Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 1.

Table. 1.

Primer sequences for high-resolution melting analysis of the internal transcribed spacer (ITS) fragments

Gene Primers Sequences (5'–3') Tm (°C) Size (bp)
ITS Forward CGAGTCTTTGAACGCAAGTT 54.6 244
Reverse CTAAGATGACGAGGATTCGC 54.4
J Plant Biotechnol 2021;48:71-6 https://doi.org/10.5010/JPB.2021.48.2.71
© 2021 J Plant Biotechnol