search for




 

Physiological and molecular characterization of two inbred radish lines with different bolting times
Journal of Plant Biotechnology 2015;42:215-222
Published online September 30, 2015
© 2015 The Korean Society for Plant Biotechnology.

Hyun Ji Park1, Won Yong Jung1, Sang Sook Lee1, Joo won Lee1, Youn-Sung Kim2, and Hye Sun Cho1,*

1Sustainable BioResource Research Center, Korea Research Institute of Bioscience & Biotechnology, Daejeon 305-806, Korea,
2Department of Biotechnology, NH Seed, Anseong, 463-824, Korea
Correspondence to: H. S. Cho e-mail: hscho@kribb.re.kr
Received June 12, 2015; Revised July 17, 2015; Accepted July 20, 2015.
Abstract

적요

본 연구는 무의 개화가 지연되는 형질을 갖는 ‘NH-JS1’과 조기개화 형질을 가진 ‘NH-JS2’계통을 대상으로 춘화처리에 의한 무의 개화 특성을 조사하였으며, 이러한 특성을 유발하는 개화관련 유전자의 발현 수준을 분석하였다. NH-JS1 과 NH-JS2 두 계통 모두 춘화처리가 없는 조건에서는(23±1°C, 12시간 광조건/12시간 암조건) 90일 동안 생육하였을 때는 개화하지 않았으며, NH-JS1계통의 경우, 개화 유도를 위해서는 최소 25일의 춘화처리가 필요하며, NH-JS2계통은 15일의 춘화처리에 의해 개화가 유도되는 특성을 보여 주었다. 또한, NH-JS1계통은 로제트 잎이 9장 이상일 때, NH-JS2계통은 7장 이상일 때 추대가 형성됨을 확인 할 수 있었다. 춘화처리에 의한 개화 관련 유전자들의 유전자발현을 분석한 결과, 개화억제 유전자인 FLCFRI의 발현은 개화가 지연되는 계통인 NH-JS1에서 높은 반면, 개화를 촉진하는 유전자인 SOC1, LHY 그리고 CO의 발현은 조기개화 계통인 NH-JS2에서 높게 나타났다. 춘화처리에 의해 FLC의 발현억제를 유지하는 VRN1VRN2도 NH-JS1 계통에서 2배 이상 높게 발현됨을 확인하였다. 본 연구결과는 춘화처리 시 무의 개화관련 유전자들의 발현과 개화특성이 관련되어 있음을 시사하며, 이를 바탕으로 육종분야에서 무의 개화시기가 조절된 품종을 개발하는데 도움이 될 것으로 예상된다.

The radish (Raphanus sativus L.) is an important Brassicaceae root vegetable crop worldwide. Several studies have been conducted concerning radish breeding. There are major challenges to prevent premature bolting in spring plantings. Here, we performed the characterization of two inbred radish lines which vary in bolting time. “Late bolting radish” (NH-JS1) and “early bolting radish” (NH-JS2) were generated by a conventional breeding approach. The two inbred lines showed different bolting phenotypes depending on vernalization time at 4°C. NH-JS1, the late bolting radish, was less sensitive to cold treatment and the less sensitivity was inversely proportional to the duration of the vernalization. We also measured gene expression levels of the major bolting time related genes in the NH-JS1 and NH-JS2 lines. RsFLC1 plays a central role in the timing of flowering initiation. It is a strong repressor and it’s transcript is highly expressed in NH-JS1 compared to NH-JS2 under no treatment and vernalization conditions. RsFRI, a positive regulator of RsFLC, is also highly expressed in NH-JS1 compared to NH-JS2 regardless of vernalization. In contrast, RsSOC1, suppressed by FLC as a floral integrator gene, showed the most difference, a 5-fold increase, between NH-JS1 and NH-JS2 under vernalization conditions. From these results, we conclude that NH-JS1 showed a late flowering phenotype after cold treatment due to the expression differences of flowering time regulator genes rather than difference sensitivity to cold. These results may be useful to understand the control mechanisms of flowering time and may help identify molecular markers for selecting late bolting trait in radish.

