search for




 

Identification of multiple key genes involved in pathogen defense and multi-stress tolerance using microarray and network analysis
J Plant Biotechnol 2016;43:347-358
Published online September 30, 2016
© 2016 The Korean Society for Plant Biotechnology.

Hyeongmin Kim, Suyun Moon, Jinsu Lee, Wonsil Bae, Kyungho Won, Yoon-Kyeong Kim, Kwon Kyoo Kang*, and Hojin Ryu*

Department of Biology, Chungbuk National University, Cheongju, 28644, Korea,
Pear Research Institute, National Institute of Horticultural & Herbal Science, Rural Development Administration, Naju, 58126, Korea,
Department of Horticulture, Hankyong National University, Ansung, Gyeonggi-do 456-749, Korea
Correspondence to: e-mail: hjryu96@chungbuk.ac.kr
e-mail: kykang@hknu.ac.kr
Received August 16, 2016; Revised August 16, 2016; Accepted August 27, 2016.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Brassinosteroid (BR), a plant steroid hormone, plays key roles in numerous growth and developmental processes as well as tolerance to both abiotic and biotic stress. To understand the biological networks involved in BR-mediated signaling pathways and stress tolerance, we performed comparative genome-wide transcriptome analysis of a constitutively activated BR bes1-D mutant with an Agilent Arabidopsis 4 x 44K oligo chip. As a result, we newly identified 1,091 (562 up-regulated and 529 down- regulated) significant differentially expressed genes (DEGs). The combination of GO enrichment and protein network analysis revealed that stress-related processes, such as metabolism, development, abiotic/biotic stress, immunity, and defense, were critically linked to BR signaling pathways. Among the identified gene sets, we confirmed more than a 6-fold up-regulation of NB-ARC and FLS2 in bes1-D plants. However, some genes, including TIR1, TSA1 and OCP3, were down-regulated. Consistently, BR-activated plants showed higher tolerance to drought stress and pathogen infection compared to wild-type controls. In this study, we newly developed a useful, comprehensive method for large-scale identification of critical network and gene sets with global transcriptome analysis using a microarray. This study also showed that gain of function in the bes1-D gene can regulate the adaptive response of plants to various stressful conditions.

Keywords : Brassinosteroid, Plant stress tolerance, Pathogen, Network analysis
서언

브라시노스테로이드는 식물에서 발견되는 유일한 스테로이드 계통의 호르몬으로 식물의 길이 생장, 개화, 뿌리 발달, 관다발 발달, 광 형태 형성, 과실의 성숙 및 후숙, 스트레스 저항성 증진 등 life cycle에 있어서 매우 중요한 생리 활성 조절 물질이다(Kim and Wang 2010; Kutschera and Wang 2012; Wang et al. 2012). 최근 들어 애기장대 및 벼를 중심으로 브라시노스테로이드에 대한 연구는 식물세포내에서 어떻게 인식이 되고, 신호전달되어 다양한 생리현상을 일으키는지에 대한 중요한 정보를 제공하고 있다(Choudhary et al. 2012). 브라시노스테로이드는 생체막에 존재하는 수용체 복합체인 BRI1/BAK1 의해 인식이 되어 신호 개시가 일어난다. 브라시노스테로이드의 인식은 복합체를 이루고 있는 두 수용체 단백질 BRI1과 BAK1에 인산화를 유도하게 되고, BSU1 탈인산화효소의 활성화를 통해 신호전달의 주요 억제인자 BIN2의 기능을 억제하게 된다(Choudhary et al. 2012; He et al. 2002; Li and Chory 1997; Li et al. 2002; Vriet et al. 2012; Wang et al. 2012). BIN2는 신호가 없을 때 브라시노스테로이드 신호전달의 주요 BES1과 BZR1의 인산화를 유도하게 되고, 인산화 된 전사인자들은 세포질로 이동하여 유전자의 발현을 유도하지 못하게 됨으로써 신호를 억제하게 된다(Ryu et al. 2007; 2010a; 2010b). 하지만 신호전달의 활성화를 통해 BIN2의 기능이 억제되게 되면, BES1/BZR1의 탈인산화가 유도되게 되고, 탈인산화 된 전사인자들은 핵으로 이동하게 된다(Gampala et al. 2007; Ryu et al. 2007). 탈인산화에 의해 핵으로 이동된 전사인자들은 TPL-HDA19 단백질과 복합체를 형성하여 다양한 브라시노스테로이드 신호전달에 관여하는 유전자들의 발현을 조절한다고 하였다(Oh et al. 2014; Ryu et al. 2014). 실제로 전사인자 BES1과 BZR1에 진화적으로 보존된 PEST 도메인에 존재하는 Proline 잔기가 Leucine으로 변경된 돌연변이체(bes1-Dbzr1-1D)에서는 인산화가 잘 이뤄지지 않으며, 아주 강력한 브라시노스테로이드 신호가 전달된다고 보고하였다(Wang et al. 2002; Yin et al. 2002). 이러한 신호전달 메커니즘에 의해 활성화되는 유전자들은 주로 식물의 발달, 브라시노스테로이드 생합성, 호르몬의 신호전달 상호작용 등에 관여하는 것으로 알려져 있을 뿐 많은 정보가 없는 실정이다. 최근 들어 분자생리학적 연구 기법을 통해 브라시노스테로이드가 다양한 환경스트레스 및 병 저항성에 관여하고 보고 되었다(Choudhary et al. 2012). 토마토, 벼, 애기장대와 같은 식물에 외부에서 브라시노스테로이드를 처리하게 되면 염, 가뭄, 열, 냉해, 산화 등과 같은 비생물학적 스트레스에 대한 광범위 저항성이 향상되었다(Divi and Krishna 2009; Divi et al. 2010; Gendron and Wang 2007; Kagale et al. 2007). 이러한 브라시노스테로이드의 생리적 특성을 이용하여 농업현장에서 직접 적용하는 농법이 시도되고 있으나, 호르몬 합성 비용 및 생합성과정상의 어려움 때문에 널리 전파되고 있지 않다. 이러한 사실을 종합해볼 때 외부에서 공급되는 브라시노스테로이드는 식물이 지니는 canonical 신호전달 체계를 이용하여 광범위 스트레스 내성을 증대시키는 것으로 설명하고 있다. 현재까지 브라시노스테로이드에 의해 조절되는 다양한 식물의 생장과 발달에 관여하는 유전자들의 분리 동정은 이뤄졌지만, 이들 처리를 통해 광범위 스트레스 내성에 관여하는 유전자들에 대한 연구는 거의 이뤄지지 않고 있다. Microarray 및 Next Generation Sequencing (NGS)을 기반으로 한 빅 데이터 분석은 단편적인 유전자들의 발현 조절 양상을 넘어서 시스템적으로 어떻게 유전자들의 발현 양상이 변화하는가를 확인함으로써 다양한 변화를 확인할 수 있다 (Harnsomburana et al. 2011; Lee et al. 2015a). 따라서 본 연구에서는 애기장대에서 브라시노스테로이드 신호전달이 활성화 되어 있는 bes1-D 돌연변이체의 microarray 분석을 수행하여 전사체 레벨에서 유전자 발현 양상을 분석하였다. 발현 차이를 보인 1,091개유전자들은 Gene Ontology와 단백질 네트워크 분석 등을 통해 브라시노스테로이드 신호전달에 의해 조절되는 네트워크 유전자들 및 광범위 스트레스 내성에 관여하는 주요 유전자들을 동정하여 고찰하였다.

재료 및 방법

식물 생장 및 Total RNA 분리, cDNA 합성 및 qRT-PCR

본 실험에 사용한 애기장대(Arabidopsis thaliana)는 야생형 En-2 및 브라시노스테로이드 활성 돌연변이 bes1-D 계통을 포트에 파종하여 22°C, 16hr 명조건/8hr 암조건의 온실에서 생장시켰다. Total RNA 분리는 어린 잎으로부터 Total RNA extraction kit (Intron Biotech. Korea)를 이용하여 제공된 실험 방법에 따라 분리하였다. 분리된 total RNA 는 MS 3000 Nano-drop (Bio-red, USA)으로 농도 및 QC를 진행하여 실험에 공시하였다. Total RNA는 Microarray 분석에 이용하였다. Real-time quantitative PCR을 수행하기 위해 Oligo (dT) primer를 사용한 cDNA를 합성하였다. cDNA 는 1st strand synthesis KIT (Enzynomics, Korea)를 이용하여 합성하였다. Total RNA 의 2 ㎍을 이용하였으며 합성 조건은 50°C에서 60분 동안 반응시킨 후 1분간 얼음에 냉각시켜 first strand cDNA 합성을 완성하였다. qRT-PCR 분석은 cDNA를 사용하여 SYBR Green Real-time PCR Master Mix (Applied Biosystem, USA)를 사용하여 Quant Studio 3 (Applied Biosystem, USA) 장비를 사용하여 권장하는 방법에 의해 수행하였다. 본 연구에 사용된 primer sequence 정보는 Table 5에 나열하였다. Threshold cycle (Ct) 값에 의한 발현량 분석은 2−ΔΔCt으로 계산하였으며, ΔΔCt은 처리식물체의(Ct target gene−Ct actin gene) − 대조식물체의(Ct target gene− Ct actin gene)에 의해 계산하여 수치화 하였다(Livak and Schmittgen 2001).

List of up-regulated DEGs

UP-regulated gene list(562)
AT1G72930AT3G57470AT5G27110AT5G50100AT4G19030AT2G14820AT1G17960AT4G14450AT3G11385AT3G45680
AT5G64400AT2G14660AT4G10800AT5G24670AT5G27010AT1G30795AT3G16370AT3G07180AT3G62510AT2G14800
AT5G45500AT5G02500AT4G06627AT5G38020AT1G05440AT1G08165AT2G18170AT1G12845AT4G08620AT3G20130
AT2G25450AT5G37940AT1G31814AT4G13495AT1G05770AT5G58120AT2G38180AT1G61420AT1G23550AT2G26560
AT5G42850AT4G12310AT5G24350AT3G62530AT4G26140AT5G23930AT1G63540AT3G56080AT5G03390AT2G28830
AT3G60950AT4G13560AT1G53440AT3G13437AT3G18830AT4G31990AT2G19910AT4G10280AT2G15910AT3G03702
AT3G32120AT2G21860AT5G02670AT4G19520AT2G25460AT5G46470AT2G41190AT2G40300AT3G09450AT5G26320
AT2G27402AT5G59690AT3G07800AT5G60060AT4G23490AT5G06390AT4G29103AT4G00990AT2G30942AT4G23310
AT5G45490AT2G38620AT1G50290AT5G08630AT2G17240AT3G11930AT1G62910AT1G31335AT1G12080AT2G17280
AT5G45430AT2G05117AT1G01670AT4G16950AT5G37970AT3G45290AT3G14450AT1G76820AT1G10540AT4G30660
AT2G15555AT2G16530AT5G65207AT1G78970AT5G48530AT1G70810AT1G32920AT1G12220AT1G68910AT1G32375
AT2G05830AT1G58235AT1G13430AT3G59890AT3G51230AT4G28085AT2G26970AT2G41480AT5G43450AT2G40340
AT4G16215AT5G54020AT2G25670AT1G58180AT5G45469AT5G51930AT1G64105AT3G50880AT1G16880AT1G58300
AT5G65950AT5G27360AT3G26240AT3G58220AT2G15580AT4G08093AT1G61490AT1G78050AT5G54060AT3G43440
AT3G29410AT4G16980AT2G41640AT1G31820AT3G46880AT3G58020AT3G43610AT3G23800AT1G24490AT1G03850
AT2G13665AT1G65970AT5G42720AT5G03495AT4G21370AT3G47580AT3G53350AT1G58520AT3G55910AT1G16030
AT1G61180AT5G59660AT1G22590AT3G56890AT5G60460AT5G46640AT2G41340AT1G02820AT4G31730AT5G38010
AT5G33251AT5G18010AT1G62860AT3G08860AT3G14395AT4G13970AT5G18245AT5G36870AT4G36110AT4G23270
AT3G21080AT2G34300AT4G21650AT5G28000AT1G30720AT3G44970AT5G15790AT2G18780AT3G29290AT1G35255
AT3G11880AT2G02770AT3G04330AT5G44430AT1G32310AT3G18980AT3G29100AT2G35075AT1G53460AT4G29610
AT2G43550AT3G60965AT1G78030AT4G13564AT1G77590AT1G49030AT3G61028AT3G50160AT4G09420AT2G35270
AT4G15242AT2G32550AT2G13431AT5G42800AT3G60300AT4G10050AT2G03200AT3G19930AT4G36930AT3G18450
AT5G34850AT4G20480AT4G27370AT3G58820AT4G22212AT4G12680AT2G18360AT2G36800AT2G03390AT5G59090
AT5G03370AT1G47380AT2G02580AT2G27389AT1G48070AT5G37890AT1G10155AT4G01430AT5G18770AT5G49770
AT4G19240AT3G60960AT2G05915AT2G11270AT5G10760AT4G14620AT4G12020AT3G13400AT3G02240AT2G35810
AT4G23290AT3G45070AT5G40942AT5G38000AT2G23960AT1G33970AT2G21520AT2G21185AT1G30835AT2G39830
AT1G22800AT4G09500AT5G37072AT3G13440AT5G45420AT5G50110AT5G40170AT3G19508AT3G21090AT3G44790
AT4G22210AT3G19515AT1G13460AT1G65200AT5G23380AT1G66900AT1G24020AT4G15070AT5G49520AT1G74170
AT2G20180AT3G22570AT3G50300AT4G23260AT1G17300AT5G56590AT2G23600AT2G21620AT1G43890AT4G19700
AT4G14630AT1G66700AT1G53340AT1G31940AT5G53970AT4G38850AT2G02630AT4G21730AT5G43570AT4G30020
AT1G29800AT1G62610AT2G36590AT4G29200AT3G60980AT2G04110AT5G48880AT1G34750AT5G63080AT1G64270
AT5G66590AT4G14390AT5G27100AT1G65350AT4G16890AT2G12550AT5G08460AT1G47820AT5G02060AT4G06701
AT1G29790AT5G59680AT3G58270AT2G29660AT3G62730AT4G01525AT3G12965AT5G57700AT1G67460AT3G58780
AT5G42825AT3G61010AT1G72920AT5G28010AT4G23520AT1G30784AT5G59650AT3G26320AT4G01350AT3G53310
AT5G05890AT4G20390AT4G20450AT2G41650AT5G24210AT1G74640AT2G28800AT4G11500AT3G08870AT5G45000
AT4G24420AT4G14650AT5G19230AT5G46590AT3G54340AT3G51660AT3G50960AT5G09710AT1G06950AT2G31370
AT4G23320AT3G30214AT4G22390AT4G09680AT4G10400AT1G32090AT2G24310AT1G73550AT1G65032AT1G23780
AT3G44430AT5G49500AT3G27420AT5G50790AT3G21010AT1G70260AT3G27400AT4G09320AT5G09810AT1G21460
AT1G65985AT2G28990AT5G43940AT4G21590AT5G41000AT3G26180AT5G23570AT4G02550AT1G50180AT2G35690
AT5G25250AT2G23985AT2G14095AT4G29990AT5G20630AT4G38545AT3G16200AT3G03070AT1G31720AT3G62860
AT1G56680AT3G21020AT1G67481AT3G45700AT3G02850AT4G12000AT3G03040AT2G17710AT2G24160AT1G59840
AT5G40920AT4G12917AT4G12870AT3G18485AT4G00880AT1G65730AT1G11540AT1G22150AT2G14080AT5G13210
AT4G23300AT5G27120AT5G42890AT3G60480AT5G26300AT5G54710AT5G44030AT1G60130AT2G02620AT5G46260
AT5G21105AT4G21220AT3G05400AT2G29525AT1G17860AT3G43510AT5G46500AT3G27095AT3G60080AT4G34900
AT2G05995AT1G47786AT5G37980AT3G15380AT2G13960AT4G19350AT4G17260AT5G53240AT1G64100AT1G11803
AT3G25440AT3G29430AT3G17950AT5G48580AT4G16530AT5G39090AT5G63595AT2G21195AT4G15390AT4G27890
AT4G17470AT5G44575AT5G11780AT1G07660AT2G45360AT5G58575AT4G08950AT4G02700AT3G16565AT3G01345
AT5G24060AT3G03855AT3G59930AT5G24200AT5G18360AT1G34050AT2G39530AT5G33355AT5G45840AT1G12780
AT4G15210AT5G38005AT5G60370AT4G19633AT1G35680AT2G28970AT1G27980AT1G70895AT3G27906AT1G60750
AT5G35935AT3G19370AT3G45000AT2G14475AT3G60940AT3G24255AT3G28880AT2G15318AT4G37370
AT3G27520AT3G61020AT3G28190AT2G21187AT1G67570AT1G04580AT1G78760AT1G73120AT4G39590
AT4G15955AT1G24145AT5G09470AT1G05680AT1G15380AT4G17030AT1G69050AT4G27380AT1G20130
AT1G57610AT4G01450AT3G58865AT5G40910AT5G41740AT5G53230AT3G12430AT1G64780AT1G02940
AT3G25790AT3G57260AT2G41880AT2G29670AT1G67860AT3G29000AT1G05420AT3G44716AT1G58420
AT2G02120AT4G16770AT3G16520AT4G09260AT3G26730AT3G08590AT5G59540AT2G14878AT2G25720
AT1G47530AT4G31980AT2G02680AT2G24960AT3G51330AT1G27190AT5G41870AT3G23470AT5G51160
AT5G24950AT1G30975AT2G11891AT1G11570AT3G12460AT1G78820AT3G50845AT4G13540AT5G27990

List of down-regulated DEGs

DOWN-regulated gene list(529)
AT3G46040AT1G60110AT5G44920AT2G26370AT3G13980AT2G31490AT5G43520AT4G21903AT5G18404AT5G56980
AT3G16450AT3G59880AT2G43590AT1G66930AT1G59620AT5G53050AT5G08590AT5G53110AT2G30880AT4G36780
AT5G25980AT5G53048AT3G30122AT5G56747AT5G18340AT3G01540AT1G05350AT5G66270AT1G69310AT3G04000
AT3G28899AT4G01593AT5G24770AT3G52680AT1G49930AT4G01390AT1G63040AT3G28940AT4G36910AT2G35635
AT5G11280AT5G39080AT4G19840AT5G02690AT1G76640AT1G58270AT1G74430AT5G66220AT4G23600AT5G09650
AT1G53480AT2G10900AT1G63870AT5G45220AT5G23405AT2G23130AT1G27390AT3G58930AT1G01520AT3G21330
AT4G12545AT5G48010AT5G17090AT5G46150AT2G05642AT1G31460AT2G28120AT5G03180AT1G70870AT5G45740
AT3G11700AT2G05185AT4G16920AT3G49620AT1G45616AT3G50660AT1G18710AT4G18580AT5G01110
AT2G15128AT5G44570AT1G60810AT1G19396AT5G51620AT2G18040AT4G27260AT3G51450AT4G02130
AT2G26740AT5G23955AT3G43690AT1G59218AT3G01329AT1G64240AT1G34047AT1G77230AT2G20700
AT3G01720AT5G51630AT2G24280AT4G38280AT2G07213AT3G13730AT5G57780AT3G01010AT1G22350
AT1G23940AT1G65040AT4G22610AT5G23840AT2G47560AT5G35490AT3G28956AT5G61590AT2G20950
AT1G52990AT2G44160AT3G47965AT5G24960AT1G31070AT1G35375AT1G19090AT1G47960AT1G10000
AT5G38690AT1G17940AT5G47990AT4G01680AT4G16845AT1G35515AT3G44480AT1G52410AT3G17626
AT5G02160AT3G47290AT1G80970AT5G04120AT4G16710AT3G03470AT3G59010AT5G09978AT1G54580
AT2G16367AT1G31170AT3G21950AT3G46730AT5G08600AT2G01830AT5G11230AT5G64110AT4G18300
AT2G05510AT4G22120AT5G18290AT1G49630AT3G30180AT3G24890AT4G25710AT2G02470AT5G46295
AT5G58590AT4G05631AT1G58602AT1G66510AT3G20940AT4G13330AT3G04650AT1G61170AT3G51110
AT4G34881AT1G57800AT3G11010AT5G23010AT1G68620AT5G46240AT4G24972AT4G10410AT3G28100
AT1G52000AT2G15050AT3G53650AT5G11670AT3G14530AT5G46520AT1G65150AT2G16970AT1G79700
AT5G56380AT1G51990AT2G38240AT5G45090AT5G38780AT3G10650AT4G01380AT2G02520AT1G19394
AT5G45070AT2G12190AT2G11140AT5G26260AT5G23060AT1G68050AT4G00160AT2G03750AT5G46750
AT1G10220AT1G12010AT5G22500AT1G52190AT2G35733AT5G50020AT5G24870AT1G33490AT5G05480
AT3G09270AT1G56510AT5G35950AT5G50240AT2G23620AT4G15400AT5G23800AT3G60160AT1G50560
AT5G44572AT2G21080AT1G36580AT5G39530AT5G24140AT3G44420AT3G05770AT1G62540AT5G24910
AT1G27540AT3G11070AT1G12400AT5G23830AT3G46110AT1G25155AT3G12820AT1G25570AT1G43180
AT4G19500AT1G19080AT2G17690AT4G15620AT1G21220AT4G22235AT5G15420AT5G39493AT1G16445
AT1G52827AT4G08593AT3G02410AT2G43920AT5G42580AT1G66970AT5G18407AT3G30730AT3G02070
AT5G16980AT1G59730AT4G14548AT1G13270AT5G42840AT1G23950AT5G42650AT2G12462AT1G79310
AT5G22580AT1G35612AT4G15920AT3G43670AT5G10230AT3G47010AT1G02575AT5G66520AT1G06570
AT3G60170AT4G15330AT3G15352AT2G42990AT3G18070AT3G17420AT5G61270AT1G27570AT4G27410
AT1G02020AT5G51730AT1G02770AT3G29252AT4G19630AT5G43470AT1G68240AT5G11260AT5G37340
AT5G54700AT3G45080AT3G28220AT5G07560AT1G69490AT3G09310AT1G18180AT3G07070AT1G58400
AT3G50020AT1G73325AT1G49032AT3G03270AT5G23395AT5G02540AT2G10410AT5G54064AT2G23560
AT5G19070AT1G23052AT2G35980AT3G26445AT5G46710AT3G16020AT3G59000AT1G19070AT4G11110
AT5G65050AT5G45080AT5G43210AT3G27470AT1G53490AT5G56370AT2G24110AT1G34000AT5G02460
AT5G55896AT5G16340AT4G24880AT1G17590AT2G02000AT5G40950AT3G06125AT4G25530AT5G27440
AT1G65370AT3G48080AT2G04800AT3G44590AT3G47360AT5G28510AT1G48260AT3G49310AT3G48460
AT3G29639AT2G07811AT5G01335AT3G26960AT1G67265AT3G16030AT1G52920AT5G05290AT5G46780
AT5G42600AT1G69550AT1G72140AT1G25520AT2G11150AT3G44670AT4G10080AT4G12550AT3G04710
AT3G06660AT2G12480AT5G33370AT5G42510AT2G25355AT3G46030AT5G47980AT5G64480AT4G12440
AT4G36515AT4G01590AT4G37310AT5G23030AT3G60972AT2G13690AT3G24360AT5G54190AT3G15640
AT5G58770AT4G27560AT3G25770AT4G00430AT2G22990AT1G14120AT1G36680AT1G23060AT5G01840
AT1G60525AT5G24780AT5G23410AT1G65520AT3G22940AT1G62590AT1G02220AT5G53150AT5G28350
AT2G41440AT1G23130AT3G11370AT5G46330AT3G25830AT3G44600AT4G28710AT5G52470AT1G23020
AT1G52347AT3G47250AT2G42170AT4G15165AT1G29180AT2G05812AT2G35830AT3G50440AT5G52050
AT2G22821AT3G43833AT4G15910AT5G43516AT5G22520AT2G29420AT1G23040AT4G07820AT3G18280
AT3G14650AT2G10606AT3G46700AT2G19900AT3G28060AT3G20935AT2G22860AT3G06950AT3G22680
AT5G03090AT2G19980AT5G37410AT2G14880AT3G55130AT4G27020AT1G49490AT3G26480AT5G60250
AT4G08940AT1G23935AT1G70720AT2G22420AT1G52100AT1G59660AT5G52547AT5G03545AT5G22555
AT5G26290AT3G05625AT1G25211AT1G24370AT4G11410AT1G11175AT1G27170AT3G51620AT3G11630
AT1G25150AT4G00970AT1G65670AT4G29760AT5G57270AT3G20395AT3G29780AT1G60505AT4G23700
AT2G46490AT1G54260AT5G26200AT3G61930AT4G15475AT3G05160AT4G01026AT5G34830AT4G13493
AT4G11460AT3G60150AT1G25230AT5G05690AT3G49780AT4G22233AT3G12170AT5G37400AT1G80740
AT2G18193AT5G57785AT1G65190AT4G29690AT4G19510AT1G07705AT3G46650AT5G03310AT5G20550
AT3G30720AT5G27927AT1G29090AT3G52830AT1G34240AT3G11110AT4G15260AT3G20705AT1G31190
AT1G67365AT5G53990AT5G46490AT5G24206AT1G63900AT4G15340AT5G02350AT1G32900AT1G50090
AT3G45140AT4G11000AT4G24415AT4G22200AT1G63090AT3G44630AT2G04100AT1G12020AT5G11270

List of up-regulated DEGs related to stress responses

Stress-related / UP-regulated gene list(98)
GeneAnnotationGeneAnnotation
 AT1G72930 AtTN10 (toll/interleukin-1 receptor-like) AT4G16890 SNC1 (SUPPRESSOR OF NPR 1-1, CONSTITUTIVE 1)
 AT3G60950 C2 calcium/lipid-binding endonuclease/exonuclease/phosphatase AT1G32920 unknown protein
AT5G45490P-loop containing nucleoside triphosphate hydrolases superfamily proteinAT5G56590O-Glycosyl hydrolases family 17 protein
AT2G05830MTI1 (NagB/RpiA/CoA transferase-like superfamily protein)AT1G61490S-locus lectin protein kinase family protein
AT1G61180LRR and NB-ARC domains-containing disease resistance proteinAT5G23570ATSGS3 (SUPPRESSOR OF GENE SILENCING 3)
AT4G22210LCR85 (low-molecular-weight cysteine-rich 85)AT1G73120unknown protein
AT4G23290CRK21 (cysteine-rich RLK (RECEPTOR-like protein kinase) 21)AT5G40170AtRLP54 (receptor like protein 54)
AT2G20180`AT1G12220RPS5 (RESISTANT TO P. SYRINGAE 5)
AT4G14630GLP9 (germin-like protein 9)AT4G12020ATWRKY19/MAPKKK11 (MITOGEN-ACTIVATED PROTEIN KINASE KINAE KINASE 11)
AT5G25250FLOT1 (FLOTLLIN 1)AT2G23600ACL (acetone-cyanohydrin lyase)
AT4G23300CRK22 (cysteine-rich RLK (RECEPTOR-like protein kinase) 22)AT4G17260Lactate/malate dehydrogenase family protein
AT4G15210AT-BETA-AMY (beta-amylase 5)AT2G18170ATMPK7 (MAP kinase 7)
AT2G02120LCR70 (LOW-MOLECULAR-WEIGHT CYSTEINE-RICH 70)AT5G33355Defensin-like (DEFL) family protein
AT5G37940Zinc-binding dehydrogenase family proteinAT1G24020MLP423 (MLP-like protein 423)
AT5G02500ATHSC70-1 (heat shock cognate protein 70-1)AT1G16880ACR11 (ACT DOMAIN REPEATS 11)
AT2G05117SCRL9 (SCR-like 9)AT4G37370CYP81D8 (cytochrome P450, family 81, subfamily D, polypeptide 8)
AT3G57260AtBG2 (beta-1,3-glucanase 2)AT2G21195unknown protein
AT1G50290unknown proteinAT4G02550unknown protein
AT1G72920Toll-Interleukin-Resistance (TIR) domain family proteinAT3G50880DNA glycosylase superfamily protein
AT5G27100ATGLR2.1 (glutamate receptor 2.1)AT4G30660Low temperature and salt responsive protein family
AT5G37980Zinc-binding dehydrogenase family proteinAT2G40300ATFER4 (ferritin 4)
AT5G43940HOT5 (SENSITIVE TO HOT TEMPERATURE 5)AT3G45680NPF2.3
AT3G59930Encodes a defensin-like (DEFL) family proteinAT1G61420S-locus lectin protein kinase family protein
AT4G16950ADH2 (GroES-like zinc-binding dehydrogenase family protein)AT5G44030CESA4 (cellulose synthase A4)
AT5G38000RPP5 (Disease resistance protein (TIR-NBS-LRR class) family)AT4G09320ATNDK1 (Nucleoside diphosphate kinase 1)
AT5G28000Polyketide cyclase/dehydrase and lipid transport superfamily proteinAT2G21620RD2 (RESPONSIVE TO DESCCATION 2)
AT4G19520disease resistance protein (TIR-NBS-LRR class) familyAT3G21090ABCG15 (ATP-BINDING CASSETTE G15)
AT4G19030AT-NLM1 (NOD26-like major intrinsic protein 1)AT4G19700BOI (BOTRYTIS SUSCEPTIBLE1 INTERACTOR)
AT5G44430PDF1.2c (plant defensin 1.2C)AT4G09420Disease resistance protein (TIR-NBS class)
AT5G28010Polyketide cyclase/dehydrase and lipid transport superfamily proteinAT4G23310CRK23 (cysteine-rich RLK (RECEPTOR-like protein kinase) 23)
AT5G40910Disease resistance protein (TIR-NBS-LRR class) familyAT3G20130CYP705A22 (cytochrome P450, family 705, subfamily A, polypeptide 22)
AT5G20630ATGER3 (germin 3)AT2G03390uvrB/uvrC motif-containing protein
AT1G35680RPL21C (Chloroplast Ribosomal protein L21)AT1G16030Hsp70b (heat shock protein 70B)
AT5G10760AED1 (APOPLASTIC, EDS-1DEPENDENT 1)AT2G40340AtERF48
AT3G60980Tetratricopeptide repeat (TPR)-like superfamily proteinAT5G43570Predicted to encode a PR (pathogenesis-related) peptide
AT1G05680UGT74E2 (Uridine diphosphate glycosyltransferase 74E2)AT3G43440JAZ11 (jasmonate-zim-domain protein 11)
AT4G31990ASP5 (aspartate aminotransferase 5)AT4G36930SPT (SPATULA)
AT5G41740Disease resistance protein (TIR-NBS-LRR class) familyAT4G23270CRK19 (cysteine-rich RLK (RECEPTOR-like protein kinase) 19)
AT5G18360Disease resistance protein (TIR-NBS-LRR class) familyAT5G09810ACT7 (actin 7)
AT2G14820MEL3 (MAB4/ENP/NPY1-LIKE 3)AT2G28830AtPUB12 (PLANT U-BOX 12)
AT2G23960Class I glutamine amidotransferase-like superfamily proteinAT1G64780AMT1;2 (ammonium transporter 1;2)
AT5G37890SINAL7 (SINA LIKE 7)AT5G49520ATWRKY48 (WRKY DNA-binding protein 48)
AT5G46470RPS6 (disease resistance protein (TIR-NBS-LRR class) family)AT5G46260disease resistance protein (TIR-NBS-LRR class) family
AT3G51660Tautomerase/MIF superfamily proteinAT1G50180NB-ARC domain-containing disease resistance protein
AT4G22212Encodes a defensin-like (DEFL) family proteinAT2G35690ACX5 (acyl-CoA oxidase 5)
AT1G33970P-loop containing nucleoside triphosphate hydrolases superfamily proteinAT2G26560PLA IIA (phospholipase A 2A)
AT5G58120Disease resistance protein (TIR-NBS-LRR class) familyAT5G45000Disease resistance protein (TIR-NBS-LRR class) family
AT3G45290ATMLO3 (Seven transmembrane MLO family protein)AT2G14080Disease resistance protein (TIR-NBS-LRR class) family
AT4G12000SNARE associated Golgi protein familyAT1G03850ATGRXS13 (Glutaredoxin 13)

List of down-regulated DEGs related to stress responses

Stress-related / UP-regulated gene list(105)
GeneAnnotationGeneAnnotation
AT3G16450JAL33(JACALIN-RELATED LECTIN 33)AT3G49620DIN11 (DARK INDUCIBLE 11)
AT5G25980BGLU37(BETA GLUCOSIDASE 37)AT4G00430PIP1;4 (4(plasma membrane intrinsic protein 1;4)
AT2G26740ATSEH(soluble epoxide hydrolase)AT1G25520Uncharacterized protein family (UPF0016)
AT5G45070AtPP2-A8(phloem protein 2-A8)AT5G23060CaS(calcium sensing receptor)
AT1G52827ATCDT1(cadmium tolerance 1)AT2G22420Peroxidase superfamily protein
AT5G16980Zinc-binding dehydrogenase family proteinAT1G45616AtRLP6(receptor like protein 6)
AT4G19500nucleoside-triphosphatasesAT1G59620CW9(Disease resistance protein (CC-NBS-LRR class) family)
AT5G65050AGL31(AGAMOUS-like 31)AT4G19630winged-helix DNA-binding transcription factor family protein
AT3G50020Serine protease inhibitor, potato inhibitor I-type family proteinAT2G23620ATMES1(methyl esterase 1)
AT4G08940Ubiquitin carboxyl-terminal hydrolase family proteinAT3G16030CES101 (CALLUS EXPRESSION OF RBCS 101)
AT4G11460CRK30(cysteine-rich RLK (RECEPTOR-like protein kinase) 30)AT1G68050ADO3(flavin-binding, kelch repeat, f box 1)
AT5G51630Disease resistance protein (TIR-NBS-LRR class) familyAT3G25830ATTPS-CIN(terpene synthase-like sequence-1,8-cineole)
AT1G31170ATSRX(sulfiredoxin)AT5G10230ANN7(annexin 7)
AT3G45140ATLOX2(lipoxygenase 2)AT4G19510Disease resistance protein (TIR-NBS-LRR class)
AT1G65040AtHrd1BAT2G01830AHK4(ARABIDOPSIS HISTIDINE KINASE 4)
AT1G56510ADR2(Disease resistance protein (TIR-NBS-LRR class))AT3G44670Disease resistance protein (TIR-NBS-LRR class) family
AT3G48080alpha/beta-Hydrolases superfamily proteinAT1G35515HOS10(high response to osmotic stress 10)
AT5G45080AtPP2-A6(phloem protein 2-A6)AT5G61270PIF7(phytochrome-interacting factor7)
AT1G120102-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteinAT4G22235Arabidopsis defensin-like protein
AT1G23130Polyketide cyclase/dehydrase and lipid transport superfamily proteinAT1G34047Defensin-like (DEFL) family protein
AT5G24780ATVSP1(vegetative storage protein 1)AT5G46520VICTR (VARIATION IN COMPOUND TRUGGERED ROOT GROWTH RESPONSE)
AT1G69550disease resistance protein (TIR-NBS-LRR class)AT5G43470HRT (HYPERSENSITIVE RESPONSE TO TCV)
AT5G44920Toll-Interleukin-Resistance (TIR) domain family proteinAT1G27170transmembrane receptors
AT2G10606MIR396A (MICRORNA396A)AT3G44480COG1 (RECOGNITION OF PERONOSPORA PARASITICA 1)
AT5G24770ATVSP2(vegetative storage protein 2)AT5G08590SnRK2.1 (SNF1-related protein kinase 2.1)
AT4G16920Disease resistance protein (TIR-NBS-LRR class) familyAT3G44630Disease resistance protein (TIR-NBS-LRR class) family
AT1G63870Disease resistance protein (TIR-NBS-LRR class) familyAT1G18710AtMYB47(myb domain protein 47)
AT4G00970CRK41(cysteine-rich RLK (RECEPTOR-like protein kinase) 41)AT1G52410TSA1(TSK-associating protein 1)
AT5G47990CYP705A5(cytochrome P450, family 705, subfamily A, polypeptide 5)AT5G11260HY5 (ELONGATED HYPOCOTYL 5)
AT5G57785unknown proteinAT5G42650AOS (ALLENE OXIDE SYNTHASE)
AT4G19840ATPP2-A1(phloem protein 2-A1)AT3G51450Calcium-dependent phosphotriesterase superfamily protein
AT2G43590Chitinase family proteinAT5G61590DEWAX (DECREASE WAX BIOSYNTHESIS)
AT1G58602LRR and NB-ARC domains-containing disease resistance proteinAT3G60160ABCC9 (ATP-BINDING CASSETTE C9)
AT3G11010AtRLP34(receptor like protein 34)AT4G23600CORI3(CORONATINE INDUCED 1)
AT5G22500FAR1(fatty acid reductase 1)AT5G64110Peroxidase superfamily protein
AT4G15910ATDI21(drought-induced 21)AT1G34000OHP2(one-helix protein 2)
AT1G12400Nucleotide excision repair, TFIIH, subunit TTDAAT1G69310ATWRKY57(WRKY DNA-binding protein 57)
AT4G24415MIR824A (MICRORNA824A)AT3G50440ATMES10(methyl esterase 10)
AT3G25770AOC2(allene oxide cyclase 2)AT3G28940AIG2-like (avirulence induced gene) family protein
AT5G43210Excinuclease ABC, C subunit, N-terminalAT1G01520ASG4(Homeodomain-like superfamily protein)
AT1G72140Major facilitator superfamily proteinAT1G70870Polyketide cyclase/dehydrase and lipid transport superfamily protein
AT3G15352ATCOX17(cytochrome c oxidase 17)AT5G09978PEP7(elicitor peptide 7 precursor)
AT5G46490Disease resistance protein (TIR-NBS-LRR class) familyAT3G116302-Cys PrxA (2-Cys peroxiredoxin)
AT2G35980ATNHL10 (ARABIDOPSIS NDR1/HIN1-LIKE 10)AT2G02470AL6(alfin-like 6)
AT5G45090AtPP2-A7(phloem protein 2-A7)AT1G58400Disease resistance protein (CC-NBS-LRR class) family
AT1G59218Disease resistance protein (CC-NBS-LRR class) familyAT5G52050ATDTX50 (DETOXIFICATION EFFLUX CARRIOR 50)
AT5G42510Disease resistance-responsive (dirigent-like protein) family proteinAT2G23560ATMES7(methyl esterase 7)
AT5G45220Disease resistance protein (TIR-NBS-LRR class) familyAT4G27410ATRD26 (RESPONSIVE TO DESICCATION 26)
AT5G23010IMS3 (2-ISOPROPYLMALATE SYNTHASE 3)AT4G11110SPA2(SPA1-related 2)
AT3G46730NB-ARC domain-containing disease resistance proteinAT5G01840ATOFP1(ovate family protein 1)
AT5G05690DWF3(DWARF 3)AT5G09650AtPPa6(pyrophosphorylase 6)
AT5G46330FLS2(FLAGGELLIN-SENSITIVE 2)AT5G11270OCP3(overexpressor of cationic peroxidase 3)
AT4G16845VRN2 (REDUCED VERNALIZATION RESPONSE 2)

List of primers used in this study

 Primer name  Sequence(5’ - 3’)  Comment 
 JAZ1 F GCTAGGAGACGTTCACTTCAAAGAT JAZ1 Foward
 JAZ1 R CATTTTTGTCTGCTTCCGAAGTC JAZ1 Reverse
 TSA1 F CATCTTCTGGCTGATGCTTCTG TSA1 Foward
 TSA1 R GTCGCCTCTTTCGCAAATTC TSA1 Reverse
 NB-ARC F TGGGCTGGGATTTATCTATTCA NB-ARC Foward
 NB-ARC R GAAGGAATGTGTTGGACTTTGTAATAAT  NB-ARC Reverse 
 TIR F GAGCTCTTCGCCGGATCTT TIR Foward
 TIR R CATTAACCAATCCATGAGACAGAGA TIR Reverse
 OCP3 F TGTGGTCGAACCTAAGGAAAAAGT OCP3 Foward
 OCP3 R CGTTTCAATGTGAGCTTTCTTCA OCP3 Reverse
 PrxA F AATGAGAACCCTCCAGGCATT PrxA Foward
 PrxA R TGGGTCGGGTTTCATTGACT PrxA Reverse
 MLO3 F GCACTGGCAAGGGATGGTTA MLO3 Foward
 MLO3 R TTCTTCAGAATCAATATCACCATTG MLO3 Reverse
 FLS2 F GAATGATGAAGATTCACAAGACATGA FLS2 Foward
 FLS2 R GAGTTCCATATCAAGAACCCTAACCA FLS2 Reverse

Microarray 분석

애기장대(Arabidopsis thaliana) 야생형 En-2, 브라시노스테로이드 활성 돌연변이 bes1-D에 대한 transcript의 발현 양상을 규명하기 위해 대조구인 야생형과 bes1-D 유식물에서 RNA를 추출한 후, microarray 분석을 3반복으로 수행하여 발현 차이를 분석하였다. 타겟 probes와 hybridization은 Agilent’s Low RNA Input Linear Amplification kit (Agilent Technology, USA)을 사용하였으며, Microarray 분석을 위한 chip은 상용화 되고 있는 Agilent Arabidopsis 4 x 44K Oligo microarray을 사용하여 hybridization 후, image quantification은 GenePix Pro 4.0을 사용하였고, LOWESS 프로그램을 이용하여 각 spot의 nomalization을 수행하였다. 분석 프로그램은 Agilent GeneSpringGX 7.3을 사용하였으며, Hybridization은 각각 3 반복으로 수행되었다.

Gene Ontology (GO)와 Gene network 분석

Microarray 분석을 통해 얻어진 1,091개의 DEGs으로부터 주요 생물학적 기능을분석하기 위해 GO enrichment analysis 분석과 단백질 간 상호작용 네트워크 분석을 수행하였다(Ashburner et al. 2000). Gene Ontology Consortium website (http://geneontology.org/page/go-enrichment-analysis)에서 제공하는 프로그램을 이용하여 biological process, molecular function 및 cellular component에 해당하는 카테고리를 분리하였다(Supek et al. 2011). GO-Slim 카테고리는 TAIR database (https://www.arabidopsis.org)에서 제공되는 데이터를 이용하였다. GO enrichment analysis 분석을 통해 분리된 스트레스 관련 유전자들로부터 주요역할을 수행하는 유전자를 추출하기 위해 단백질 상호작용 네트워크 분석을 수행하였다(Shannon et al. 2003). 단백질 네트워크의 기본 데이터는 AraNet v2 (Lee et al. 2015b) 에서 제공받아 사용하였고, 네트워크 작성은 Cytoscape network visualization tool (Shannon et al. 2003)을 이용 하였다. 유전자의 이름은 TAIR database를 이용하여 결정하였다.

식물 스트레스 처리 및 저항성 검정

식물의 drought 내성 및 병 저항성 검증을 위해 브라시노스테로이드 전사인자의 기능 획득 돌연변이 bzr1-1D, bes1-D 식물체를 이용하였다. Drought 내성에 대한 실험을 하기 위해 3주간 생장시킨 야생형과 bzr1-1D 돌연변이계통에 급수를 중단하고 12일 후 다시 급수하여 식물이 회복되는 정도를 확인하였다. 병 저항성을 실험하기 위해 4주간 온실에서 생장 시킨 식물체에 Psudomonas syringae pv. Tomato strain DC3000 (Pst DC3000)을 5 X 107/ml 농도로 침지 처리하였다. 병원균 접종 후 7일 후 잎의 발생단계별로 진열하여 병의 진행 유무를 확인하였다.

결과 및 고찰

브라시노스테로이드 신호전달 과정에 관여하는 유전자를 동정하기 위해 En-2 계통과 bes1-D 계통을 이용하여 microarray 분석한 결과 통계적으로 유의성이 나타나는 p-value가 0.01 이하와 2배이상의 발현량 차이를 보이는 유전자(DEGs) 총 1,091개를 추출하였다(Fig. 1). 그 중 En-2 계통에 비해 bes1-D계통에서 발현량이 증가를 보인 유전자는 총 562개 이었고, 발현량이 감소를 보인 유전자는 총 529개 이었다(Fig. 1, Table 1, Table 2). 총 1,091개의 DEGs으로부터 주요 생물학적 기능을 분석하기 위해 GO enrichment analysis 분석을 수행한 결과 GO 분석을 통해 브라시노스테로이드 전사인자의 활성화는 3,185개의 cellular component, 2,217개의 molecular function 그리고 3,082개의 biological process로 구분되었다(Fig. 2). Biological process에 포함되는 유전자들은 다시 11개의 기능별로 구분이 되었으며, 현재까지 그 기능이 정확하게 구분되지 않는 term이 약 50% 정도를 차지하고 있었다. 이러한 이유는 NGS에 의해 발전하고 있는 유전체 서열 분석 기술의 발전속도에 비해 유전자의 기능을 연구하는 기능유전체학의 발전이 상대적으로 빈약하기 때문으로 파악된다. 또한 그 밖의 약 50%의 유전자들은 단백질 대사, 발달, 전사 및 번역, 신호전달에 관여하는 유전자들로 구성되어 있었다. 이 중 16% 정도는 스트레스 반응에 관여하는 유전자군으로 나타났으며, 이들 유전자의 역할에 매우 관심을 갖게 한다(Fig. 2). 이러한 결과를 통해 브라시노스테로이드 신호전달이 다양한 스트레스 반응과 아주 밀접하게 연관되어 있음을 시사하고 있다. 몇몇 보고에서도 식물의 생장과정상에서 브라시노스테로이드 처리가 광범위 스트레스 내성 증대에 밀접한 관계가 있다고 하였다(Divi and Krishna 2009; Gendron and Wang 2007). 또한 분리된 GO term을 좀더 생물학적 기능과 연관시켜 GO 상호작용 네트워크를 분석한 결과 브라시노스테로이드 신호전달에 의해 활성화 될 때 알려진 embryo development, seed development, cell differentiation, reproductive, fruit development, gametophyte development 등 식물 발육 과정상에서 밀접하게 관련되는 것들이 분리 되었다(Fig. 3). 또한 cellular biosynthesis, 아미노산 대사, 핵산 대사, 2차 대사산물 합성 경로 등과 같은 대사에 관련된 유전자들의 그룹이 연관성을 보이는 것으로 나타났다(Fig. 3). 이전의 브라시노스테로이드의 연구에 있어서 외부로부터 자극원으로 처리가 되면, 식물의 생장과 발육과정상에 다양한 신호전달 및 호르몬과의 상호작용을 하여 스트레스 내성 및 표현형의 변화를 보인다고 하였다 (Choudhary et al. 2012; Wang et al. 2012). 아울러 이와 비슷한 결과로서 브라시노스테로이드의 처리에 따른 auxin, SA, JA, 스테로이드 신호전달과의 상호작용을 확인 할 수 있었다(Fig. 3). 특히 식물의 외부 병원균 및 곤충들에 대한 방어 신호에 매우 중요하게 작용하는 SA와 JA 신호전달 및 대사의 네트워크가 존재함을 알 수 있었다. 이외에 개별적인 네트워크로써 스트레스 반응성과 면역, 병원균에 대한 방어 등에 관련된 유전자들의 그룹이 다수 존재하고 있음을 확인 할 수 있었다(Fig. 3). 이러한 결과는 브라시노스테로이드 신호전달에 중요한 전사인자의 기능이 증대됨으로써, 발현에 변화가 일어나는 전사체 정보를 분석함으로써 더욱 세분화 되고 복잡한 생명현상을 설명할 수 있다. 또한 현재까지 알려진 브라시노스테로이드에 의해 조절되는 것으로 알려진 대사와 발달 그리고 호르몬 신호전달과의 상호작용 이외에 생리학적인 표현형 특징으로만 보고된 스트레스 저항성에 관련된 유전자들의 발현 양상도 발견할 수 있었다. GO enrichment 분석 및 상호작용 네트워크 분석을 통해 새롭게 동정된 스트레스 반응에 관련 유전자들은 발현 양상을 조사한 결과 up-regulation 98개 유전자(Table 3)와 down-regulation 105개 유전자(Table 4)를 선발하였다. 유전자의 발현이 높게 나타나는 유전자들은 AtTN10 (AT1G72930), C2 calcium/lipid-binding endonuclease (AT3G60950), PDF1.2 (AT5G44430) 등과 같은 비생물학적 스트레스에 관련된 유전자들과 R gene으로 알려진 TIR-NBS-LRR class family 유전자들 (AT5G41740, AT5G18360, AT5G45000 등)과 CRK21과 같은 RECEPTOR-like protein kinase 유전자 (AT4G23290, AT2G05117 등) 등 이었다. Down-regulation 되는 유전자들의 발현 양상도 비슷한 패턴을 보였는데, 이들 유전자들의 단백질-단백질 간의 상호작용을 확인할 수 있는 네트워크 분석을 수행한 결과 TIR-NBS-LRR들을 중심으로 만들어지는 중요한 병원균에 대한 방어 네트워크가 만들어 지는 것을 확인하였다(Fig. 4). 흥미롭게도 이들 TIR-NBS-LRR들은 유전자의 발현 양상이 up-regulation과 down-regulation 모두 발견되었다(Fig. 4). 이러한 특성들은 브라시노스테로이드에 의해 병원균에 대한 특이성이 존재함을 의미한다. 이러한 가설과 연관성 있게, 최근 연구는 브라시노스테로이드 신호전달이 세균성 병원균 P. syringae에 대한 저항성을 보이지만, 곰팡이성 necrotrophic 병원균 Alternaria brassicicola에 대한 감수성이 보고되었다 (Shin et al. 2016). 네트워크 분석은 브라시노스테로이드 신호전달과 병원균 사이의 기주 특이성을 설명할 수 있는 중요한 자료라고 판단된다. 이외에도 AtMES를 중심으로 이뤄지는 방어 호르몬 SA 합성에 주요한 네트워크가 발견이 되었다. 또한 ADH2, AtHSC70, AtPPa6로 합쳐지는 주요 비생물학적 스트레스 저항성 네트워크가 존재함을 확인하였다. 이러한 네트워크 분석을 통해 브라시노스테로이드 신호전달에 의한 광범위 스트레스가 어떠한 경로를 통해 형성되는지를 예측할 수 있었다. Microarray 분석과 시스템 생물학적 접근을 통해 브라시노스테로이드 신호전달에 의해 형성되는 광범위 스트레스 내성에 대한 네트워크 분석하여 얻어진 허브유전자의 발현 조사하였다. 병원균 저항성 주요 네트워크 분석에서 NB-ARCFLS2의 경우 bes1-D 계통이 야생형 En-2 계통에 비해 약 6배 정도의 발현량이 증가되었다(Fig. 5A). 반대로 TIR1, TSA1, OCP3의 경우 bes1-D 계통이 야생형 En-2 계통에 비해 발현이 감소되었다(Fig. 5A). 이러한 결과를 바탕으로 브라시노스테로이드 신호 강도가 증가된 bzr1-1D 돌연변이를 이용하여 drought 스트레스 내성을 검정한 결과 브라시노스테로이드 증대 식물체에서 약 40%(16개체 샘플 중 6개체 생존)는 drought stress에 대한 저항성을 보였다(Fig. 5B). 그러나 야생형 En-2 식물체는 drought stress에 감수성을 보였다(16개체 샘플 중 0개체 생존). 또한 병원균 저항성을 검정하기 위해 Pst DC3000을 접종한 결과 best1-D 계통이 En-2 계통에 비해 저항성을 보였다(Fig. 5C). 최근 들어 시스템 생물학을 이용한 빅데이터 처리를 통해 생명현상을 이해하려는 노력이 최근 다양한 방면에서 사용되고 있으며, Serin 등 (2016)은 전 전사체 분석을 통해 얻어진 많은 양의 데이터를 효율적으로 처리하고, 이를 통해 새로운 생명현상의 모듈을 발견할 수 있는 생명공학적 기법을 보고하였다. 이런 방법은 신호전달 과정의 연구에서 단일 호르몬 또는 신호전달 체계가 어떻게 이뤄지고 있는지를 이해하는데 큰 역할을 할 수 있지만 단일체계들이 상호적으로 복잡하게 얽혀져 있는 생명현상을 이해하는데 많은 장애가 있음을 사사하였다(Serin et al. 2016). 본 연구는 비록 microarray분석, 시스템생물학 및 유전자의 발현양상 등의 국한적인 기법을 이용하여 브라시노스테로이드 신호전달에 의해 형성되는 다양한 스트레스 저항성 현상을 이해하는데 큰 일조를 하였다고 판단된다. 향후 이러한 연구 기법을 통해 NGS를 통해 얻어지는 빅데이터를 분석하고 이를 통해 식물이 지니고 있는 복잡한 생명현상을 이해할 수 있으리라 사료된다.

Fig. 1.

Microarray analysis of various genes in WT : BR activating plant. Heatmap of the z-scores of DEGs between En-2 and bes1-D. The heatmap was generated by the Plotly website (https://plot.ly/alpha/workspace/). High and low scores are indicated in red and blue, respectively. DEGs are scaled to Z-scores of the rows


Fig. 2.

GO annotation classification of DEGs. The fractions of cellular components, biological processes, and molecular functions were calculated based on the number of GO terms. The fractional ratios of the biological processes were calculated based on the number of GO-slim from the TAIR database


Fig. 3.

GO enrichment and interactive network analysis of DEGs. Interactive graph of the biological processes of DEGs related to BR activation. The network was summarized and plotted following the published REVIGO protocol (http://revigo.irb.hr)


Fig. 4.

Protein interaction network analysis of stress-related genes. There were 203 stress-related GO genes. A network was modeled, in which interactions between genes are represented as nodes. Up- and down-regulated genes are represented in blue and red, respectively


Fig. 5.

Brassinosteroid activated plants show multiple stress tolerance phenotypes. A. Real time quantitative RT-PCR analysis of the expression levels of candidate hub genes identified by microarray and protein interaction network analysis. B. Drought stress tolerance phenotype of BR-activated bzr1-1D. C. BR-activated bes1-D plants revealed a higher resistance to bacterial pathogens


적요

브라시노스테로이드는 식물의 생장과 발육 과정에 있어서 중요한 역할을 담당 할 뿐 아니라 생물학적/비 생물학적 스트레스에 대한 복합 저항성을 보인다고 알려져 있다. 따라서 본 연구에서는 브라시노스테로이드와 광범위스트레스 내성을 연결하는 중요한 생물학적 네트워크를 이해하기 위해, Agilent Arabidopsis 4 x 44K oligo chip을 이용하여 브라시노스테로이드 신호가 강화된 bes1-D 계통의 전 전사체 비교 분석을 수행하였다. 그 결과 bes1-D 계통에서 DEGs (Differentially Expressed Genes)를 1,091 (562 up-regulated, 529 down-regulated)개 선발하였다. 또한 선발된 유전자들의 GO 와 단백질 상호작용 네트워크 분석을 통해 대사, 발달, 스트레스, 면역, 방어 반응에 관련된 주요 브라시노스테로이드 신호전달과 연결된 스트레스 관련 유전자군을 분리하였다. 선발된 유전자중 NB-ARCFLS2bes1-D 계통이 야생형 En-2 계통에 비해 약 6배 정도의 발현량이 증가되었으며, TIR1, TSA1, OCP3 유전자등은 bes1-D 계통이 야생형 En-2 계통에 비해 발현이 감소되었다. 또한 브라시노스테로이드 활성형 계통이 야생형 식물체 계통에 비해 가뭄 스트레스 및 병원균에 대해 저항력이 향상되었다. 따라서 microarray 분석을 통한 유전자 간 발현 네트워크와 유전체 정보를 결합하여 대단위 주요 기능 유전자들을 동정할 수 있는 방법을 고안하여 실험에 사용하였다. 이를 통해 기능 획득 돌연변이 bes1-D가 식물들이 다양한 스트레스 환경에 적응할 수 있는 반응을 조절한다는 사실을 보여주고 있다.

사사

본 성과물은 농촌진흥청 2016 국가농업 R&D 어젠다 연구사업 (세부과제명: 과수 주요 병해의 현장 진단 및 생물학적 방제법 개발, 세부과제번호: PJ011917)과 농림축산식품부·해양수산부·농촌진흥청·산림청 Golden Seed 프로젝트 사업 (원예종자사업단, 과제번호 : 213003-04-3-SBY10)의 지원에 의해 이루어진 것임.

References
  1. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, and Eppig JT. (2000) Gene ontology:tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25-9.
    Pubmed KoreaMed CrossRef
  2. Choudhary SP, Yu JQ, Yamaguchi-Shinozaki K, Shinozaki K, and Tran LS. (2012) Benefits of brassinosteroid crosstalk. Trends Plant Sci 17, 594-605.
    Pubmed CrossRef
  3. Divi UK, and Krishna P. (2009) Brassinosteroid:a biotechnological target for enhancing crop yield and stress tolerance. N Biotechnol 26, 131-6.
    Pubmed CrossRef
  4. Divi UK, Rahman T, and Krishna P. (2010) Brassinosteroid-mediated stress tolerance in Arabidopsis shows interactions with abscisic acid, ethylene and salicylic acid pathways. BMC Plant Biol 10, 151.
    Pubmed KoreaMed CrossRef
  5. Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, Guan S, Lalonde S, Sun Y, and Gendron JM. (2007) An essential role for 14-3-3 proteins in brassinosteroid signal transduction in Arabidopsis. Dev Cell 13, 177-89.
    Pubmed KoreaMed CrossRef
  6. Gendron JM, and Wang ZY. (2007) Multiple mechanisms modulate brassinosteroid signaling. Curr Opin Plant Biol 10, 436-41.
    Pubmed KoreaMed CrossRef
  7. Harnsomburana J, Green JM, Barb AS, Schaeffer M, Vincent L, and Shyu CR. (2011) Computable visually observed phenotype ontological framework for plants. BMC Bioinformatics 12, 260.
    Pubmed KoreaMed CrossRef
  8. He JX, Gendron JM, Yang Y, Li J, and Wang ZY. (2002) The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. Proc Natl Acad Sci USA 99, 10185-90.
    Pubmed KoreaMed CrossRef
  9. Kagale S, Divi UK, Krochko JE, Keller WA, and Krishna P. (2007) Brassinosteroid confers tolerance in Arabidopsis thaliana and Brassica napus to a range of abiotic stresses. Planta 225, 353-64.
    Pubmed CrossRef
  10. Kim TW, and Wang ZY. (2010) Brassinosteroid signal transduction from receptor kinases to transcription factors. Annu Rev Plant Biol 61, 681-704.
    Pubmed CrossRef
  11. Kutschera U, and Wang ZY. (2012) Brassinosteroid action in flowering plants:a Darwinian perspective. J Exp Bot 63, 3511-22.
    Pubmed KoreaMed CrossRef
  12. Lee T, Kim H, and Lee I. (2015a) Network-assisted crop systems genetics:network inference and integrative analysis. Curr Opin Plant Biol 24, 61-70.
    Pubmed CrossRef
  13. Lee T, Yang S, Kim E, Ko Y, Hwang S, Shin J, Shim JE, Shim H, Kim H, and Kim C. (2015b) AraNet v2:an improved database of co-functional gene networks for the study of Arabidopsis thaliana and 27 other nonmodel plant species. Nucleic Acids Res 43, D996-1002.
    Pubmed KoreaMed CrossRef
  14. Li J, and Chory J. (1997) A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. Cell 90, 929-38.
    CrossRef
  15. Li J, Wen J, Lease KA, Doke JT, Tax FE, and Walker JC. (2002) BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell 110, 213-22.
    CrossRef
  16. Livak KJ, and Schmittgen TD. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△Ct method. Methods 25, 402-408.
    Pubmed CrossRef
  17. Oh E, Zhu JY, Ryu H, Hwang I, and Wang ZY. (2014) TOPLESS mediates brassinosteroid-induced transcriptional repression through interaction with BZR1. Nat Commun 5, 4140.
    Pubmed KoreaMed CrossRef
  18. Rhee SY, Dickerson J, and Xu D. (2006) Bioinformatics and its applications in plant biology. Annu Rev Plant Biol 57, 335-60.
    Pubmed CrossRef
  19. Ryu H, Cho H, Bae W, and Hwang I. (2014) Control of early seedling development by BES1/TPL/HDA19-mediated epigenetic regulation of ABI3. Nat Commun 5, 4138.
    Pubmed CrossRef
  20. Ryu H, Cho H, Kim K, and Hwang I. (2010a) Phosphorylation dependent nucleocytoplasmic shuttling of BES1 is a key regulatory event in brassinosteroid signaling. Mol Cells 29, 283-90.
    Pubmed CrossRef
  21. Ryu H, Kim K, Cho H, and Hwang I. (2010b) Predominant actions of cytosolic BSU1 and nuclear BIN2 regulate subcellular localization of BES1 in brassinosteroid signaling. Mol Cells 29, 291-6.
    Pubmed CrossRef
  22. Ryu H, Kim K, Cho H, Park J, Choe S, and Hwang I. (2007) Nucleocytoplasmic shuttling of BZR1 mediated by phosphorylation is essential in Arabidopsis brassinosteroid signaling. Plant Cell 19, 2749-62.
    Pubmed KoreaMed CrossRef
  23. Serin EA, Nijveen H, Hilhorst HW, and Ligterink W. (2016) Learning from Co-expression Networks:Possibilities and Challenges. Front Plant Sci 7, 444.
    Pubmed KoreaMed CrossRef
  24. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, and Ideker T. (2003) Cytoscape:a software environment for integrated models of biomolecular interaction networks. Genome Res 13, 2498-504.
    Pubmed KoreaMed CrossRef
  25. Shin SY, Chung H, Kim SY, and Nam KH. (2016) BRI1-EMS-suppressor 1 gain-of-function mutant shows higher susceptibility to necrotrophic fungal infection. Biochem Biophys Res Commun 470, 864-9.
    Pubmed CrossRef
  26. Supek F, Bosnjak M, Skunca N, and Smuc T. (2011) REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS One 6, e21800.
    CrossRef
  27. Vriet C, Russinova E, and Reuzeau C. (2012) Boosting crop yields with plant steroids. Plant Cell 24, 842-57.
    Pubmed KoreaMed CrossRef
  28. Wang ZY, Bai MY, Oh E, and Zhu JY. (2012) Brassinosteroid signaling network and regulation of photomorphogenesis. Annu Rev Genet 46, 701-24.
    Pubmed CrossRef
  29. Wang ZY, Nakano T, Gendron J, He J, Chen M, Vafeados D, Yang Y, Fujioka S, Yoshida S, and Asami T. (2002) Nuclear- localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis. Dev Cell 2, 505-13.
    CrossRef
  30. Yin Y, Wang ZY, Mora-Garcia S, Li J, Yoshida S, Asami T, and Chory J. (2002) BES1 accumulates in the nucleus in response to brassinosteroids to regulate gene expression and promote stem elongation. Cell 109, 181-91.
    CrossRef


December 2018, 45 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles

Funding Information
  • CrossMark
  • Crossref TDM