Journal of Plant Biotechnology : eISSN 2384-1397 / pISSN 1229-2818

Table. 2.

Table. 2.

Primers used for detecting the viruses and viroids causing infections in persimmon

Virus name Primer name Oligonucleotide sequence (5′ to 3′) Product size Reference
PeCV PeCV-F TTCCAATGGCAGACCAAGG 526 bp Cho et al. (2016)

PeCV-R TGT GTA GGT CGG ATG ACG
PeLV Chry-f CGATCCACTGACCTGATCAAC 251 bp Ito et al. (2013)

272568r TAGAGCACGCGCAAATACTC
PeVA PeVAfor AGGATCATTACAAAATCCGTGAGG 250 bp Morelli et al. (2014)

PeVArev TTCCCGAAAGACAATCTGTCCC
PeVB BF1 AATACGCAAGCGATTCCCGA 541 bp The present study

BR1 CATTCCCAACTAGTCGAGTC
AFCVd AFCVd-C1 GCCCGCAGGGAAAAATAGGA 355 bp Nakaune and Nakano (2008)

AFCVd-H1 GCCCGGTCGTGGATACCTAG
CVd-VI CVdOS-C1 CGACAGGTGAGTCTCCTTGC 330 bp Nakaune and Nakano (2008)

CVdOS-H1 TCGTCGACGAAGGCATGTGA
PVd PVd-C1 CGGCAGGGAGCCTTGCGAAC 396 bp Nakaune and Nakano (2008)

PVd-H1 AGCTCGGGGCTGGAGCTTGG
PVd2 PVd2 2-4(F) GTCGTCGGATGGCCTCCGAG 358 bp The present study

PVd2 2-3(R) TGAAGCTCCCCGTGACGAGC
J Plant Biotechnol 2022;49:193-206 https://doi.org/10.5010/JPB.2022.49.3.193
© 2022 J Plant Biotechnol