Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 2.

Table. 2.

Information on primers and restriction enzymes used to generate S. acaule specific markers

Marker name Region Sa Primer sequence Size (bp)b REc
SA_InDel_3 trnG-rnfM(Intergenic) F TCAATGGATTCATGATAAAG 742 as
R TTTATGAAATTCAATAATAAAGC

SA_SNP_7 ccsA(Intragenic) F ATTTCCTTTTCGATCGTTTC 588 HaeIII
R TTGAATCAATTGGGACCTG

aF and R indicate forward and reverse strand of primers.

bThe expected sizes of PCR fragments are measured based on the sequence of S. acaule.

cRestriction enzyme generating S. acaule-specific marker. ‘as’ indicates allele-specific marker.

J Plant Biotechnol 2022;49:178-86 https://doi.org/10.5010/JPB.2022.49.3.178
© 2022 J Plant Biotechnol