Keywords : Radish, Bolting time, Vernalization, FLC, SOC
서론

무(Raphanus sativus L.)는 십자화과에 속하는 식물로서 잎뿐만 아니라 비대하게 생장하는 뿌리까지 식용 가능한 대표적인 뿌리채소이며, 배추와 함께 김치의 주요 구성 성분이다. 최근에는 성분분석을 통해 항암작용을 하는 글루코라파닌(Glucoraphanin)과 비타민C 등 다양한 항산화 물질의 함량이 높은 것으로 알려지며 인체에 유용한 작물로 인식되고 있다(Lee and Lee 2006; Higdon et al. 2007). 무는 전 세계적으로 각 나라의 기후와 기호에 맞게 뿌리의 색이나 형태가 다양한 품종이 재배되고 있다. 특히 동아시아의 한국, 중국 및 일본에서는 주로 흰색의 크기가 크고 긴 뿌리 형태의 무를 많이 재배하고 있으며, 파종시기에 따라 가을에 파종하여 겨울 전에 수확하는 가을 무와 봄에 파종하여 여름 전에 수확하는 봄 무로 구분한다. 그러나 무의 생육기간 중 어린 시기의 식물이 조기 개화(조추대)하는 현상이 문제가 되고 있으며 저온(1?~?10°C)에 장기간 노출 되거나 낮의 길이가 길어지는 등 여러 환경적 요인의 변화에 의해 조기 개화가 야기된다.

이러한 현상은 무의 생산성 및 상품성 저하에 직접적인 요인이 되므로 육종을 통한 개화시기를 늦추는(만추대) 무의 품종 개발이 요구되고 있다.

식물의 개화는 온도, 광주기, 자발적 경로 및 호르몬 등 다양한 신호에 의해 유도되며 이런 변화들에 의해 개화시기 또한 영향을 받는다(Chouard 1960; Bernier et al. 1993; Reeves and Coupland, 2000). 무 역시 다른 십자화과 식물에서와 같이 장기간의 저온에 노출(Vernalization; 춘화처리)에 의해 개화가 촉진된다고 알려져 있다(Engelen-Eigles and Erwin 1997). 춘화처리에 의한 개화기작은 모델식물인 애기장대 연구를 통해서 잘 알려져 있다. 그 중 FLC (FLOWERING LOCUS C)는 중요 개화억제 유전자로서 영양생장 단계에서는 발현이 높게 유지되어 개화를 억제하다가 춘화처리와 자발적경로(Autonomous pathway)에 의해 발현이 줄어들어 개화를 유도하게 된다(Michaels and Amasino, 1999). FRI (FRIGIDA)는 FLC의 발현을 촉진하는 상위단계 유전자로 알려져 있으며, floral integrator인 SOC1 (SUPPRESSOR OF OVER EXPRESSION OF CONSTANS 1)과 FT (FLOWERING LOCUS T)는 FLC에 의해 발현이 억제된다(Michaels and Amasino 1999; Bastow et al. 2004). 또한 VRN2 (VERNALIZATION 2)는 chromatin remodeling에 관여하여 춘화처리 후 FLC의 발현 억제를 유지시키는 역할을 한다(Amasino 2004, 2010). 특히 SOC1은 광, 온도, 호르몬, 등 여러 신호에 의해 공통적으로 발현이 조절되는 유전자로서 식물이 영양생장 단계에서 생식생장 단계로 전환되는데 중요한 역할을 한다(Immink et al. 2012; Torti and Fornara 2012). 이에 따라 여러 작물에서 형질전환 식물체를 이용한 개화 관련 유전자들의 기능분석 및 개화가 억제되거나 촉진된 품종 개발에 대한 연구가 이루어지고 있다. 그 예로, 배추의 FLC1FLC3 유전자를 과 발현시켜 개화가 지연된 계통을 선발하였으며, 배추의 SOC1을 유채에 도입 하였을 때 개화가 촉진됨을 보여준 보고가 있다(Tadege et al. 2001; Ding et al. 2013; Hong et al. 2013b). 그 외에도 포퓰러(P.deltoides), 잔디(L. perenne) 그리고 자작나무(B. pendula)등 여러 작물의 개화 관련 유전자들에 대한 연구가 보고되었으나(Hong et al. 2013a) 아직까지 무의 개화기작관련 연구는 거의 이루어지고 있지 않다. 무의 개화를 늦추기 위해서 일본의 Tokinashi 품종과 한국 품종을 교배하여 표현형을 관찰한 결과 개화는 늦어졌지만 뿌리가 가늘어지며 강도가 약해지는 문제점을 보여주었다(Curtis 2011). 이와 유사한 예로 GI 유전자 발현을 억제시킨 형질전환 무 품종을 개발하여 개화시기를 관찰한 결과, 대조 군에 비해 17-18일 개화가 늦어졌으나 생육상태가 저하되는 연구결과도 보고되었다(Curtis et al. 2002). 최근 보고된 바에 의하면 무는 세 종류의 FLC 개화억제 유전자를 가지고 있으며, 세 유전자 모두 애기장대에서 과 발현 되었을 때 개화가 지연됨을 보여주었다(Yi et al. 2014). 따라서 저온에 의한 조기개화 현상이 나타나지 않고 무의 뿌리 생육도 정상적으로 되는 품종을 개발하기 위해서는 다양한 접근방법을 통한 무 개화기작에 대한 연구가 전제되어야 한다.

이에 본 연구에서는 개화시기가 다른 조추대와 만추대 두 계통의 무를 대상으로 춘화처리 조건에 따른 개화 특성을 조사하였으며, 두 계통간 춘화처리에 반응하는 개화조절 유전자발현 분석으로 분자생물학적 차이를 조사하였다. 이러한 연구결과는 춘화처리에 의한 무 작물의 추대 시기와 이를 조절하는 유전자의 기능을 이해하는데 기여할 수 있을 것이다.

재료 및 방법

추대 형질 식물재료

농협종묘로부터 개화시기가 다른 두 계통의 무(Raphanus sativus L.) 종자를 분양 받았다. 추대가 늦게 형성되어 개화가 늦어지는 만추대 “NH-JS1” 계통과 추대가 일찍 형성되어 조기 개화하는 형질을 가진 조추대 “NH-JS2” 계통을 실험 재료로 이용하였다.

저온처리 조건 및 개화특성 조사

NH-JS1과 NH-JS2 계통 종자를 멸균된 원예용 상토에 파종한 뒤 발아를 위해 저온(4±1°C)에 암 상태로 3일간 방치 후 식물 배양실(23±1°C, 12시간 광조건/12시간 암조건)에서 4일 동안 발아시켰다. 춘화처리 기간에 따른 개화특성 조사를 위해 4일된 유식물체를 저온 배양실(4±1°C, 12시간 광조건/12시간 암조건)에서 15일, 25일, 35일, 45일 및 55일 동안 춘화처리 후 다시 정상조건의 식물 배양실에서 생육하였다. 그리고 춘화처리 후 정상조건에서 추대가 형성 되기까지의 일 수와 당시의 로제트(rosette) 잎 수 그리고 시간에 따라 추대가 형성되는 개체의 비율(추대형성률)을 조사하였다. 각 춘화처리 기간에 대해 각 20개체의 식물체를 대상으로 조사하였으며 이의 평균값을 계산하여 나타내었다.

유전자발현의 정량적 분석

개화 관련 유전자의 mRNA 발현 양을 분석하기 위하여 정량적 reverse transcription PCR (qRT-PCR) 방법을 이용하였다. NH-JS1과 NH-JS2 종자를 멸균한 원예용 상토에 파종하여 저온(4±1°C) 에서 암 상태로 3일간 방치 후 식물 배양실(23±1°C, 12시간 광 조건/12시간 암 조건)에서 2주 간 생육하였다. 2 주 된 식물체를 저온실(4±1°C, 12시간 광조건/12시간 암조건)에서 10일, 20일 그리고 35일 간 저온처리 후(0, 5, 10, 15, 20, 35일째 샘플링 하여 실험 하였으며 그 중 대표 값으로 0, 10, 20, 35일 샘플을 유전자발현에 사용)샘플링 하였다. 총 RNA는 저온처리 기간에 샘플링 한 식물체의 잎 조직에서 RNAiso Plus (TaKaRa, Tokyo, Japan)를 이용하여 추출하였다. 그리고 RNase-free DNase I (RQ1 RNase-Free DNase; Promega, Madison, USA)을 처리 후, 총 RNA 1-2 ?g으로부터 cDNA를 합성하였다(RevertAid First-strand cDNA Synthesis Kit; Fermentas, Burlington, Canada). 정량적 reverse transcription PCR은 CFX Connect™ Real-Time PCR Detection System (Bio-Rad, California, USA)과 SYBR Premix Ex Taq (TaKaRa)을 이용하여 수행하였다. 유전자 특이적인 프라이머(Table 1)를 제작하여 해당유전자의 발현 양을 확인하였으며, AtACT2 프라이머를 이용하여 template로 사용한 cDNA의 양을 정규화하였다.

List of primers used in quantitative reverse transcription PCR

Primer nameSequence (5’-3’)
RsFLC1-FAGTAGCCGACAAGTTACCTTCTC
RsFLC1-RTAGCTCTTGTTACGGAGAGGGCG
RsFRI-FTCTCCTCTTCAACCGTCAAGTTC
RsFRI-RCATGCTCCATTCACTCAGTATCG
RsSOC1-FCCAGCTCCAATATGCAAGATACC
RsSOC1-RTCTTCGTCACCTCTTCCACTTTC
RsVRN1-FTGTTTGAAGACCTTGAAGACGAAG
RsVRN1-RAACTCTGAAGAAAGGGTTTGTTGG
RsVRN2-FCCATCGTTTCTTCCTAGATGCTT
RsVRN2-RTATCTGTGCCATTGGGTAAACAG
RsFPA-FAAGGGCTACAAGGGAGGTTATTC
RsFPA-RTTTGACCTCATAGGGTTCCTCAT
RsLHY-FCTCCTCTACTTTCCCCAATCTCA
RsLHY-RGATCTTGCAGAGCTGTGTTCTGT
RsCO-FCAGAGAAGAGAGCTGTGTTGGTTC
RsCO-RGGTGTATAGTCTCTTTGGGCGTCT
AtACT2-FGGAAGGATCTGTACGGTAAC
AtACT2-RTGTGAACGATTCCTGGACCT

결과 및 고찰

두 품종의 개화 표현형

개화시기가 다른 NH-JS1 과 NH-JS2 두 계통간 개화시기를 조사하기 위하여 배양실 조건에서 4일간 발아 시킨 유식물체를 저온실에서 25일간 춘화처리 한 후, 다시 배양실 조건에서 생육하며 개화시기 및 추대 형성시기를 관찰하였다. 두 계통은 저온 처리에 무관하게 잎의 크기와 형태에서도 약간의 차이를 나타내었는데 전체적인 잎의 표면적은 NH-JS2가 NH-JS1 보다 컸으며 NH-JS1은 잎의 테두리에 돌기가 많이 형성되었고 잎의 두께도 두꺼웠다. 뿌리의 형태는 NH-JS1이 NH-JS2 보다 굵고 단단한 특징을 나타내었다. 이러한 생리적인 차이는 저온 처리 후 NH-JS2가 조기 추대되면서 뿌리 발달이 저해되어 더욱 큰 차이를 나타내었다. 두 계통은 춘화처리(4±1°C, 25일)가 끝난 후 22일째에 뚜렷한 개화 시기의 차이를 보여주었다: NH-JS1 계통은 추대가 형성되지 않아 개화가 일어나지 않는 반면, NH-JS2 계통은 이미 추대가 형성되어 개화가 진행되었다(Fig. 1A). 그러나 춘화처리를 하지 않고 약 90일간 배양실 조건에서 생육한 경우에는 두 계통 모두 개화가 일어나지 않았다. 따라서 NH-JS1 과 NH-JS2 두 계통 모두 춘화처리에 의해 개화가 유도/촉진됨을 알 수 있었다. 두 계통간의 개화특성을 정량적으로 구분하기 위해 각 20개체의 식물체를 대상으로 춘화처리 기간을 15일부터 55일까지 10일 간격으로 다양한 조건에서 추대가 형성 되기까지의 일 수와 로제트 잎 수를 측정하여 평균값을 계산하였다. 그 결과 NH-JS1과 NH-JS2 두 계통 모두 춘화처리 기간이 길어질수록 추대형성이 촉진되었다. NH-JS1 계통은 15일 간 춘화처리 했을 경우에는 40일 후에 추대가 형성되었지만, 55일 간 춘화처리를 하였을 때에는 22일 후에 추대가 형성되었다. 반면, NH-JS2 계통은 15일 춘화 처리시 30일에서 55일 춘화 처리시 15일로 추대형성 기간이 감소하였으며, NH-JS1 계통에 비해 추대형성 기간이 약 5-10일 빠른 특징을 보였다(Fig. 1B). 또한 개화시기와 밀접한 관련성이 있는 특성 중에 하나인 로제트 잎의 수(Engelen-Eigles and Erwin 1997)를 조사하였다. 개화가 일찍 진행되는 NH-JS2 계통은 로제트 잎 수가 평균 6장 일 때 추대가 형성되었으며, NH-JS1 계통은 NH-JS2 보다 약 3장 정도 많은 9장 일 때 추대가 형성되었다. 그리고 두 계통 모두 추대형성 시기에 식물체의 로제트 잎 수가 춘화처리 기간(15일?~?55일)에 크게 영향을 받지 않는 결과를 보였다(Fig. 1C). 그러나 두 계통 모두 춘화처리를 하지 않은 조건에서 로제트 잎 수가 15장 이상이 되어도 추대형성이 안되었다는 점을 고려해 볼 때, 춘화처리에 의해 추대 형성시기의 로제트 잎의 수가 감소하는 기존의 연구 결과들(Fowler et al. 1996; Sheldon et al. 2000; Tadege et al. 2001)과 일치하고 있음을 알 수 있다.

Fig. 1.

Characterization of flowering times in two inbred radish lines. Plants of two inbred lines were grown in a normal growth room (23°C) for 2 weeks and transferred to cold room (4°C) for vernalization treatments. After each vernalization period, plants were re-located to a normal growth room. (A) Flowering phenotypes of two inbred radish lines 22 days after vernalization treatments (at 4°C for 25 days). (B, C) Analysis of days and number of rosette leaves at the bolting time. Twenty plants of each inbred line were used for one time-point experiment. V, vernalized days. Bars = 5 cm


춘화처리 기간에 따른 개화특성 조사

NH-JS1과 NH-JS2 계통간 춘화처리 기간에 따른 개화시기의 영향을 조사하기 위해 춘화처리를 15일, 25일, 35일, 45일 그리고 55일동안 처리한 후 각 20 개체의 추대형성률과 로제트 잎의 수를 조사하였다. Fig. 2에서는 각 춘화처리 기간당 20개체를 대상으로 조사한 값을 그래프로 나타내었다. 모든 춘화처리 기간에서 NH-JS2 계통이 NH-JS1 계통보다 추대형성이 일찍 되거나 추대가 형성된 개체가 많았으며, 35일 이상 춘화처리를 한 경우에는 두 품종 모두 30일 후에 추대형성률이 100%에 도달하였다. 특히 15일 간 춘화처리를 한 경우, NH-JS2 계통은 40일 후 모든 개체에서 추대가 형성된 반면, NH-JS1 계통은 40일 후 추대형성률이 5%에 그쳤으며 60일후에도 20% 이하를 유지하였다(Fig. 2A). 이 결과를 통해 NH-JS1 계통의 개화는 4°C에서 25일 이상의 춘화처리 기간이 필요하며, NH-JS2 계통은 15일간의 춘화처리만으로도 개화가 유도됨을 확인하였다. 뿐만 아니라 추대형성 시기에 로제트 잎 수에서도 두 계통간 차이를 나타내었다. 추대형성이 되지 않을 경우 계속 영양생장을 지속하기 때문에 로제트 잎 수는 증가하게 된다. 따라서 춘화처리를 15일간 한 경우, 추대형성률이 낮은 NH-JS1 계통의 로제트 잎 수는 점차 증가하여 60일째에 12장이 되었으며, NH-JS2 계통은 40일째 7장으로 60일이 되어도 계속 유지되었다. 이는 40일째부터 NH-JS2 계통의 모든 개체가 추대가 형성되어 더 이상 영양생장이 지속되지 않기 때문으로 사료된다. 또한 NH-JS1 계통은 NH-JS2 계통보다 춘화처리 후 10일째부터 잎 수가 1-2장 많았으며 60일 후에는 그 차이가 3-4장으로 증가하는 경향을 보였다(Fig. 2B). 종합해보면, NH-JS1 만추대 계통은 춘화처리를 적어도 25일 이상 유지시켰을 때 그리고 식물체의 로제트 잎 수가 9장이 되었을 때 추대가 형성되는 반면, NH-JS2 조추대 계통은 춘화처리 15일 이상 조건에서 로제트 잎 수가 7장일 때 평균적으로 추대가 형성되어 개화가 진행됨을 알 수 있었다. Kayamak (2010)은 무 6개 품종을 대상으로 토양에서 춘화처리 기간에 따른 추대형성률과 추대까지의 일 수를 조사하였다(Kayamak and Guvenc 2010). 6 품종은 평균적으로 15일간 춘화 처리한 경우 약 40일 후 추대가 형성되며, 춘화처리를 20일 하였을 때 평균 추대 형성률은 81% 였다. 이러한 보고와 비교해 보면 NH-JS2 계통이 저온에 반응하는 평균적인 무의 개화특성과 일치함을 알 수 있다. 반면 NH-JS1 계통은 저온에 둔감하게 반응을 보인 Siyah 품종의 개화특성과 유사하였다. 따라서 NH-JS2 계통이 NH-JS1 계통보다 저온에 민감하게 반응하여 춘화처리에 의한 개화가 더 빠르게 진행되었음을 유추해 볼 수 있다. 이로써 저온에 둔감하게 반응하는 NH-JS1은 Siyah처럼 무의 개화를 지연시키는 유전적 특성을 보유하는 계통으로 여겨지며, NH-JS1 과 NH-JS2 두 계통이 무 작물 개화연구의 중요한 재료로 활용될 수 있음을 확인하였다.

Fig. 2.

Differences in bolting time and leaf number in response to vernalization treatments of two inbred radish lines. The effects of the vernalization period on bolting time and leaf number in two inbred radish lines. These plants were grown in normal growth room (23°C) for 2 weeks and transferred to cold room (4°C) for the vernalization treatment. After each vernalization period, plants were re-located to normal growth room. (A) The percentage of bolted plants and (B) the number of rosette leaves over 60 days was recorded. Twenty plants of each inbred line were used for one time-point experiment. V, vernalized days


춘화처리에 의한 개화 관련 유전자의 유전자발현 분석

NH-JS1과 NH-JS2 계통이 춘화처리에 의해 다른 개화특성을 나타내었기 때문에 그 원인을 알아보고자 식물의 개화조절 기작에 관여하는 주요 유전자들(FLC, FRI, SOC1, VRN1, VRN2, FPA, LFY, CO)의 유전자발현을 분석하였다. 최근 Yi (2014)의 보고에 의하면, 무는 세 종류의 FLC 유전자를 가지고 있으며 개화조절에 FLC1과 FLC3 유전자가가 주요 역할을 수행함이 확인되었다. 본 연구에서는 FLC1 유전자를 대상으로 유전자발현을 분석하였다(Yi et al. 2014). FLC1 유전자발현은 NH-JS1과 NH-JS2 두 계통 모두에서 춘화처리에 의해 발현이 감소하는 기존의 연구결과와 같은 경향을 보였으며, 춘화처리를 하지 않은 조건(0일)에서 NH-JS1 계통이 NH-JS2 계통보다 약 2배 정도 발현이 높았으며 춘화처리 기간에도 그 차이는 계속 유지되었다(Fig. 3). 또한 FLC1의 발현을 촉진하는 상위단계 FRI 유전자발현도 NH-JS1 계통이 NH-JS2 계통보다 약 2배 높은 발현을 보였다(Fig. 3). 가장 흥미로운 것은 FLC에 의해 발현이 억제되는 floral integrator인 SOC1 유전자는 두 계통간 춘화처리 기간에 따라 발현이 증가되는 경향은 같았으나, 두 계통간 발현양은 NH-JS2 계통이 춘화처리 전과 후 모두 NH-JS1 계통 보다 약 5배 높게 나타났다(Fig. 3). 또한, 춘화처리에 의한 FLC 발현억제를 유지하는데 관련된 VRN1VRN2 역시 NH-JS2 계통에서 2-4배 정도 발현이 높은 것을 확인하였다(Fig. 3). 또한 광주기성 개화기작의 차이를 알아보기 위하여 이와 관련된 개화유도 유전자인 LHY (LATE ELONGATED HYPOCOTYL)와 CO (CONSTANS)의 발현을 확인해 보았다. 두 유전자 모두 춘화처리 10일까지는 NH-JS2 계통이 2-3배 높은 발현을 보였으나 20일 이후에는 두 계통간의 발현이 비슷해지는 양상을 나타냈다(Fig. 3). 반면, 자발적경로 개화기작에 관련된 유전자로 FLC의 발현을 억제하는 것으로 알려진 FPA는 두 계통간 유전자발현 차이를 보이지 않았다(Fig. 3). 위와 같은 개화관련 유전자발현 분석 결과를 통해 애기장대 개화 조절기작에 관련된 유전자들이 무 NH-JS1과 NH-JS2 추대 계통 형질간 춘화처리 조건에서 유사하게 반응함을 확인할 수 있었으며, 두 계통간 개화관련 유전자의 발현차이가 개화시기에 영향을 주었을 것으로 추측할 수 있다.

Fig. 3.

Quantitative reverse transcription PCR analysis of flowering pathway regulated gene expression in two inbred radish lines. The expression levels of flowering time regulating genes in two inbred lines. Total RNA was extracted from leaves of plants grown in a normal growth room (23°C) for 2 weeks and transferred to cold room (4°C). The relative expression levels are represented after normalizing the values using a pair of AtACT2 specific primers


지금까지 여러 작물에서 개화를 늦추거나 촉진하기 위한 다양한 연구가 시도되어 왔다. 유채(Brassica napus L.)에서는 개화시기가 다른 여러 품종을 대상으로 FLC 유전자의 발현을 조사한 결과 개화가 빨리 일어나는 품종에서 FLC의 발현이 다른 품종보다 매우 낮음을 확인하였다(Tadege et al. 2001). SOC homolog 유전자를 과 발현시킨 난(Dendrobium orchid)이 야생형 보다 개화가 촉진된 결과가 보고되었고, 피튜니아(Petunia hybrida, Solanaceae)에 유전자침묵(gene silencing) 방법으로 SOC1 유전자의 발현을 억제시켰을 때 개화가 지연되었음을 보여준 연구결과도 있다(Ding et al. 2013; Preston et al. 2014). 따라서 무 작물에서도 본 연구에 의한 개화관련 유전자의 발현정도와 개화시기와의 관련성의 연구결과에 기초해서, 개화형질 계통간 유전체/발현체 비교분석이 요구되며 이러한 연구결과로부터 무의 개화 조절기작을 이해하고 개화 형질이 개선된 신 품종개발의 원천기술을 확보할 수 있을 것이다.

References
  1. Amasino R. (2004) Vernalization, competence, and the epigenetic memory of winter. Plant Cell 16, 2553-2559.
    Pubmed KoreaMed CrossRef
  2. Amasino R. (2010) Seasonal and developmental timing of flowering. Plant J 61, 1001-1013.
    Pubmed CrossRef
  3. Bastow R, Mylne JS, Lister C, Lippman Z, Martienssen RA, and Dean C. (2004) Vernalization requires epigenetic silencing of FLC by histone methylation. Nature 427, 164-167.
    Pubmed CrossRef
  4. Bernier G, Havelange A, Houssa C, Petitjean A, and Lejeune P. (1993) Physiological Signals That Induce Flowering. Plant Cell 5, 1147-1155.
    Pubmed KoreaMed CrossRef
  5. Chouard P. (1960) Vernalization and its Relations to Dormancy. Annual Review of Plant Physiology 11, 191-238.
    CrossRef
  6. Curtis IS. (2011) Genetic engineering of radish: current achievements and future goals. Plant Cell Rep 30, 733-744.
    Pubmed CrossRef
  7. Curtis IS, Nam HG, Yun JY, and Seo KH. (2002) Expression of an antisense GIGANTEA (GI) gene fragment in transgenic radish causes delayed bolting and flowering. Transgenic Res 11, 249-256.
    Pubmed CrossRef
  8. Ding L, Wang Y, and Yu H. (2013) Overexpression of DOSOC1, an ortholog of Arabidopsis SOC1, promotes flowering in the orchid Dendrobium Chao Parya Smile. Plant Cell Physiol 54, 595-608.
    Pubmed CrossRef
  9. Engelen-Eigles G, and Erwin JE. (1997) A model plant for vernalization studies Scientia Horticulturae. 70, 197-202.
    CrossRef
  10. Fowler DB, Chauvin LP, Limin AE, and Sarhan F. (1996) The regulatory role of vernalization in the expression of low-temperature-induced genes in wheat and rye. Theor Appl Genet 93, 554-559.
    Pubmed CrossRef
  11. Higdon JV, Delage B, Williams DE, and Dashwood RH. (2007) Cruciferous vegetables and human cancer risk: epidemiologic evidence and mechanistic basis. Pharmacol Res 55, 224-236.
    Pubmed KoreaMed CrossRef
  12. Hong J, Kim J, Lee S, Suh E, Chang A, Koo B, and Lee Y. (2013a) Flowering Time Genes and Application in Crops. Korean J Breed Sci 45, 303-310.
    CrossRef
  13. Hong J, Kim S, Kim K, Kwon S, Kim J, Kim J, Lee S, and Lee Y. (2013b) Overexpression of a Brassica rapa MADS-box gene, BrAGL20 , induces early flowering time phenotypes in Brassica napus. Plant Biotechnol Rep 7, 231-237.
    CrossRef
  14. Immink RG, Pose D, Ferrario S, Ott F, Kaufmann K, Valentim FL, de Folter S, van der Wal F, van Dijk AD, Schmid M, and Angenent GC. (2012) Characterization of SOC1’s central role in flowering by the identification of its upstream and downstream regulators. Plant Physiol 160, 433-449.
    Pubmed KoreaMed CrossRef
  15. Lee S-O, and Lee I-S. (2006) Induction of Quinone Reductase, The Phase 2 Anticarcinogenic Marker Enzyme, in Hepa1c1c7 Cells by Radish Sprouts, Raphanus sativus L. Journal of Food Science 71, S144-S148.
    CrossRef
  16. Michaels SD, and Amasino RM. (1999) FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11, 949-956.
    CrossRef
  17. Preston JC, Jorgensen SA, and Jha SG. (2014) Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia. PLoS One 9, e96108.
    CrossRef
  18. Reeves PH, and Coupland G. (2000) Response of plant development to environment: control of flowering by daylength and temperature. Curr Opin Plant Biol 3, 37-42.
    CrossRef
  19. Sheldon CC, Rouse DT, Finnegan EJ, Peacock WJ, and Dennis ES. (2000) The molecular basis of vernalization: the central role of FLOWERING LOCUS C (FLC). Proc Natl Acad Sci U S A 97, 3753-3758.
    Pubmed KoreaMed CrossRef
  20. Tadege M, Sheldon CC, Helliwell CA, Stoutjesdijk P, Dennis ES, and Peacock WJ. (2001) Control of flowering time by FLC orthologues in Brassica napus. Plant J 28, 545-553.
    Pubmed CrossRef
  21. Torti S, and Fornara F. (2012) AGL24 acts in concert with SOC1 and FUL during Arabidopsis floral transition. Plant Signal Behav 7, 1251-1254.
    Pubmed KoreaMed CrossRef
  22. Yi G, Park H, Kim J-S, Chae WB, Park S, and Huh JH. (2014) Identification of three FLOWERING LOCUS C genes responsible for vernalization response in radish (Raphanus sativus L.). Hort Environ Biotechnol 55, 548-556.
    CrossRef


June 2018, 45 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles

Funding Information
  • CrossMark
  • Crossref TDM