search for




 

Three transcripts of EDS1-like genes respond differently to Vitis flexuosa infection
J Plant Biotechnol 2017;44:125-134
Published online June 30, 2017
© 2017 The Korean Society for Plant Biotechnology.

Md. Zaherul Islam, and Hae Keun Yun*

On-Farm Research Division, Bangladesh Agricultural Research Institute, Pabna 6600, Bangladesh,
Department of Horticulture and Life Science, Yeungnam University, Gyeonsan 38541, Korea
Correspondence to: e-mail: haekeun@ynu.ac.kr
Received May 31, 2017; Revised June 2, 2017; Accepted June 16, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Enhanced disease susceptibility1 (EDS1) is a regulator of basal defense responses required for resistance mediated by TIR-NBS-LRR containing R proteins. We identified three transcripts of EDS1-like genes encompassing diverse/ separate expression patterns, based on the transcriptome analysis by Next Generation Sequencing (NGS) of V. flexuosa inoculated with Elsinoe ampelina. These genes were designated VfEDL1 (Vitis flexuosa Enhanced Disease Susceptibility1-like1), VfEDL2 and VfEDL3, and contained 2464, 1719 and 1599 bp, with 1791, 1227 and 1599 bp open reading frames (ORFs), encoding proteins of 596, 408 and 532 amino acids, respectively. The predicted amino acid sequences of all three genes showed the L-family lipase-like domain (class 3 lipase domain), and exhibited a potential lipase catalytic triad, aspartic acid, histidine and serine in the conserved G-X-S-X-G. All three VfEDL genes were upregulated at 1 hpi against the bacterial and fungal pathogens Rizhobiumvitis and E. ampelina, respectively, except VfEDL1, which was downregulated against E. ampelina at all time points. Against E. ampelina, VfEDL2 and VfEDL3 showed downregulated expression at later time points. When evaluated against R. vitis, VfEDL1 showed downregulated expression at all time points after 1 hpi, while VfEDL3 showed upregulation up to 24 hpi. Based on the expression response, all three genes may be involved in plant resistant responses against R. vitis, and VfEDL2 and VfEDL3 show additional resistant responses against E. ampelina infection.

Keywords : Disease resistance, Elsinoe ampelina, Enhanced disease susceptibility1, Hypersensitive response, Rhizobium vitis
Introduction

Plants constantly encounter various pathogens and have therefore evolved several defense mechanisms to protect themselves from attacks by pathogens. Resistance (R) and defense related genes are involved in resistance reactions in plants, and the R gene is necessary for them to recognize pathogen attacks (Hammond-Kosack and Jones 1996). The genetic interaction between an R gene and an Avr gene drives activation of plant disease resistance signaling cascades, resulting in the induction of defense gene expressions, hypersensitive response (HR) and elicitation of systemic acquired resistance (Staskawicz et al. 1995; Hammond-Kosack and Jones 1996; Dangl and Jones 2001).

Disease resistance (R) genes are believed to confer resistance to specific diseases caused by fungi, bacteria, viruses, oomycetes or nematodes (Taler et al. 2004). A major class of R genes encodes the nucleotide binding site-leucine rich repeat (NBS-LRR) (Joshi and Nayak 2011). Based on the N-terminal motif, NBS-LRR class R genes are classified into two major classes, TIR-NBS-LRR (TNL), which contains a Toll Interleukin-1 receptors (TIR) motif in the N-terminal, and CC-NBS-LRR (CNL), which contains a coiled-coil (CC) or a leucine-zipper (LZ) motif in the N-terminal (Meyers et al. 1999; Pan et al. 2000; Liu et al. 2007; Joshi and Nayak 2011). In addition to R genes, mutational analysis in Arabidopsis revealed several genes required for the R gene mediated resistance and signaling pathway, including EDS1, NDR1, PAD4, SID1, EDS5, SID2, EDS16, NPR1 and NIM1 (Cao et al. 1994; Century et al. 1995; Delaney et al. 1995; Glazebrook et al. 1997; Rogers & Ausbel 1997; Aarts et al. 1998; Zhou et al. 1998; Falk et al. 1999; Nawrath and Metraux 1999; Rusterucci et al. 2001). EDS1 and NDR1 are required for resistance mediated by several R genes encoding TIR-NBS-LRR and CC/LZ-NBS-LRR proteins, respectively (Century et al. 1995; Aarts et al. 1998; Falk et al. 1999; Rusterucci et al. 2001). EDS1 is also required for basal resistance in plants (Wanger et al. 2013). EDS1 nuclear accumulation is necessary for transcriptional defense reprogramming in both effector-triggered immunity (ETI) and basal immunity (Garcia et al., 2010; Heidrich et al., 2011). EDS1 encodes lipase-like protein, which functions upstream of salicylic acid (SA)-dependent PR1 mRNA accumulation against an avirulent bacterial pathogen in Arabidopsis (Falk et al. 1999).

Cultivated grapevines (Vitis spp.) are exposed to many pathogenic fungi, bacteria, and viruses (Wang et al. 2011). Grape anthracnose caused by fungal pathogenic E. ampelina (Yun et al. 2007; Kono et al. 2009) and crown gall caused by bacterial pathogenic R. vitis (Eastwell et al. 2006) are major devastating diseases that result in loss of yield and quality of grapes. The use of commercial fungicides to control diseases is very expensive and causes various adverse impacts on the environment; therefore, interest in development of resistant varieties is increasing.

Several signaling regulators, including EDS1, NDR1, PAD4, SID1, EDS5, SID2, EDS16, NPR1 and NIM1, have been characterized and shown to play roles in signaling cascades in pathways to pathogen resistance in plants. Although cultivated grapevines (V. vinifera L.) are highly susceptible to several diseases, some wild cultivars such as V. riparia, V. rupestris, V. rotundifolia and V. flexuosa are reportedly resistant to several important grapevine diseases (Eibach et al. 1989; Kortekamp et al. 2008; Ahn et al. 2012). In a previous study, we found several transcripts of EDS1- like genes with differential expression levels in the transcriptome of V. flexuosa infected with E. ampelina (Ahn et al. 2014). Therefore, in this study, we cloned three EDS1-like genes in V. flexuosa to characterize these genes by analyzing their structural features and phylogenetic relationship with other plants, and by investigating their expression patterns in response to infection by E. ampelina and R. vitis.

Materials and Methods

Plant materials and pathogens

V. flexuosa VISKO001 plants were cultured in pots at the green house of Horticulture and Life Science in Yeungnam University, Gyeongsan, Korea, for leaf production. Leaves were used for gene expression analysis following pathogen inoculation. The pathogens used in this study were virulent strains of E. ampelina (EA-1) and B. cinerea (B1035) that were isolated from infected grapes by Dr. W.K. Kim, National Academy of Agricultural Science, Rural Development Administration, Korea and R. vitis strain Cheonan 493, which was kindly provided by Prof. J.S. Cha, Chungbuk National University, Korea.

Inoculation of pathogens

Spores of E. ampelina were produced according to Yun et al. (2007), then collected by scraping off of the plates with sterile distilled water. The concentrations of the spore suspensions were measured using a hemocytometer and adjusted to 106 spores mL-1. Inoculation of spore suspensions was performed by spraying onto leaves. After growing single colonies of R. vitis on potato dextrose agar (PDA), a single colony was transferred to YEP medium (yeast extract 10 g, bacto peptone 5 g, NaCl 5 g L-1 and pH 7.0) and grown at 28°C in a shaking incubator for 16 to 18 hours. The bacterial cells were subsequently collected by centrifugation and resuspended in sterile water at a concentration of OD600 = 1. Next, the leaves were injured slightly with a pencil tip and inoculated by dropping 20 µL of R. vitis cell suspensions onto the wounded portion of the leaves. Leaves inoculated with spore suspensions were subsequently incubated in a moist box at 22–28°C for 48 h. Leaves were harvested at 0, 1, 6, 12, 24, and 48 hours post inoculation (hpi).

Isolation of total RNA and first-strand cDNA synthesis

Leaf samples were ground in liquid nitrogen using a mortar and pestle, after which total RNA was extracted using the modified pine tree method described by Chang et al. (1993). The RNA quality was then measured based on the absorbance at 230, 260 and 280 nm using a Nano Drop spectrophotometer (ACTGene ASP-3700; ACTGene, Inc., Piscataway, New Jersey, USA). Next, first-strand cDNA was synthesized from the total RNA (500 ng) using a GoScriptTM Reverse Transcription System (Promega, Madison, WI, USA).

Analysis of VfEDL2 and VfEDL3 through sequencing

PCR amplification of the VfEDL2 and VfEDL3 genes was conducted using cDNA and gene specific primers (forward: ATGGAAGCCCACGATTGCACTG; reverse: CTAATGG ATGAGTTTCATAATGCG and forward: GGCTTCCCAA TGATTAGTGTGC; reverse: TTACCCACCGATGAGTTTCGAA, respectively). The PCR conditions were as follows: 94°C for 5 minutes followed by 35 cycles of denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds and extension at 72°C for 1 minute, with a final extension at 72°C for 7 minutes. Following PCR, samples were electrophoresed on a 1% agarose gel and photographed using Benchtop UV Transilluminator gel doc (Cambridge, UK). Gel purified samples were either subjected to cloning using a TA cloning kit (RBC Bioscience, New Taipei, Taiwan) or sequenced directly by ABI sequencing (Xenotech, Daejeon, Republic of Korea).

Real-time quantitative PCR analysis

First-strand cDNA was subsequently used as a template for PCR. Real-time PCR was performed on a C1000TM Thermal Cycler (CFX96TM Real-Time System, BioRad, CA, USA) using SYBR Premix Ex Taq (TaKaRa Bio Inc., Osaka, Japan) as the fluorescent dye. Amplification was conducted by subjecting the samples to 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Transcript levels were calculated using the standard-curve method and normalized against the grapevine actin gene (AB372563) as an internal control and non-treated leaves (at time zero) as a reference. Melting curves of the amplified products were also recorded. For each gene, the reference sample was defined as the 1× expression level and the results were expressed as the fold increase in mRNA level over the reference sample. All reactions were performed in triplicate to minimize the experimental error. The specific primers used for real-time PCR are listed in Table 1.

Specific primers based on alignment of the three VfEDL genes used for real time PCR

Gene Primers    Sequences
VfEDL1FPCACGCTGAGTCTTCGTCAACCT
RPGAAAGGCAGAAGGGGAAGAGGG
VfEDL2FPTAGCAAGAAACTGGGCTTACCC
RPCGTCATCGCCTAAACTTTTAAGCG
VfEDL3FPATATGGTGGAAAGGCCTTCGTCCC 
RPCCGATGAGTTTCGAAATGAAAG

FP: forward primer, RP: reverse primer


Sequence analysis of genes

The nucleotide sequences of genes were converted to amino acid sequences using translation software (http://web.expasy.org/translate/) (Gasteiger et al. 2003). Analysis of primary structures of the genes was performed using ExPasy protParam (http://web.expasy.org/protparam/) (Gasteiger et al. 2003), while the secondary structure was analyzed using the Self- Optimized Prediction Method with Alignment (SOPMA) (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa _sopma.html) (Geourjon & Deleage 1995). To verify the presence of the lipase 3 domain, the VfEDL protein sequences were analyzed using the web tool, Simple Modular Architecture Research Tool program (SMART) (http://smart.embl- heidelberg.de/smart/set_mode.cgi?GENOMIC=1) (Letunic et al. 2009). Signal peptide searches were conducted with the SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/), while the transmembrane helix region was searched using the TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). Homologue protein sequences of the genes were searched by a BLAST (Basic Local Alignment Search Tool) of the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) using the BLASTp tool and the “nr” database. The VfEDL proteins were blasted against each other to check for gene duplication events using NCBI blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple alignments of protein sequences were performed using ClustalW (http://www.genome.jp/tools/clustalw/). Phylogenetic neighbor-joining analyses of gene sequences were performed using the Molecular Evolutionary Genetics Analysis (MEGA) version 6.0 software. The tree branches were evaluated using the bootstrap method.

Results and Discussion

Identification and sequence analysis of three EDL genes in V. flexuosa

Transcriptome analysis using NGS of V. flexuosa with an inoculation of E. ampelina (Ahn et al. 2014) revealed the presence of three different transcripts for EDS1-like genes. The transcripts for EDS1-like genes were verified for the presence of lipase 3 domain using the Simple Modular Architecture Research Tool (SMART) (http://smart.embl- heidelberg.de/smart/set_mode.cgi?GENOMIC=1). One of these genes had the full coding sequence (CDS) with the characteristic lipase 3 domain, while the remaining two were cloned for the full length coding sequence and characteristic lipase 3 domain. All genes showed the most similarity with AtEDS1 by their first hit, and were characterized and referred to as VfEDL1 (V. flexuosaEnhanced Disease Susceptibility1 like1), VfEDL2 and VfEDL3. The sequences were deposited in the National Agricultural Biotechnology Information Center (NABIC), Rural Development Administration, Korea under accession numbers NS-0829-000001, NS-0832-000001 and NS-0833-000001, respectively. The primary structure and the characteristics of VfEDL genes were analyzed using the bioinformatic tool, protParam (http://web.expasy.org/protparam/), and the results are presented in Table 2. The results showed that the size of the VfEDL genes ranged from 1599 to 2464 base pairs (bp), while the open reading frame varied from 1227 to 1791, encoding 408 to 596 amino acids. The molecular weight of VfEDL proteins ranged from 46.15 to 68.33 kDa, while the predicted isoelectric points varied from basic (6.12) to alkaline (8.71). All predicted proteins of VfEDL genes showed instability, with values of 48.88 to 49.66 in the instability index (II) proposed by Guruprasad et al. (1990) (Table 2). The secondary structures of the proteins predicted from the VfEDL genes were analyzed by SOPMA (Table 3). The results showed that random coil, alpha helix, beta turn and extended strands varied from 28.36 to 30.26%, 48.99 to 53.38%, 5.45 to 8.33% and 10.90 to 14.60% in amino acids, respectively. The prediction suggested that alpha helices are abundant structural elements of the VfEDL gene that are common features of other EDS1 genes. No predicted signal peptides or obvious transmembrane regions were detected by the SignalP 4.1 Server and TMHMM Server v. 2.0, which suggests that these proteins predicted from the VfEDL genes are cytoplasmic, similar to AtEDS1 (Falk et al. 1999).

Predicted primary structure of three VfEDL genes of V. flexuosa

GeneNucleotide length (bp)aORF (bp)Protein length (aa)bMW (kDa)cpIInstability index (II)
VfEDL12464179159668333.66.3548.80
VfEDL21719122740846156.46.1247.99
VfEDL31599159953260905.88.7149.66

aORF: open reading frame;

bMW: molecular weight;

cpI: isoelectric point


Predicted secondary structures of three proteins determined from the EDL genes of V. flexuosa

 Protein Random coil Alpha helix Beta turn Extended strand 
VfEDL128.36%48.99%8.05%14.60%
VfEDL226.23%51.23%8.33%14.22%
VfEDL330.26%53.38%5.45%10.90%

Multiple sequence alignment of the deduced proteins from three VfEDL genes with Arabidopsis and Vitis EDS1 proteins was conducted using ClustalW to analyze the sequence characteristics. The G-X-S-X-G motif, which is highly conserved, is found in may lipases and esterases. This motif contains an active site residue of serine in the serine hydrolases family genes (Baudoin et al. 1997; Bezier et al. 2002; Reina et al. 2007; Lee et al. 2010). The L-family amino acid sequences contain the signature sequences of [LIV]-X- [LIVFY]-[LIVMST]-G-[HYWV]-S-X-G-[GSTAC] around the active site serine that flanks a more commonly occurring G-X-S-X-G motif in the α/β hydrolase fold, and EDS1 conforms to the L family amino acid signature (Falk et al. 1999). Chong et al. (2007) showed that EDS1 sequences from Arabidopsisthaliana, Vitisvinifera, Solanumtuberosum, S. lycopersicum, Nicotianatabacum and Oryzasativa contained the L-family/class 3 lipase consensus sequence, three lipase catalytic triads, a serine (S), an aspartate (D) and a histidine (H), as well as the EDS1 and PAD4 (EP) conserved domain, which is well conserved among species. Wagner et al. (2013) also reported that plant EDS1 protein contained the consensus sequence of G-X-S-X-G and catalytic triads, a serine situated in the conserved G-X-S-X-G, an aspartic acid and a histidine by aligning sixteen plant EDS1 proteins. The alignment results showed that all proteins predicted from VfEDL genes contained the L-family lipase like domain (class 3 lipase domain) and also exhibited a potential lipase catalytic triad, aspartic acid, histidine and serine in the conserved G-X-S-X-G. The residues of the catalytic triad, which are essential for the activity of the hormone sensitive lipase in humans (Osterlund et al. 1996), were dispersed in primary amino acid sequences, but came together in the tertiary structure (Fig. 1 and 2). Sequence analysis revealed that the predicted proteins from the EDL genes of V. flexuosa correspond to the characteristics of the EDS1 protein.

Fig. 1.

Multiple alignment of three predicted proteins from the VfEDL gene and two other EDS1 proteins. The class 3 lipase consensus sequence is indicated by the bar above the motifs, the EP domain is shown by the bar under the domain, and asterisks indicate the positions of the catalytic triad inferred from AtEDS1 protein


Fig. 2.

Tertiary structure of VfEDL proteins: a) VfEDL1, b) VfEDL2 and c) VfEDL3 created by PyMOL. Sticks indicate conserved catalytic triads


Amino acid sequence comparison

All protein sequences predicted from V. flexuosa were compared against themselves and Arabidopsis EDS1 protein (AtEDS1) using BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Table 4). The results showed that VfEDL1, VfEDL2 and VfEDL3 were 43%, 41% and 42% identical to AtEDS1, respectively. The predicted amino acid sequences from VfEDL genes showed 68% to 82% identity among themselves, with the highest similarity (82%) observed between VfEDl2 and VfEDL3. Taken together, these findings indicated that VfED2 and VfEDL3 are duplicated genes according to Kong et al. (2013). A phylogenetic tree from 14 protein sequences related to EDS1 from dicots and monocots including three VfEDL proteins and two PAD4 proteins as the out- group was constructed to show the genetic relationships among plant EDLs by the neighbor joining method using MEGA6 (Fig. 3).

Percent identities of the amino acid sequences among VfEDLs and AtEDS1

 VfEDL1  VfEDL2  VfEDL3  AtEDS1 
VfEDL1-687143
 VfEDL2 68-8241
VfEDL37182-42
AtEDS1434142-

Fig. 3.

Phylogenetic tree of predicted proteins from the VfEDL genes with other EDS1-like proteins. The unrooted tree was generated using the MEGA 6.0 software and the neighbor-joining method. Bootstrap values (above 70%) from 1000 replicates are indicated at each node


EDS1 and PAD4 proteins are closely related in structure, both containing the N-terminal lipase and C-terminal EP domains (Wiermer et al., 2005), as well as in their function (Wagner et al. 2013). The genes were subdivided into four groups (group I-IV), excluding the out-group. In the tree, AtPAD4 and GmPAD4 were grouped as an out-group, and the VfEDL proteins were more closely related to EDS1 than PAD4. VfEDL proteins were clustered into the same group with Vitis EDS1 proteins and diverged from other proteins. Therefore, clustering EDLs in the phylogenic tree showed that EDS1 related proteins of Vitis are novel compared to other plant proteins. These results are consistent with those of a previous report that showed Vitis EDS1 proteins were grouped together in a phylogenetic tree and diverged from other plant proteins (Gao et al. 2010). The predicted amino acid sequences from the three loci of the VfEDL gene showed a high level of similarity with protein sequences of other plant species in a homology study of VfEDL genes by BLAST searches of the NCBI database. All VfEDL proteins were highly homologous with the protein sequences that originated from the Vitis genus, with identities of greater than 68% and E values of 0.0, indicating their relatively conserved evolutionary relationship at the protein level (Table 5).

Homology analysis of three predicted proteins from the VfEDL gene of V. flexuosa

ProteinTop matched clonesTop homologous speciesIdentity (%)Query cover (%)E valueReferences
VfEDL1ABU43059.1Vitis vinifera991000.0Chong et al. (2008)
VfEDL2AEM75095.1Vitis vinifera681000.0Gao et al. (2010)
VfEDL3AEM75097.1Vitis aestivalis711000.0Gao et al. (2010)

Expression analysis of VfEDL genes

Expression analysis of VfEDL genes against pathogen infections was performed by quantitative real-time PCR using gene specific primers based on nucleotide sequence alignment. The expression levels of tested genes in grapevine leaves infected with pathogens were examined based on comparison to uninoculated control samples. The expression levels of three VfEDL genes against E. ampelina pathogens are shown in Fig. 4a. VfEDL1 showed downregulated expression at all time points, while VfEDL2 and VfEDL3 were upregulated at 1 hpi and downregulated during infection with E. ampelina. The highest expression of VfEDL3 was observed at 1 hpi, which was upregulated 2.6 fold relative to the control. The responses of VfEDL genes to R. vitis infection are presented in Fig. 4b. All genes showed upregulated expression at 1 hpi against R. vitis. Among them, VfEDL1 and VfEDL3 showed a rapid decrease in expression after 1 hpi and VfEDL3 showed upregulation for up to 24 hpi. The highest expression of VfEDL2 was 2.5 fold greater than that of the control at 1 hpi following R. vitis infection.

Fig. 4.

Expression pattern of three EDL genes of Vitis flexuosa against E. ampellina (a) and R. vitis (b). VfEDL1 (), VfEDL2 () and VfEDL3(). The error bars represent the standard error of the means of three independent replicates


EDS1 is an essential signaling component for resistance mediated by a large subclass of R genes denoted by the Toll interleukin 1 receptor-nucleotide binding site-leucine rich repeat (TIR-NBS-LRR) in Arabidopsis, which is downstream from R gene function (Glazebrook 2001; Wagner et al. 2013). EDS1 is also essential to hypersensitive cell death and basal resistance against bacterial, fungal and oomycete pathogens (Parker et al. 1996; Aarts et al. 1998; Falk et al. 1999; Jirage et al. 1999; Xiao et al. 2005; Oridi & Bouarab 2007; Sing and Shah 2012). EDS1 functions in plant innate immunity with its partners, SAG101 and PAD4 (Sing and Shah 2012; Wagner et al. 2013). EDS1 encodes the protein with homology to eukaryotic lipases and bears conserved lipase catalytic triads made up of an active site serine surrounded by the conserved consensus sequence G-X-S-X-G, an aspartic acid and a histidine (Falk et al. 1999; Wagner et al. 2013). In the present study, the molecular structure was analyzed to detect common characteristics in three VfEDL transcripts based on their predicted amino acid sequences in V. flexuosa. All tested VfEDL proteins contained the L-family lipase like domain (class 3 lipase domain) and exhibited a potential lipase catalytic triad, aspartic acid, histidine and serine in the conserved G-X-S-X-G. The residues of the catalytic triad were dispersed in primary amino acid sequences, but came together in the tertiary structure (Fig. 1 and Fig. 2), which are characteristic features of EDS1 like proteins. Phylogenetic analysis also showed that all of these proteins grouped with EDS1 proteins of Vitis (Fig. 3).

Defense responses against most pathogens are generally mediated by initiating signal pathways of disease resistance (R) genes in plants. In this pathway, signaling molecules are very important for receiving and transducing external and internal stimuli through signaling cascades to elicit appropriate cellular responses. To date, several signaling genes including EDS1, NDR1, PAD4, SID1, EDS5, SID2, EDS16, NPR1 and NIM1 required for the R gene specified resistance and signaling pathway have been discovered in Arabidopsis (Cao et al. 1994; Century et al. 1995; Delaney et al. 1995; Glazebrook et al. 1997; Rogers and Ausbel 1997; Aarts et al. 1998; Zhou et al. 1998; Falk et al. 1999; Nawrath and Metraux 1999; Rusterucci et al. 2001). Falk et al. (1999) reported that ArabidopsisEDS1 transcript was increased during infection with the bacterial pathogen Pseudomonassyringae, but its transcript was undetectable in its mutant plant. It has been reported that GmEDS1a, GmEDS1b and GmPAD4 were induced to high levels in soybean at 2 days post inoculation (dpi) against the bacterial pathogen Pseudomonassyringae pv. glycinea (Psg) (Wang et al. 2014). They also showed decreased expression of these genes after silencing them. Moreover, GmEDS1a, GmEDS1b and GmPAD4 decreased production of salicylic acid (SA) relative to control plants during Phytophthorasojae infection when these genes were silenced. These silenced plants also showed enhanced susceptibility to the bacterial pathogen P. syringae pv. glycinea, fungal pathogen P. sojae and soybean mosaic virus (SMV). Oridi and Bouarab (2007) reported that the expression levels of two plant signaling genes required for hypersensitive response dependent resistance, EDS1 and SGT1, were increased in Nicotianabenthamiana during Botrytiscinerea infection. Interestingly, they showed that these two signaling molecules are required for the disease caused by B. cinerea by silencing these genes when the necrotic disease was significantly reduced on leaves in silenced plants compared to control plants, and that EDS1 and SGT1 transcript accumulation was reduced in silenced plants. Gao et al. (2010) reported that there were no EDS1-like genes that were significantly upregulated by the grapevine powdery mildew pathogen Erysiphenecator in both resistant ‘Norton’ of V. aestivalis and susceptible ‘Cabernet Sauvignon’ of V. vinifera. Although transcript level was not significantly higher in treated samples than control samples, VaEDS1 complemented Arabidopsiseds1 mutants by reducing bacterial growth relative to eds1 mutant during inoculation of Pseudomonassyringae pv. tomato strain DC3000 containing avrRps4.

In this study, we attempted to investigate the change of transcript levels of three VfEDL genes in response to infection with pathogenic fungi and bacteria in grapevines. In the expression study, all three VfEDL genes were upregulated at 1 hpi against bacterial pathogen R. vitis and two genes, VfEDL2 and VfEDL3, also showed upregulation at 1 hpi against fungal pathogen E. ampelina, after which all of them showed reduction in their expressions. This expression pattern was similar to the previous reports about expression pattern of EDS1 genes (Oridi and Bouarab 2007; Gao et al. 2010; Wang et al. 2014). VfEDL1 showed down regulated expression at all time points against E. ampelina, but its expression was upregulated against R. vitis infection at early time points, suggesting that the VfEDL1 gene functions in diverse response processes against bacterial and fungal pathogens. Moreover, they exhibited different expression patterns in response to pathogen infections at various times, indicating that VfEDL plays a role in defense signaling pathways against pathogen infection in grapevines.

Signaling molecules play very important roles in defense mechanisms against pathogens by receiving and transducing external and internal stimuli in plants. EDS1-like genes are important signaling molecules in plants. In this study, we attempted to identify and characterize three transcripts of the VfEDL gene that showed various expression levels in the transcriptome of grapevines inoculated with E. ampelina. The molecular structures were analyzed to detect characteristics features in three EDS1-like genes. In addition, a homology comparison study was performed using NCBI BLAST searches and phylogenetic analysis based on their predicted amino acid sequences in V. flexuosa. Structural analysis and a comparison study confirmed that the tested genes are EDS1-like genes. Additionally, the expression pattern of VfEDL transcripts investigated by real-time PCR using gene specific primers showed that all genes tested in this study showed responses with different patterns against each tested pathogen, indicating that these genes may be involved in resistance responses against different pathogens in grapevines. The results presented herein provide valuable information to help unravel the complex signaling molecular mechanisms of resistance response to diseases in grapevines.

Acknowledgement

This work was supported by Grant no. PJ011939 from the Agricultural R&D Project, Rural Development Administration, Republic of Korea.

References
  1. Aarts N, Metz M, Holub E, Staskawicz B, Daniels M, and Parker J. (1998) 1998 requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci USA 95, 10306-10311.
    Pubmed KoreaMed CrossRef
  2. Ahn S, Kim S, Jo S, and Yun H. (2014) 2014 novo transcriptome analysis of Vitis flexuosa grapevine inoculated with Elsinoe ampelina. Plant Genet Resour-Charact Util 12, S130-S133.
    CrossRef
  3. Ahn S, Kim S, Kim S, and Yun H. (2012) 2012 expression screening of defense related genes in Vitisflexuosa grapevine against Elsinoeampelina and Rhizobiumvitis. Korean J Intl Agri 24, 470-476.
  4. Baudouin E, Charpenteau M, Roby D, Macro Y, Ranjeva R, and Ranty B. (1997) 1997 expression of a tobacco gene related to the serine hydrolase family esterase activity towards short- chain dinitrophenyl axcylesters. Eur J. Biochem 248, 700-706.
    Pubmed CrossRef
  5. Bezier A, Lamber B, and Baillieul F. (2002) 2002 of a grapevine Botrytis-responsive gene that has homology to the tobacco hypersensitivity-related hsr203J. J Exp Bot 53, 2279-2280.
    Pubmed CrossRef
  6. Cao H, Bowling S, Gordon S, and Dong X. (1994) 1994 of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6, 1583-1592.
    Pubmed KoreaMed CrossRef
  7. Century K, Holub E, and Staskawicz B. (1995) NDR1 a locus of Arabidopsis thaliana that is required for disease resistance to both a bacterial and fungal pathogen. Proc Natl Acad Sci USA 92, 6597-6601.
    Pubmed KoreaMed CrossRef
  8. Chang S, Puryear J, and Cairney J. (1993) 1993 simple and efficient method for isolating RNA from pine trees. Plant Mol Biol 11, 113-116.
    CrossRef
  9. Chong J, Le Henanff G, Bertsch C, and Walter B. (2007) 2007, expression analysis and characterization of defense and signaling genes in Vitisvinifera. Plant Physiol Biochem 46, 469-481.
    Pubmed CrossRef
  10. Dangl J, and Jones J. (2001) 2001 pathogens and integrated defense responses to infection. Nature 411, 826-833.
    Pubmed CrossRef
  11. Delaney T, Friedrich L, and Ryals J. (1995) Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc Natle Acad Sci USA 92, 6602-6606.
    CrossRef
  12. Eastwell K, Sholberg P, and Sayler R. (2006) 2006 potential bacterial biocontrol agents for suppression of Rhizobiumvitis causal agent of crown gall disease in grapevines. Crop Prot 25, 1191-1200.
    CrossRef
  13. Eibach R, Diehl H, and Alleweldt G. (1989) 1989 zur vererbung von resistenzeigenschaften bei reben gegen OidiumtuckeriPlasmoparaviticol a and Botrytiscinerea. Vitis 28, 209-228.
  14. Falk A, Feys B, Frost L, Jones J, Daniels M, and Parker J. (1999) EDS1 an essential component of R gene-mediated diseases resistance in Arabidopsis has homology to eukaryotic lipases. Proc Natl Acad Sci USA 96, 3292-3297.
    Pubmed KoreaMed CrossRef
  15. Gao F, Shu X, Ali M, Howard S, Li N, Winterhagen P, Qiu W, and Gassmann W. (2010) 2010 functional EDS1 ortholog is differentially regulated in powdery mildew resistant and susceptible grapevines and complements an Arabidopsiseds1 mutant. Planta 231, 1037-1047.
    Pubmed CrossRef
  16. Garcia A, Blanvillain-Baufume S, Huibers R, Wiermer M, Li G, Gobbato E, Rietz S, and Parker J. (2010) 2010 nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response. PLos Pathog 6, e1000970.
    Pubmed KoreaMed CrossRef
  17. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel R, and Bairoch A. (2003) 2003:the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res 31, 3784-3788.
    Pubmed KoreaMed CrossRef
  18. Geourjon C, and Deleage G. (1995) 1995:significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Appl Biosci 11, 681-684.
  19. Glazebrook J. (2001) 2001 controlling expression of defense responses in Arabidopsis. Curr Opin Plant Biol 4, 301-308.
    CrossRef
  20. Glazebrook J, Zook M, Mert F, Kagan I, Rogers E, Crute I, Holub E, Hammerschmidt R, and Ausbel F. (1997) 1997-deficient mutants of Arabidopsis reveal that PAD4 encodes a regulatory factor and that four PAD genes contribute to downy mildew resistance. Genetics 146, 381-392.
  21. Guruprasad K, Reddy B, and Pandit M. (1990) 1990 between stability of a protein and its dipeptide composition:a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng 4, 155-161.
    Pubmed CrossRef
  22. Hammond-Kosack K, and Jones J. (1996) 1996 gene-dependent plant defense responses. Plant Cell 8, 1773-1791.
    Pubmed KoreaMed CrossRef
  23. Heidrich K, Wirthmueller L, Tasset C, Pouzet C, Deslandes L, and Parker J. (2011) ArabidopsisEDS1 connects pathogen effector recognition to cell compartment-specific immune response. Science 334, 1401-1404.
    Pubmed CrossRef
  24. Jirage D, Tootle T, Reubert T, Frost L, Feyes B, Parker J, Ausubel F, and Glazebrook J. (1999) Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proc Natl Acad Sci USA 96, 13583-13588.
    Pubmed KoreaMed CrossRef
  25. Joshi R, and Nayak S. (2011) 2011 characterization and signal transduction ability of nucleotide-binding site-leucine-rich repeat resistance genes in plants. Genet Mol Res 10, 2637-2652.
    Pubmed CrossRef
  26. Kong X, Lv W, Jiang S, Zhang D, Cai G, Pan J, and Li D. (2013) 2013-wide identification and expression analysis of calcium-dependent protein kinase in maize. BMC Genomics 14, 433.
    Pubmed KoreaMed CrossRef
  27. Kono A, Nakaune R, Yamada M, Nakano M, Mitani N, and Ueno T. (2009) 2009 of culture conditions on conidia formation by Elsinoeampelina the causal organism of grapevine anthracnose. Plant Dis 93, 481-484.
    CrossRef
  28. Kortekamp A, Welter L, Vogt S, Knoll A, Schwander F, Töpfer R, and Zyprian E. (2008) 2008, isolation and characterization of a CC-NBS-LRR candidate disease resistance gene family in grapevine. Mol Breeding 22, 421-432.
    CrossRef
  29. Lee G, Chepyshko H, Chen H, Chu C, Chou Y, Akoh CC, and Shaw J. (2010) 2010 and biochemical characterization of the three novel chlorophyllase isozymes from Brassicaoleracea. J Agr Food Chem 58, 8651-8657.
  30. Letunic I, Doerks T, and Bork P. (2009) 2009 6:Recent updates and new developments. Nucleic Acids Res 37, D229-D232.
    Pubmed KoreaMed CrossRef
  31. Liu J, Liu X, Dai L, and Wang G. (2007) 2007 progress in elucidating the structure, function and evolution of disease resistance genes in plants. J Genet Genomics 34, 765-776.
    CrossRef
  32. Meyers B, Dickerman A, Michelmore R, Sivaramakrishnan S, Sobral B, and Young N. (1999) 1999 disease resistance genes encode members of an ancient and diverse protein family with in the nucleotide-binding superfamily. Plant J 20, 317-332.
    Pubmed CrossRef
  33. Nawrath C, and Metraux J. (1999) 1999 acid induction deficient mutants of Arabidopsis expess PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11, 1393-1404.
    Pubmed KoreaMed CrossRef
  34. Oirdi M, and Bouarab K. (2007) 2007 signalling components EDS1 and SGT1 enhance disease caused by the necrotrophic pathogen Botrytiscinerea. New Phytol 175, 131-139.
    Pubmed CrossRef
  35. Osterlund T, Danielsson B, Degerman E, Contreras JE, Edgren G, Davis RC, Schotz MC, and Holm C. (1996) 1996 structure analysis of recombinant hormone sensitive lipase. Biochem J 319, 411-420.
  36. Pan Q, Wendel J, and Fluhr R. (2000) 2000 evolution of plant NBS-LRR resistance gene homologues in dicot and cereal genomes. J Mol Evol 50, 203-213.
    Pubmed CrossRef
  37. Parker J, Holub E, Frost L, Falk A, Gunn N, and Daniels M. (1996) 1996 of eds1 a mutation in Arabidopsis suppressing resistance to Peronosporaparasitica specified by several different RPP genes. Plant Cell 8, 2033-2046.
    Pubmed KoreaMed CrossRef
  38. Reina J, Guerrero C, and Heredia A. (2007) 2007, characterization, and localization of AgaSGNH cDNA:a new SGNH-motif plant hydrolase specific to Agave americana L. leaf epidermis. J Exp Bot 58, 2717-2731.
    Pubmed CrossRef
  39. Rogers E, and Ausbel F. (1997) Arabidopsis enhanced disease susceptibility mutants exhibit enhanced susceptibility to several bacterial pathogens and alterations in PR-1 gene expression. Plant Cell 9, 305-316.
    Pubmed KoreaMed CrossRef
  40. Rusterucci C, Aviv D, Holt B, Dangl J, and Parker J. (2001) 2001 disease resistance signaling components EDS1 and PAD4 are essential regulators of the cell death pathway controlled by LSD1 in Arabidopsis. Plant Cell 13, 2211-2224.
    Pubmed KoreaMed CrossRef
  41. Singh I, and Shah K. (2012) In silico study of interaction between rice proteins enhanced disease susceptibility 1 and phytoalexin deficient 4, the regulators of salicylic acid signalling pathway. J Biosci 37, 563-571.
    Pubmed CrossRef
  42. Staskawicz B, Ausubel F, Baker B, Ellis J, and Jones J. (1995) 1995 genetics of plant disease resistance. Science 268, 661-667.
    Pubmed CrossRef
  43. Taler D, Galperin M, Benjamin I, Cohen Y, and Kenigsbuch D. (2004) 2004 R genes that encode photorespiratory enzyme confer resistance against disease. Plant Cell 16, 172-184.
    Pubmed KoreaMed CrossRef
  44. Wagner S, Stuttmann J, Rietz S, Guerois R, Brunstein E, Bautor J, Niefind K, and Parker JE. (2013) 2013 basis for signaling by exclusive EDS1 Heteromeric complexes with SAG101 or PAD4 in plant innate Immunity. Cell Host Microbe 14, 619-630.
    Pubmed CrossRef
  45. Wang J, Shine M, Gao Q, Navarre D, Jiang W, Liu C, Chen Q, Hu G, and Kachroo A. (2014) 2014 disease susceptibility1 mediates pathogen resistance and virulence function of a bacterial effector in soybean. Plant Physiol 165, 1269-1284.
    Pubmed KoreaMed CrossRef
  46. Wang Q, Zhang Y, Gao M, Jiao C, and Wang X. (2011) 2011 and expression analysis of a pathogen responsive PR-1 gene from Chinese wild Vitis quinquangularis. Afr J Biotechnol 10, 17062-17069.
  47. Wiermer M, Feys B, and Parker J. (2005) 2005 immunity:the EDS1 regulatory node. Curr Opin Plant Biol 8, 383-389.
    Pubmed CrossRef
  48. Xiao S, Calis O, Patrick E, Zhang G, Charoenwattana P, Muskett P, Parker JE, and Turner JG. (2005) 2005 atypical resistance gene, RPW8, recruits components of basal defence for powdery mildew resistance in Arabidopsis. Plant J 42, 95-110.
    Pubmed CrossRef
  49. Yun H, Park K, Roh J, Choi Y, and Jeong S. (2007) 2007 a screening system for resistance to anthracnose in grapevines using culture filtrates from Elsinoe ampelina. J Hortic Sci Biotech 82, 360-364.
    CrossRef
  50. Zhou N, Tootle T, Tsui F, Klessig D, and Glazebrook J. (1998) PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell 10, 1021-1030.
    Pubmed KoreaMed CrossRef


September 2017, 44 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM