search for




 

Identification of specific SNP molecular marker from Cudrania tricuspidata using DNA sequences of chloroplast TrnL-F region
J Plant Biotechnol 2017;44:135-141
Published online June 30, 2017
© 2017 The Korean Society for Plant Biotechnology.

Soo Jin Lee, Yong-Wook Shin, Yun-Hee Kim*, and Shin-Woo Lee*

Department of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Korea,
Department of Biology Education, College of Education, IALS, Gyeongsang National University, Jinju, Korea
Correspondence to: e-mail: cefle@gnu.ac.kr
Received May 31, 2017; Revised June 26, 2017; Accepted June 26, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Cudrania tricuspidata Bureau is a widely used medicinal perennial woody plant. For conservation and germplasm utilization of the plant, it is imperative to obtaining information regarding the genetic diversity of the plant populations. Although C. tricuspidata is an important medicinal plant registered in South Korea, no molecular markers are currently available to distinguish Korean-specific ecotypes from other ecotypes of different countries. In this study, we developed single nucleotide polymorphism (SNP) markers derived from chloroplast genomic sequences to identify distinct Korean-specific ecotypes of C. tricuspidata via the amplification refractory mutation system (ARMS)-PCR analyses. Molecular authentication of twelve C. tricuspidata ecotypes from different regions was performed, using DNA sequences in the trnL-F chloroplast intergenic region. The SNP markers developed in this study are useful for rapidly identifying specific C. tricuspidata ecotypes from different regions.

Keywords : ARMS-PCR, chloroplast genome, single nucleotide polymorphisms
서언

구지뽕 나무(Cudrania tricuspidata Bureau)는 일반적으로 병충해에 강한 소득형 농업작목으로서, 줄기와 뿌리는 암 치료에 이용되고 있으며, 잎과 열매는 식용 가능한 식품 원료로 이용되고 있다. 구지뽕 잎은 단백질, 식이섬유, 칼슘 및 GABA (γ-amino byturic acid) 뿐만 아니라 주요 항산화물질인 비타민 B1, B2, 루테인 등이 풍부하며(Lee et al. 2007), 구지뽕 뿌리는 소화계의 암세포주에 저해 활성을 보이는 isoprenylated xanthone 또는 isoprenylated flavanones계에 속하는 물질들이 분리 된 바 있다(Zou et al. 2005). 또한, isoprenylated xanthone인 cudrafrutixanthone A 화합물을 구지뽕 뿌리에서 분리하여 Candida albicans 균주의 활성을 저해하는 항진균 작용이 확인되었으며(Wang et al. 2005), 이외에도 간암 및 간독성의 억제(Tian et al. 2005; An et al. 2006), 혈압강하작용(Kang et al. 2002), 항우울 작용 및 파킨슨병 예방(Han et al. 2005), 고지혈증 및 동맥경화 억제(Park et al. 2006)에 효과가 있음이 보고된 바 있다. 그러므로, 구지뽕 나무는 다양한 항균 및 항암 활성을 갖는 주요 식물임을 알 수 있다.

꾸지뽕 나무(C tricuspidata Bureau)는 뽕나무과(Molaceae)에 속하며, 세계적으로 73속 1,000여종이 분포하고 있다고 알려져 있다. 국내에는 5속 10여종이 서식하고 있는 것으로 보고된 바 있으며, 그 중 꾸지뽕 나무는 인도, 중국, 호주에 각각 3종과 일본에 2종이 자생하고 있는 것으로 보고 되어 있다(Lee et al. 1985; Lee 1986). 최근 나고야의정서의 발효 등의 국제적 추세에 따라 자국의 유전자원의 발굴, 보존 등이 강화됨에 따라 중국과 한국 꾸지뽕 계통을 판별 할 수 있는 기준 설정에 관한 연구의 필요성이 대두되었다. 특히 전통적으로 이용되고 있는 형태학적 연구 결과를 기초로 한 분자생

물학적 판별 기술의 개발이 더욱더 필요한 실정이다(Kwon et al. 2014).

최근 활발히 진행 중인 특정 유전자의 단일염기 다형성(single nucleotide polymorphism, SNP) 적용을 통한 분자표지인 바코드(barcode)의 개발에 관한 연구는 특이적 품종이나 생태 종의 확인을 위해 매우 중요한 연구라 할 수 있다 (He et al. 2011). SNP를 확인한 후 그 SNP에 이웃하고 있는 2번째 또는 3번째의 염기를 변경하여 mismatch primer를 제작하여 PCR 반응과정에서 특이성을 증대시킨 amplification refractory mutation system(ARMS)-PCR기술의 이용은 정확한 판별결과를 얻기 위한 매우 중요한 기술이라 할 수 있다 (Han et al. 2016). 특히, 엽록체와 핵 내에 내재하는 유전자 단편의 SNP를 이용한 ARMS-PCR 기술을 적용하여 국가간 또는 지역간에 서식하는 토종 계통의 판별과 함께 이들의 혼재율 및 상호교배에 의한 교잡종 여부 등도 판별이 가능하기 때문에 매우 적용이 필요한 중요한 기술이라 할 수 있다. 최근 유사한 약용식물인 백하수오, 적하수오 및 이엽우피소의 구분을 위해 엽록체와 핵 내에 내재하는 유전자 단편의 SNP를 이용한 판별기술이 발표된 바 있다 (Han et al. 2016)

선행연구 결과로써, 국내에서 생육 중인 구지뽕 나무의 핵내 유전자 단편인 ITS 지역의 염기서열을 비교분석 한 결과, 꾸지뽕 나무는 다른 뽕나무속 식물과 쉽게 구분이 가능한 다양한 SNP를 확인하였다(Sung et al. 2001). 그러나 지역별로 수집한 꾸지뽕 나무계통간 또는 암수나무 사이에는 염기서열의 큰 차이가 없었다. 또한, 최근 국내에 분포하고 있는 꾸지뽕나무를 8개 그룹으로 그 계통을 분류하여 암·수나무를 구분하여 ITS 영역의 염기서열을 비교 분석한 결과 99.4에서 99.8%이상의 유의성을 보였으며, 지역별로 암·수 계통 간에 단일염기 다형성을 확인할 수 있었다(Oh et al. 2012). 그러나 이 후 추가적인 연구결과가 보고된 것이 없어 최근의 보다 진전된 분자생물학적 기술을 적용한 판별 마커의 개발이 절실한 실정이다.

본 연구에서는 한국산 국내 토종과 중국 계통의 구지뽕 나무의 기원을 판별하기 위해 엽록체에 존재하는 TrnL-TrnF 유전자단편에서 SNP를 이용한 판별 프라이머를 확보하였으며 이를 보완하여 보다 신속하게 판별하기 위하여 ARMS- PCR기술을 이용한 판별 마커와 그 조건을 확립하였다.

재료 및 방법

실험재료

실험에서 사용한 꾸지뽕 계통은 경남지역에 분포하는 중국 혹은 한국 계통의 기원이 확실하게 알려진 계통을 확보하였으며, 이 외에 경남 진주시 대곡면, 경남 의령군 대의면, 경남 진주시 미천면 대암, 경남 밀양 등의 꾸지뽕 재배 농가 혹은 전남 해남군 송지면 송호리 산 45번지의 땅끝마을 등에서 분양받거나 직접 채취한 시료들을 대상으로 조사하였다 (Table 1).

List of plant materials used in this study

Identification codeScientific nameCultivated regions (sources)Identified origin
2014-30Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth Korea
2014-31Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth Korea
2014-33Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth Korea
2014-34Cudrania tricuspidata BureauSacheon, Gyeongnam, KoreaSouth Korea
2014-36Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth Korea
2014-37Cudrania tricuspidata BureauUiryeong, Gyeongnam, KoreaSouth Korea
2014-38Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth Korea
2014-39Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth Korea
2014-41Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaChina
2014-42Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth Korea
2016-10Cudrania tricuspidata BureauMiryang, Gyeongnam, KoreaChina
2016-47Cudrania tricuspidata BureauCommercial herbsChina

DNA 분리

수집된 계통별로 일정량의 뿌리, 종자, 잎 등을 액체질소에 급속 냉동시킨 후 곱게 갈아서 얻은 분말을 이용하여 GeneAll사의 ExgeneTM Plant SV 키트를 이용하여 회사에서 제공한 실험방법에 따라 염색체 DNA를 분리하였다. 정제된 DNA는 1% agarose gel에서 전기영동을 실시하여 DNA의 분리과정에서의 분해정도를 확인한 후 Micro-spectrometer (BioPrince, SD-2000, Gangwon, South Korea)를 이용하여 234 nm, 260 nm, 280 nm에서 각각 흡광도를 측정하여 A260/A280 값이 1.8 ~ 2.2 범위 그리고 A234/A260 값이 0.5-0.8 범위 내 포함 여부를 조사하여 RNA 및 단백질 등의 오염 정도를 확인하여 순수한 DNA를 확인하였다.

엽록체 유전자(trnL-F)의 증폭 및 염기서열 분석

엽록체 유전자 내의 SNP를 확인하고자 trnL-trnF유전자 단편의 증폭을 위하여 Table 2에 표시된 기존의 알려진 유전자의 염기서열정보를 사용하여 각각의 프라이머를 제작하였다 (GenBank Accession number JN006418.1). 유전자의 증폭은 iNtRON 회사(Gyeonggi Province, South Korea)에서 제공하는 PCR 반응용 완충용액 및 i-pfu DNA polymerase를 사용하여 중합반응과정에서 야기 될 수 있는 돌연변이를 최소화 하였다. 제조사에서 제공하는 실험방법에 따라 순수 분리한 DNA 50 ng과 프라이머를 각각 10 pmole을 혼합 한 후 94°C에서 5분간 DNA를 변성 시킨 후 94°C에서 30초, 60°C에서 10초, 72°C에서 30초를 1 cycle로 하여 35 cycle 반복 후 72°C에서 5분간 연장반응을 시킨 후 4°C에서 반응을 종료하고 증폭된 DNA밴드는 2.0% agarose gel을 이용하여 전기영동 하여 그 결과를 확인하였다. 증폭 되어진 각 유전자 단편의 클로닝 과정에서 돌연변이가 일어날 수도 있으므로 클로닝을 하지 않고 증폭된 DNA단편을 ExpinTM PCR SV (GeneAll, Seoul, South Korea)Kit를 사용하여 순수 정제한 후 직접 염기서열분석을 의뢰하였다. 또한 최종적으로 확인된 SNP는 최소 5반복 이상 수행하여 검정하였다.

Primer sequences used in this study

A. SNP analysis
GenePrimersSequences (5’–3’)Tm (°C)Size (bp)

TrnL-FTrnL-F forwardGATATGGCGAAATCGGTAGACG57.21047
TrnL-F reverseTGCCAGGAACCAGATTTGAACT57.2

B. ARMS-PCR analysis

OriginPrimersSequences (5’–3’)Tm (°C)Size (bp)

ChinaCHI-41 specific forwardGATATGGCGAAATCGGTAGACG57.2505
CHI-41 specific reverseCTTACTATAAATTTCATTGTTGGCA51.7

Korea/ChinaKOR, CHI-10, 47 specific forwardGATATGGCGAAATCGGTAGACG57.2505
KOR, CHI-10, 47 specific reverseCTTACTATAAATTTCATTGTTGTCG55.1

ChinaCHI-10, 47 specific forwardGATATGGCGAAATCGGTAGACG57.2849
CHI-10, 47 specific reverseGGCCTTGGTGAAATTTCTTGA57.4

Korea/ChinaKOR, CHI-41 specific forward KOR, CHI-41 specific reverseGATATGGCGAAATCGGTAGACG GGCCTTGGTGAAATTTCTTGG57.2 59.4849

유연관계 분석

확인된 TrnL-F 유전자의 유연관계 분석은 Mega 6.0 프로그램을 이용해 진행하였다. 비교 군들간의 유전적 거리의 계산은 Tamura-Nei distance 방법을 이용하였으며, neighbor-joining 방법을 이용해 유연관계를 분석하였다(Tamura et al. 2013).

ARMS-PCR

일반적으로 SNP를 이용하여 제작한 mismatch primer를 사용하여 특정 계통을 판별하기 위해 많이 이용하기 때문에, 본 연구에서는 TrnL-F 유전자의 SNP를 나타내는 염기를 3′-말단에 위치하게 하고, 5′-말단 쪽으로 첫 번째 또는 세 번째의 염기를 인위적으로 변형시킨 primer를 사용하여 특이성을 향상 시킬 수 있는 ARMS-PCR기술을 도입 하였다(Table 2).

결과 및 고찰

엽록체 유전자단편 TrnL-F내에 존재하는 SNP 확인

국내 토종으로 알려진 한국산 9종의 구지뽕 시료들과 중국에서 도입되거나, 중국 종으로 알려진 3종의 꾸지뽕 시료들의 엽록체 유전자 단편인 T rnL-F의 염기서열 분석을 한 결과, 9종의 국내유래의 구지뽕 시료들은 모두 같은 염기서열을 보였으나, 중국 유래의 3종은 염기서열의 차이를 보였다 (Fig. 1A). 유전적 유연관계 분석을 통해 3종의 중국유래 구지뽕들 중 경남 산청의 재배종인 2014-41이 경남 밀양의 재배종인 2016-10과 상업적으로 수입된 2016-47 시료보다 가까운 유연관계를 나타냄을 확인할 수 있었다 (Fig. 1B).

Fig. 1.

Sequence alignment and phylogenetic tree showing the genetic diversity of 12 ecotypes of Cudrania tricuspidata Bureau using the TrnL-F (GenBank accession number JN006418.1) chloroplast intergenic regions. (A) Sequence alignment of the TrnL-F chloroplast intergenic region in each ecotype. The black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. (B) Phylogenetic tree showing the genetic diversity of 12 ecotypes of Cudrania tricuspidata Bureau. The tree was produced using the neighbor-joining method based on intergenic sequences of the TrnL-F


국내 유래의 구지뽕들과 중국 유래의 2016-10과 2016-47은 TrnL-F 유전자 단편의 약 870 bp 부위에서 12 bp (TTTTTAA TTCAC)가 특이적으로 반복되어 있는 것을 확인할 수 있었다(Fig. 1A). 중국계통인 2014-41은 한국계통과 비교하여 459번 염기가 C에서 T로 변한 단 하나의 SNP가 확인 되었으며, 870번 부근에서 12 bp (TTTTTAATTCAC)가 삭제된 것으로 확인 되었다(Table 3). 그러나 2016-10과 47번 중국계통은 한국계통과 비교하여 237, 238, 807번 염기에서 C가 T 또는 A로 변한 SNP를 확인할 수 있었다. 905번과 918번 염기에서는 2016-47 중국계통 특이적 SNP가 확인 되었다(염기서열 A의 결실 및 C의 전이). 그러므로, 본 연구결과의 TrnL-F의 SNP 분석을 통해서는 한국품종 특이적인 SNP 부위를 찾을 수 없었다.

The SNPs in TrnL-F as a molecular marker of each ecotypes. The length of the alignment of each ecotype was approximately 956 bp or 944 bp

SNP location (bp)

Identification Origin (identification code)237238459807870-881905918
Korean (2014-30, 31, 33, 34, 36, 37, 38, 39 and 42) CCCCTTTTTAATTCACA-
Chinese (2014-41)CCTC-A-
Chinese (2016-10)TACTTTTTTAATTCACA-
Chinese (2016-47)TACTTTTTTAATTCAC-C

엽록체 유전자단편 TrnL-F에 대한 ARMS-PCR용 primer를 이용한 한국 및 중국 꾸지뽕 계통의 판별용 마커 개발

중국 재배종 특이적 SNP 판별 마커를 개발하여 국내종과 중국종을 구분하고자, 중국유래의 구지뽕 계통 특이적 프라이머를 제작하였다(Table 3, Fig. 2A). 첫번째로 중국계통 2014-41 특이적 SNP 판별마커를 개발하기 위해 역방향 프라이머의 염기서열을 치환한 프라이머를 제작하였다. PCR 증폭의 결과, 중국계통인 2014-41 특이적 밴드를 확인할 수 있었으며, 국내계통용 프라이머는 국내계통과 중국계통인 2016-10과 47이 함께 확인되었다(Fig. 2B). 다음으로 중국계통 2016-10과 47 특이적 SNP 판별마커를 개발하기 위해 역방향 프라이머의 염기서열을 치환한 프라이머를 이용하여 PCR 증폭을 진행하였다. PCR 증폭의 결과, 중국계통인 2016-10과 47 특이적 밴드를 확인할 수 있었으며, 국내계통용 프라이머는 국내계통과 중국계통인 2014-41이 함께 확인되었다(Fig. 2C). 본 연구의 결과로써, 특이적 프라이머에 의한 특이적 PCR 밴드들을 확인할 수 있었지만, 증폭되지 않아야할 시료들에서 희미한 밴드들이 확인됨에 따라 향후 보다 다양한 조합의 mismatch 프라이머 들을 이용한 ARMS-PCR 연구가 필요할 것으로 생각된다. 그러므로, 본 연구에서는 각 중국계통 특이적 판별마커의 개발을 통해 국내계통의 판별을 간접적으로 진행할 수 있는 방법을 개발하였다.

Fig. 2.

Sequence alignment and products of ARMS-PCR using the TrnL-F (GenBank accession number JN006418.1) chloroplast intergenic regions in various ecotypes of Cudrania tricuspidata Bureau. (A) Sequence alignment of the TrnL-F chloroplast intergenic region in each ecotype. The gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. Arrows indicate the positions of the TrnL-F primers developed in this study. (B) PCR results using Chinese-41 ecotype-specific primers; (C) PCR results using Chinese-10 and 47 ecotype-specific primers. M, marker; KOR, ecotype originating from Korea; CHI, ecotype originating from China


현재까지의 연구결과를 종합하여 보면, 한국, 중국, 그리고 일본에서 그 기원을 달리하는 구지뽕 식물들의 정확한 기원판별을 위하여서는 재배조건이나, 수확 후 처리 및 가공 방법 등에 따라 크게 영향을 받지 않는 DNA단편을 이용한 분자생물학적 판별 마커의 개발이 절실히 필요한 실정이다. 그러나 한국, 중국 및 일본의 구지뽕을 중심으로 ITS region 등에 대한 특정 유전자 단편 내에 존재하는 SNP의 확인 등에 관한 연구에 한정되어 있어, 아직까지 실제 유통시장에서 실용화 하기에는 턱없이 부족하여 보다 많은 추가 연구가 필요한 것으로 생각된다. 특히 최근에 개발된 SNP를 이용한 특이프라이머의 제작 및 실용화를 위한 amplification refractory mutation system (ARMS)-PCR을 적용한 연구는 전무한 실정이었다.

본 연구의 결과에서처럼, 최근 SNP를 보이는 부분을 이용하는 DNA barcodes의 개발 및 이를 이용한 약용작물의 기원 분석에 관한 연구가 활발하게 진행되고 있다. DNA barcodes를 밝혀내는 가장 첫 단계는 각 종에 해당하는 특정 DNA단편의 염기서열을 비교하여 먼저 SNP부위를 찾는 것이라 할 수 있다. 최근, 여러 약용작물들의 근연 관계를 조사하기 위하여 엽록체 단편의 유전자 서열 또는 핵 유전체의 ribosomal DNA의 ITS 유전자 단편에 존재하는 SNP를 이용하여 연구한 결과들이 활발히 보고되고 있다(Techen et al. 2014; Han et al. 2016). 본 연구의 결과를 통해 향후, 인접국가인 중국과 일본의 지역별로 수집된 구지뽕 및 계통간 차이가 나는 SNP를 근거로 하여 이들의 혼합체를 끓여서 만든 탕재로 부터 특정 DNA 단편의 증폭이 가능할 것으로 생각되고, 염기서열분석을 통한 SNP의 확인으로 국가별 그 기원을 달리하는 구지뽕을 정확하게 판별할 수 있을 것으로 기대되는 바이다.

적요

구지뽕 나무(Cudrania tricuspidata Bureau)는 일반적으로 이용되는 대표적인 다년생의 약용식물이다. 최근 국제적 추세에 따라 자국의 유전자원의 발굴, 보존 등이 강화됨에 따라 인접국가와 국내 자생 꾸지뽕 계통을 판별 할 수 있는 기준 설정에 관한 연구의 필요성이 대두되고 있지만, 분자생물학적 판별 기술의 개발은 아직 미흡한 실정이다. 본 연구에서는 국내 토종과 중국 계통의 구지뽕 나무의 기원을 판별하기 위해 엽록체에 존재하는 trnL-trnF 유전자단편에서 SNP를 이용한 판별 프라이머를 확보하였으며 이를 보완하여 보다 신속하게 판별하기 위하여 ARMS-PCR기술을 이용한 판별 마커와 그 조건을 확립하였다. 그러므로, 본 연구에서 개발된 SNP 마커는 다양한 지역에서 서식하는 구지뽕 계통들의 신속한 확인을 위해 매우 유용하게 이용될 것으로 생각된다.

사사

본 연구는 농림축산식품부 농생명산업기술개발사업(과제번호: 314021-3-1-SB050) 지원에 의하여 연구되었음.

References
  1. An RB, Sohn DH, and Kim YC. (2006) 2006 compounds of the roots of Cudrania tricuspidata on tacrine-induced cytotoxicity in Hep G2 cells. Biol Pharm Bull 29, 838-840.
    Pubmed CrossRef
  2. Han EH, Cho KM, Goo YM, Kim MB, Shin YW, Kim YH, and Lee SW. (2016) 2016 of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species Cynanchum wilfordii, Cynanchum auriculatum and Polygonum multiflorum. Mol Biol Rep 43, 323-332.
    Pubmed CrossRef
  3. Han XH, Hong SS, Hwang JS, Jeong SH, Hwang JH, Lee MH, Lee MK, Lee D, Ro JS, and Hwang BY. (2005) 2005 oxidase inhibitory constituents from the fruits of Cudrania tricuspidata. Arch Pharm Res 28, 1324-1327.
    Pubmed CrossRef
  4. He Y, Hou P, Fan G, Song Z, Liu H, Li Y, and Zhang Y. (2011) 2011 transcribed spacers (ITS) identification of Angelica anomala Lallem Chuanbaizhi (in Chinese) cultivars collected in Sichuan and their molecular phylogenetic analysis with other Angelica L. species. J Med Plant Res 5, 3653-3657.
  5. Kang DG, Hur TY, Lee GM, Oh H, Kwon TO, Sohn EJ, and Lee HS. (2002) 2002 of Cudrania tricuspidata water extract on blood pressure and renal functions in NO-dependent hypertension. Life Sci 70, 2599-2609.
    CrossRef
  6. Kwon YS, Park BR, Lee S, Yu HC, Baek SJ, and Oh CJ. (2014) 2014 Study on the Morphological Characteristics of Leaves and Fruit of Cudrania tricuspidata in Korea. Kor J Plant Res 27, 337-343.
    CrossRef
  7. Lee CB, Kim YS, Kim JS, and Lee JS. (1985). 1985 plantbtaxonomy , pp.182. Hyangmunsa Seoul, Korea.
  8. Lee CB. (1986). 1986, pp.235. Hyangmunsa, Seoul, Korea.
  9. Lee JS, Han GC, Han GP, and Nobuyuki K. (2007) 2007 antioxidant activity and total polyphenol content of Cudrania tricuspidata. J East Asian Soc Dietary Life 17, 696-702.
  10. Oh CJ, Lee S, Kwon YS, You HC, Ryu SB, and Wi A. (2012) 2012 analysis of Cudrania tricuspidata using DNA sequences of nuclear ribosomal ITS region. J Agri Life Sci 43, 32-36.
  11. Park KH, Park YD, Han JM, Im KR, Lee BW, Jeong IY, Jeong TS, and Lee WS. (2006) 2006-atherosclerotic and anti-inflammatory activities of catecholic xanthones and flavonoids isolated from Cudrania tricuspidata. Bioorg Med Chem Lett 16, 5580-5583.
    Pubmed CrossRef
  12. Sung GB, Ryu KS, Kim HR, Nam HW, Goo TW, and Cho SY. (2001) 2001 of ITS nucleotide sequences in ribosomal DNA of Morus species. J Seric Entomol Sci 43, 1.
  13. Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S. (2013) 20136:molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30, 2725-2729.
    Pubmed KoreaMed CrossRef
  14. Techen N, Parveen I, Pan Z, and Khan IA. (2014) 2014 barcoding of medicinal plant material for identification. Curr Opin Biotech 25, 103-110.
    Pubmed CrossRef
  15. Tian YH, Kim HC, Cui JM, and Kim YC. (2005) 2005 constituents of Cudrania tricuspidata. Arch Pharm Res 28, 44-48.
    Pubmed CrossRef
  16. Wang YH, Hou AJ, Zhu GF, Chen DF, and Sun HD. (2005) 2005 and antifungal isoprenylated xanthones and flavonoids from Cudrania fruticose. Planta Med 71, 273-274.
    Pubmed CrossRef
  17. Zou YS, Hou AJ, and Zhu GF. (2005) 2005 xanthones and flavonoids from Cudrania tricuspidata. Chem Biodiver 2, 131-138.
    Pubmed CrossRef


September 2017, 44 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM