search for




 

Development of SNP markers for the identification of apple flesh color based on RNA-Seq data
J Plant Biotechnol 2017;44:372-378
Published online December 31, 2017
© 2017 The Korean Society for Plant Biotechnology.

Se Hee Kim*, Seo Jun Park, Kang Hee Cho, Han Chan Lee, Jung Woo Lee, and In Myung Choi

Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wanju 55365, Korea,
Ginseng Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Eumseong 27709, Korea
Correspondence to: e-mail: ezsehee@korea.kr
Received October 21, 2017; Revised November 1, 2017; Accepted November 1, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

For comparison of the transcription profiles in apple (Malus domestica L.) cultivars differing in flesh color expression, two cDNA libraries were constructed. Differences in gene expression between red flesh apple cultivar, ‘Redfield’ and white flesh apple cultivar, ‘Granny Smith’ were investigated by next-generation sequencing (NGS). Expressed sequence tag (EST) of clones from the red flesh apple cultivar and white flesh apple cultivar were selected for nucleotide sequence determination and homology searches. High resolution melting (HRM) technique measures temperature induced strand separation of short PCR amplicons, and is able to detect variation as small as one base difference between red flesh apple cultivars and white flesh apple cultivars. We applied high resolution melting (HRM) analysis to discover single nucleotide polymorphisms (SNP) based on the predicted SNP information derived from the apple EST database. All 103 pairs of SNPs were discriminated, and the HRM profiles of amplicons were established. Putative SNPs were screened from the apple EST contigs by HRM analysis displayed specific difference between 10 red flesh apple cultivars and 11 white flesh apple cultivars. In this study, we report an efficient method to develop SNP markers from an EST database with HRM analysis in apple. These SNP markers could be useful for apple marker assisted breeding and provide a good reference for relevant research on molecular mechanisms of color variation in apple cultivars.

Keywords : Anthocyanin, Gene expression, Transcription factor, Breeding, Cultivars
서언

사과나무(Malus domestica Borkh)는 장미과(Rosaceae) 배나무아과(Maloideae) 사과나무속(Malus)에 속하는 목본성 영년생 원예작물로 온대 지역에서 주로 재배하고 있으며, 일년생 작물에 비해 과실의 형질을 확인하기까지의 유년기간이 길고, 수형이 커서 육종을 위해서는 많은 포장 면적과 경비가 소요되어 육종 효율이 낮은 작물이다. 또한 사과나무속은 자가불화합성으로 인해 근연종은 물론이고, 품종간에도 교배 불친화성이 존재하며 유전적으로 이형접합이다(Sassa et al. 1994). 따라서 육종 효율을 높이기 위하여 유묘기에 목표형질을 가진 개체를 선발할 수 있는 조기선발 분자표지의 개발이 필요하다. 사과에서는 검은별무늬병 저항성(Yang and Kruger 1994), 흰가루병(Markussen et al. 1995), 과피색(Cheng et al. 1996)과 관련한 분자표지 개발 연구가 보고되었으며, MdMYB1 유전자를 활용한 적색 과피를 구분할 수 있는 SNP 분자표지에 관한 연구가 보고되었다(Yanmin et al. 2011).

사과 품종 육성 초기에는 대과, 고당도 품종 개발이 육종 목표였으나 최근 붉은색 과육, 항산화 기능이 높은 품종 개발 목표가 추가되었다. 사과 유전자원을 수확기의 과육색으로 분류하면 백색 과육과 적색 과육으로 나뉘어진다. 우리

나라에서는 수확했을 때 과육색이 백색인 품종을 주로 재배하고 있지만, 소비자들의 요구는 기능성 성분 함량이 높은 품종으로 변화하고 있다. 사과의 기능성 성분 함량은 백색 과육보다는 적색 과육에 더 많이 함유되어 있어, 기능성 물질의 섭취를 위해 적색 과육 사과 품종의 육성이 필요하다. 전 세계적으로 과육까지 붉은 사과 품종은 ‘Redfield’, ‘Okanagan’, ‘Purple Wave’ 등 여러 품종이 육성되었으나 대체로 산도가 높아 식미는 불량한 편이다. 적육계 사과의 식미를 개량하기 위해서 여러 조합과 세대를 진전시켜야 하며, 조기선발 분자표지 개발 등 육종연한 단축을 위한 연구가 필요하다. 과수에서 색소를 나타내는 flavonoid는 식물의 꽃, 과실, 잎, 줄기, 뿌리, 종자 등 식물체 전체 부위에 존재하며 생장과 발육, 미생물과 해충에 대한 방어, 약리적 효과, 강력한 항산화 활성을 가지고 있다(Forkmann and Martens 2001). 사과에서 꽃, 과실, 잎 등이 적색으로 발현하는 데에는 MdMYB transcription factor가 관여하는 것으로 보고되었으며(Espley et al. 2007), MdMYB1 유전자는 사과의 과피색을 적색으로 하는데 있어 key regulator로 알려져 있어서(Ban et al. 2007), 국내에서는 이 유전자에서 유래한 SNP 분자표지를 개발하여 사과의 과피색을 조기에 구분하는데 활용하고 있다(Kim et al. 2011). MdMYB10 유전자는 사과의 과육색을 적색으로 하는데 있어 중요한 역할을 하며 이 유전자에서 유래한 SNP 분자표지를 이용하여 사과의 과육색을 판별한 연구결과가 보고되었다(Chagne et al. 2007).

본 연구는 기존에 보고된 MdMYB10 유전자에서 유래한 SNP 분자표지 외에 사과 과육색을 구분할 수 있는 조기선발 분자표지의 개발을 위해 적색 과육 사과 품종 ‘Redfield’와 녹색 과육 사과 품종 ‘Granny Smith’의 EST 분석 결과를 바탕으로(Kim et al. 2015) anthocyanin 발현에 관여하는 유전자들을 비교 분석하였다. HRM 기술을 사용하여 적색 과육 사과 품종과 백색 과육 사과 품종의 PCR 증폭산물에서 한 개의 서로 다른 염기서열을 구분하여 분리할 수 있는 SNP 위치를 확인하였다. 적색 과육 발현에 관련한 특이적 SNP 분자표지를 탐색하여 사과 유전자원 중 적색 과육 품종과 백색 과육 품종을 구분할 수 있는 분자표지를 개발하였고, 이러한 분자표지의 개발은 적색 과육 사과 품종의 육종 기한을 단축시키고 교배 육종의 효율성을 높이는데 이용할 수 있을 것이다.

재료 및 방법

식물재료 및 RNA 추출

본 연구에 사용한 재료는 농촌진흥청 국립원예특작과학원에 재식되어 있는 적색 과피, 적색 과육 사과 품종, ‘Redfield’와 녹색 과피, 백색 과육 사과 품종인 ‘Granny Smith’ 과실을 시기별로 채취하여 액체질소를 사용하여 분쇄하였다. 만개 후 7주에 과실을 수확하였고, RNA 분리 방법은 Pine Tees Methods (Shujun et al. 1993)에 따라서 다음과 같이 수행하였다. 분쇄한 3 g의 시료에 15 mL의 추출용액(2% CTAB, 2% PVP, 100 mM Tris-HCl pH 8.0, 25 mM EDTA, 2.0 M NaCl, 0.05% spermidine, 2% β-mercaptoethanol 사용 직전에 첨가)을 첨가하였다. 동량의chloroform:isoamyl alcohol (24:1)을 첨가하여 15000 rpm에서 25분 동안 원심분리 하였다. 상등액에 ¼ volume 의 10 M LiCl 를 첨가한 후 4°C에서 7시간 이상 보관 후, 15000 rpm에서 30분 동안 원심분리하여 침전물을 500 µL의 SSTE에 녹이고 동량의chloroform:isoamyl alcohol (24:1)을 첨가하였다. 15000 rpm에서 30분 동안 원심분리하여 상등액을 분리한 후 2배의 에탄올 첨가 후에 -70°C에서 40분 동안 저장 후 DEPC 처리한 멸균수에 녹였다. Total RNA로부터 mRNA를 분리하기 위해 polyA Tract mRNA isolation kit (Promega. USA)를 사용하였다. 다당류를 제거하기 위해 oligo (dT) 컬럼을 사용하는 대신에 biotinylated oligo (dT)와 paramagnetic particles을 사용하였다. One mg의Total RNA의 최종 부피를 500 µL로 맞춘 후 65°C에서 10분간 저장 후 3 µL의 biotinylated oligo (dT) probe와 13 µL의 20ⅹSSC를 첨가 후 상온에 저장하였다. SA- PMPs (streptavidin paramagnetic particles)이 튜브 안에서 완전하게 섞이도록 한 후에 magnetic stand에 세워서 입자를 분리하고, total RNA와 혼합하여 10분 동안 저장 후에 magnetic stand에서 0.3 ml의 0.1ⅹSSC로 4번 세척한 뒤에 0.1 mL의DEPC 처리한 멸균수를 첨가하였다.

‘Redfield’와 ‘Granny Smith’의 SNP 및 In/Del 분석

‘Redfield’와 ‘Granny Smith’ 전사체 분석 결과에서 찾은 SNP를 매트릭스로 만들어 변이 과정을 거친 후 동형(homozygous) SNP와 이형(heterozygous) SNP로 나누었고, SNP 선발 조건은 3 이상으로 하였다. ‘Redfield’와 ‘Granny Smith’의 SNP 비교분석은 동일한 SNP 위치에서 두 시료 간에 서로 동형 SNP인 경우만을 선발하였고, 두 시료 간에 탐색되는 다형성을 나타내는 SNP 554개가 선발되었다. GO분석은 TAIR10_ID을 이용하여 DAVID (http://david.abcc.ncifcrf.gov/tools.jsp)에서 제공하는 Gene Ontology Annotation Tool을 사용하였다. 참조한 제놈의 유전자는 선택적인 splicing form을 포함하고 있기 때문에 한 개의 SNP 위치는 한 개 이상의 전사체에 포함될 수 있으며 두 시료 간에 탐색되는 다형성을 나타내는 SNP 554개를 포함하는 전사체수는 323개 이고, TAIR10_ID 기준으로는 288개 이다. 이후 GO 분석 및 SNP 프라이머 디자인은 다형성을 나타내는 SNP 554개만을 사용하여 분석을 진행하여 103개의 프라이머를 제작하였다.

HRM 분석

HRM 분석(Wittwer et al. 2003)에 필요한 프라이머 제작을 위해 참조한 제놈과 주석 정보는 JGI Phytozome에서 사과(Malus domestica) 제놈 데이터를 받았고 7500 Fast Real-time PCR machine (Applied BioSystems)을 사용하여 수행하였다. HRM 분석을 위한 gDNA 추출은 적색 과피, 적색 과육 사과 10 품종 Redfield, Jay Darling, Pink Wood, Makamilk, May Pole, Okanagan, Red Flesh, M. pumila Royalty, Crimson Glory, Purple Wave, 백색 과육 사과 11 품종, Granny Smith, Court Pendu, Priam, End Blue Green, Mutsu, Northwest Greening, Lodi, Kinsei, Tumange, Bulmer Normern, Amere에서 잎을 채취하여 DNeasy Plant kit (Qiagen)을 사용하여 gDNA를 분리하였다(Prince et al. 1997). 추출한 DNA는 NanoDropⓇ ND-1000 (Nanodrop Technologies, USA)를 이용하여 정량하고 최종 농도가 20 ng이 되도록 희석하였다. PCR 반응액은 gDNA 20 ng에 각 SNP 분자표지에 해당하는 한 쌍의 프라이머(Table 2)를 넣고 PCR 반응은 95°C에서 초기 변성을 수행한 뒤, 95°C에서 15초간 변성과 60°C에서 60초간 복원하는 과정을 40회 반복하였다. 마지막으로 95°C에서 10초간 변성 반응을 시킨 후, 60°C에서 95°C까지 0.2°C씩 올리면서 각 온도에서 5초간 유지하는 동안 형광을 측정하여 HRM melting 그래프를 그렸다.

Summary of the development of SNP markers in ‘Redfield’ and ‘Granny Smith’

Sample Total SNP Homozygous SNP Heterozygous SNP Polymorphism SNP HRM primer 
Redfield2,2361,1641,072554103
Granny Smith1,373717656

PCR amplicons showing polymorphic HRM profiles in ‘Redfield’ and ‘Granny Smith’

  SNP ID Variations   TAIR10 hit  Forward primer  Reverse primerProduct
MDC002231.658T/CFAR1-related sequence 4AACAGTTTGTGAACCACGGCGCACCGCTTCTTCTAATGCG129
MDC003558.335A/CATP synthase delta-subunit geneCTGCACCTGCTTCGCTATCTCCAAGCGCATCGACCTGATA143
MDC003940.103A/CPhosphoglycerate kinase family proteinTGGGCAGCAAAAGAGACACTGCACAAGGTCTCTCAGTCGG109
MDC004004.245A/GNADH-ubiquinone oxidoreductaseCAAAGCAATGGCAGCTGAGGCAGAGGGATCAGCAAGTGGG118
MDC004582.94C/Tprotochlorophyllide oxidoreductase ATGTTCAAATCTTCCAGCAGCAGCTCGTGTGTAATGCTGCTG137
MDC005276.240G/ANAD(P)-binding superfamily proteinGCCTCCATCACCTGCTTCTTTCAATGCTATTGCCCGTGGT88
MDC006621.191A/CintergenicACAGTAGAGTTTGATTTGCCCCT TGTTTTCACTCCAAACACCAACT 133
MDC006639.149C/Tcell elongation protein / DWARF1GAAGCCCCAATGTTCCCTGATTCTTGCAGATGGCCGAGTT96
MDC006684.239G/AO-Glycosyl hydrolases 17 proteinTCTGACTTGCGGCTCAAAGTGCATGTTTGGGGATGTTCGG101
MDC006833.367C/GCalcium-dependent lipid-binding proteinACAGCCAACATCAGCTCTCCTCCTCCTGACAGTCCTCTGG87
MDC008445.171C/Tchaperonin 20CGCTGATGCCCACTTTTGTCAAACCGGCGGTGGAATTTTG114
MDC009250.268T/Calpha/beta-Hydrolases superfamilyTTCCAGTGTCGAGGGATCCTAGTTCCGCGTCAAGTGAGAG126
MDC009297.162A/Gactin 7GTCTCGTCCAGCAAGGTCAAGTGCTTGACTCTGGTGATGGA99
MDC009752.161A/Gpumilio 1AAGCTGCCTGGCATGATTCTCGCGTTTTCCAGCATGAACT142
MDC010692.100G/AMov34/MPN/PAD-1 family proteinTGCCAATGTAGGAAGGCAGGCAGTGTCGAGCATTGTTCCC104
MDC011349.124G/Arespiratory burst oxidase homologue DATGCAACCGCCATCAAAACCACAGCGATGACTACGAGCTG126
MDC011437.437A/GUDP-Glycosyltransferase family proteinTGTCCTTCCCTGGTCAGAGATACACATGGGTCAGCTGCAG95
MDC012729.141C/TCOP1-interacting protein 8TGAAGGCGAAGAGAACCAGGGCCCAATCCAGAATCCGGTT141
MDC013033.69G/ANAC domain containing protein 2TCCCAGGGGTCGAACTTGTAGACGGACGAAGAGCTAGTCG108
MDC013255.329A/Gribosomal protein L5 BTGAGACCAACTTCAAGCCCAGCCCAAATTGTATCTGCCAGC94
MDC013370.143T/CMDP0000678862:cdsTAGGTTCCCGTTCAGGCATGTCTTGGTCGTGGTCATGGTG84
MDC013467.418G/Aenvelope membrane of chloroplasts 159TAGTTGTTCGGAGCTGCTGGTTTCCCTCGGGCGAAACTAC98
MDC017371.127T/CStabilizer of iron transporter SufDGGCCACCCATCAAGTTCCTTTGCACTCTCTTGCTGGACAG136
MDC017906.52G/TNAC domain containing protein 83ACTGGGTTCTTTGCCGCATAAACAGGCCTCGAGTTCTTGG110
MDC018518.81T/CSAUR-like auxin-responsive proteinAGTACAGGCCGAAGAGGAGTTCCTCGATGCTCAAGAACCG141
MDC018809.596T/Gmonodehydroascorbate reductase 1TAGCCTTGTTCTCCTCCGGACTGTGCTCTTCGGAGACAGT123
MDC019312.167T/Gcoatomer gamma-2 subunitAAGGAGGTTAAGTCGCAGCCGCATCAACTGTGGATGCAGG101
MDC019909.124T/CDC1 domain-containing proteinAGTCGCTCTTCGGTGAAAGGGAAAAGTGCCCTTGAGTCGC148
MDC039955.18T/CNADH-dependent glutamate synthase 1TTCCACCGGAAGATGTCAGCCCTTTGAAGCCACTCCCCAT146
MDC000414.122T/Cisoamylase 3CAGGCAGCTTCGGAATGCTATCTCCCAATGACATCGTGCC118
MDC000453.153A/Galanine-2-oxoglutarate aminotransferase 2 ACAAACAACATTTCTGCAGCTGTTGCAGCAAAGGGATCCTTGA84
MDC000453.153G/Aalanine-2-oxoglutarate aminotransferase 2ACCATGGAAAAGCAGAACAGCATGGTCAACCCTCCCAAACC143
MDC000697.296G/ARibosomal protein L6 familyTCGACAGAAATGCCATGTCAACGCAAAAACAAACACCCTTCA113
MDC000727.1264T/Gubiquitin-specific protease 6TCCTCCGGAGAGTTTGGTGATGGTTCAAGGGAAATGGATCCA83
MDC000757.377T/GintergenicCTCGTGCAGATTAAGGGAGTCAGCATGGTGCAGTTTAAACTTCA150
MDC001307.439T/CRING/U-box superfamily proteinAACACCGCACAGTAGTCGTTACAGGAGACTACTGCTTGATGAC133
MDC001616.305C/GintergenicACAGGAGGGAGGATGTCGAACTGAGATCCTTGACGGTGGC131
MDC002470.355G/Acarotenoid cleavage dioxygenase 1TCCTGGCGAATGAGGAAAGCGCTAGAAGCTTCCCATGGTGA120
MDC002602.408C/Gvacuolar ATP synthase subunit AACTTCAGAGATATGGGCTACAAATTACCAGCCGCCCAGAAA95
MDC002841.101G/TRibosomal protein S11 family proteinTCAGCATGTGACTGATCTGTCACCCAACATGAGCCAATGGTG128
MDC003115.218A/TADP-ribosylation factor A1BCCAGACGGTGAAGCTGATGTTCACTTCTCTGATGTCTTGTGGA140
MDC004070.283T/CUncharacterised protein familyAGCAGCTTCCATGGAAACCAAGAGGTAGTCGGGTTTGGGG110
MDC004461.290A/GintergenicTGTCCATACAGTTTCGACGCGGTTGTCCTACGCTTTCCGA112
MDC005247.512T/CRibosomal protein S4 family proteinACAGGCTCGTGGTTTGAAGAGGAACGACAACCATTGCACG144
MDC005247.512G/ARibosomal protein S4 family proteinCAAGCCTTCGTCTGGACCTCCGGTCCTCACTTTCCCATCA149
MDC005445.136C/Tpyrophosphorylase 4GCATGAGTGGGTGAAGGTCACGGCGCTTCTTTGAGGACTA139
MDC005694.146A/GRubredoxin-like superfamily proteinTGCAGAGGATGAGCATGATGCCATCCGGTCCAATTCAGGG148
MDC005697.432G/Ctubulin alpha-2 chainGGAAATGAGCTGCTCAGGGTCACCTTCTTCTCCGAGACCG133
MDC005923.474G/A20S proteasome beta subunit E1GCCCGAACCAACAGAAAACCATCCTCGTTTGAGTGCAGGG90
MDC006455.356A/Ghomology to ABI1TGGGTCTACAGCTGTCGTTGTCAGTACGCCATAAACACATGC147
MDC007040.105C/Tcitrate synthase 2TTGTGAGTGCGATGAGTGCTGCATCGAACAATGGACCCCT138
MDC007099.161T/AUDP-D-galactose 4-epimerase 1GAGCCCCGACAGGATTGAAGAGGGATGCATCCTTTGTCTTCT138
MDC007394.373C/TO-Glycosyl hydrolases family 17 proteinATTTTGCCACGCACCACTTCCGTTGTGTGATTTAGGATGGTGC118
MDC008133.431G/AProtein of unknown function (DUF581)GGTAACACACCGTTTTGCAGTACGGTTTTGTTAGCGGTGGA137
MDC008385.321C/Tglyoxylate reductase 1ACCGGAATGACGCACAAGAAGCATTCTTGAGCAGATTTGTGC147
MDC009092.100A/Gstromal cell-derived factor 2-like proteinGATCTCGACACTGGCTACGCGTACGTGACCTGCCCAGATC144
MDC009177.321A/Gtripeptidyl peptidase iiACTTCGAAGGTAGTCAAGGCCTCTCAAGGAAGATGCAGGAA142
MDC009229.176T/CIQ-domain 21CAACAGCAATGGCATGGCTTTGAGCATTTTCCAGCGGAGA113
MDC009297.162A/Gactin 7CCTGTAGTACGCCCACTAGCTGAATCCTAAGGCCAACAGGG121
MDC009552.126A/GPyruvate kinase family proteinAACTGGCATTGTGGGTCGATATTCTGGTGGGTGCATTTGG132
MDC010328.215T/CClass II aaRS and biotin synthetasesTGCGAAGGAAAAACGAGATGCTCATCACACCAAGGAGCCAA105
MDC010706.416T/ALate Embryogenesis Abundant 4-5TTGGTCGCATTCCCACCTACTCACCAGATGTCCGCACTTC150
MDC010707.221T/AEamA-like transporter family proteinAGATGATGCAAATCGCCTTTGGGAGCATCTTTGGTTCCATTGC92
MDC011159.221A/GRING/U-box superfamily proteinGAACGAGAATGCGACAACGGTGCTTGTTCCCCCGATTTCA148
MDC011198.306T/GLeucine-rich repeat protein kinaseTTGGGACGGATGTTTACCCGCCGAGATTCGCAAGTCCAGT101
MDC011283.417T/CintergenicCCATGACGAAACCGAATCGCTGGGATTTGATGATTTGGGTGT122
MDC011443.229T/Cregulatory particle AAA-ATPase 2AGTGGGAGCTCAACTGCTTCTGGTGCTTTCTGTTGTTGGGC149
MDC011610.336C/Theteroglycan glucosidase 1CATCCAGCAGAGCGGTACTCTTCATGTGGTGATTGCAGGG97
MDC011703.39T/AMDP0000775972:cdsGAACCGGTTTCGACTCCACAGGTGTCCGAGGAGGTTGAAG122
MDC011914.230A/GLeucine-rich repeat (LRR) family proteinATTGATACGCAGGCGGCTTATCGTTTCCAGTTCTCTGAAAA116
MDC012026.355T/Gchlorsulfuron/imidazolinone resistant 1ACCCAGCAAATGAGTCGGAGTACGGACCAGGAGTGTCCAA136
MDC012278.208G/AintergenicAGGATTCATCTGTTCTGGCACACACAGATCAAGACGAGGCCA121
MDC013249.318A/TProtein kinase superfamily proteinACGTGATCAGCTTGCGAAGACTTGGCGGAACATGGTGTTG123
MDC013437.191G/AintergenicTCTTCCGAACCTCCTTTGGCTGCTGGACATGGGGTTTGAA108
MDC013823.203T/CProtein of unknown function (DUF506)TGTTCTTTTGCAGAGGCCGAGCCGCCAAGAAATGCATGAA99
MDC013824.133C/GATPase E1-E2 type family proteinGGACCTACCTTGAGACATAACTATGCTTCATTCTCCGGCCAA139
MDC013836.179T/CInorganic H pyrophosphataseAACGTGCACGAGTGGTTTTGCTGGAGGCGCATGGGATAAT118
MDC013836.179A/GInorganic H pyrophosphataseGCATACCAGTTCTTGACAGCCCAGTGAGATCGAACCCGCTT150
MDC013848.311C/TProtein of unknown function (DUF581)CTTTGCCGTGGCCAAGATTCTTTTCTCCCGGCAGGAAGTC97
MDC015282.549C/Tcystatin BACCCTCCTGACCTTTTCCTTTTTCGCCTTCACAACCCTCA122
MDC015470.252G/ARELA/SPOT homolog 3TCTGTGCAAGAGTATCCTGCAGAACCCGTACGGAGTCCATC90
MDC016054.80A/CUDP-GlycosyltransferaseTCCTTGATGTATGGAGCAGGACACGGGGATGTTCCTGTCAA136
MDC016112.100T/CStabilizer of iron transporter SufDATGACAGGTTGTGGCCTCACCCAGTTACAGTGCCCCTCTG138
MDC016219.172C/AAdenine nucleotide alpha hydrolasesAGAGTCGCAGCACTCTTTGGAGGATGAAATTTTGAAGAAGCAA87
MDC016248.191A/Tmethyltransferases superfamily proteinCCTGCTCTTAATGCATTCGACGCCTGTGCTGGAAGAAGGTGA85
MDC018099.109A/Gnucleoside triphosphate hydrolasesAGTCTCAACCGAAAGCTCAGACCGACTCAATTTTCAGGTGCA137
MDC018099.109A/Gnucleoside triphosphate hydrolasesACCCCTGCAAAGGTTACTGGAAGCATGAGCACACACCTCA121
MDC018296.41C/TMDP0000261713:cdsGTATCACCGGCATCCAGCTTGCATGAAAAGGAAATGCCAGC144
MDC018954.138T/Gzinc finger superfamily proteinTGCATGTTCATGCCTCAGGTCTGCAAGTGGACTGTGCATG89
MDC019089.170G/ATransducin family proteinTGGGACATGGACAACACTCACGAGGGCTTGCCTAGGAATT149
MDC019312.167T/Gcoatomer gamma-2 subunitCACTCTGCCTGTCAGGTCATAACTGCAGGGATGCCTTCTG150
MDC019581.293A/GProtein kinase superfamily proteinCGTCAAGCTTCTTCACTGCCCTGTGGAGGAGCTGAAAGAGA129
MDC021673.67T/GintergenicGAGGAGATCCAGCCTTCTGCACCTGAAATGAAATGGCTGGT96
MDC021750.166A/GGTP binding Elongation factorGGCTCACCTTGTTGCAGCAGCGGAGGTTTTGAAGCCGGTA110
MDC022126.96A/CGTP-binding proteinTAGCCTGTTGATGCTGGTGCCAGCTTCCCGGGCTTCTATC137
MDC022171.193A/TProtein kinase superfamily proteinTTTGCAAAACTATTCCGCAGAGACTTTGCTGTCCACGAGG143
MDC022588.206A/GNADP-malic enzyme 4ACTCTAGTTCTTGAACCCGGTTTCCAGGTTTGGCTACTCGC144
MDC022716.123C/Ttranslation initiation factor 3B1CGATCCTGCTCGCTCAAGAAAAGGCCACCATCATTGCTGA123
MDC022728.65T/CProtein of unknown function (DUF3506)AATCCACGGTTAGACTGGCGTGCTGGCCAGGTTTATAGCT145
MDC023119.21C/GENTH/VHS family proteinGGTGGAGAACAGACAGGCAATTGGGTTCTCAGTTGCAGCA145
MDC037826.18A/GUDP-glucosyl transferase 88A1TGAAATCCTTGCTCCCGGACCACAAACCCACCCACTGAGT116
MDC039955.18C/TNADH-dependent glutamate synthase 1AAAATTTGCAGGAGAACACTGAACCCGACCAGTAAACTCGG140

결과 및 고찰

사과 RNA-Seq data를 이용한 SNP 분석

본 연구의 목적인 적색 과육 사과 품종과 백색 과육 사과 품종을 구분할 수 있는 분자표지를 개발하기 위해서 사과 NGS 데이터를 참조 제놈에 매핑하여 genome wide SNP를 찾고, 적색 과육 품종인 ‘Redfield’와 백색 과육 품종인 ‘Granny Smith’에서 탐색되는 다형성을 나타내는 SNP를 선발하였다. 참조 제놈과 주석 정보는 JGI Phytozome에서 사과(Malus domestica) 제놈을 사용하였고, 사용한 염기서열은 881,278,625 bp이고 전사체 수는 63,517개, 전사체의 총 염기서열은 71,132,322 bp이다. ‘Redfield’의 총 read 수는 353,980이며 총 염기서열 길이는 213,441,953이고, read의 평균 염기서열 길이는 602.98 bp로 전사체 대비 범위가 3×이고, raw reads 대비 확보된 수치가 44.89%로 총 95,811,160 bp를 분석에 사용하였다. ‘Granny Smith’의 총 read 수는 214,679이며 총 염기서열 길이는 129,247,804이고, read의 평균 염기서열 길이는 602.05 bp로 전사체 대비 범위가 1.82×이고, raw reads 대비 44.54%를 확보하여 57,564,661 bp를 분석에 사용하였다. 참조 제놈 대비, 배열 결과 ‘Redfield’는 정리된 read 중에서 73.52%의 read가 매핑되었고, ‘Granny Smith’는 71.71%의 read가 매핑되었다. ‘Redfield’와 ‘Granny Smith’에서 찾은 SNP를 매트릭스로 만들어 변이 과정을 거친 후, 동형 SNP와 이형 SNP로 나누어 정리하였고(Table 1) SNP 선발 조건은 3 이상으로 하였다. ‘Redfield’와 ‘Granny Smith’의 SNP 비교분석은 동일한 SNP 위치에서 두 품종간에 서로 동형 SNP인 경우만을 선발하였고, 그 결과 다형성을 나타내는 SNP 554개가 선발되었다. ‘Redfield’와 ‘Granny Smith’ 간에 탐색되는 SNP 554개의 주석(JGI Phytozome)을 찾은 결과 전사체 수는 323개이고, TAIR10_ID 기준으로는 288개이다. SNP 수와 전사체 수가 다른 이유는 참조 제놈의 유전자는 한 개의 SNP 위치가 한 개 이상의 전사체에 포함될 수 있기 때문이다.

Anthocyanin 생합성 관련 유전자 탐색 및 HRM 분석

‘Redfield’와 ‘Granny Smith’ 간에 탐색되는 polymorphism SNP 554개 중에서 103개의 프라이머 조합을 이용하여 HRM 분석을 하였다(Table 2). 103개의 SNP 분자표지의 유전자 정보를 분석하여 탐색한 색소 생성과 관련된 유전자는 carotenoid cleavage dioxygenase1으로 C40 carotenoids의 이중결합을 분해하여 다양한 apocarotenoids을 생성하는 기능을 가지고 있다(Floss and Walter 2009). 이 유전자로부터 유래한 SNP 분자표지는 사과 적색 과육 품종 10개와 백색 과육 11품종이 구분되지 않았다. 과육 색에 따른 21품종의 사과를 적색과 백색 2군으로 구분할 수 있는 SNP 분자표지는 2종이었다(Fig. 1). SNP ID, MDC000453.153의 유래는 alanine-2-oxoglutarate aminotransferase 2로 식물의 잎에서 peroxisomes에 위치하며 광호흡에서 glycollate pathway에 관여하는 것으로 알려져 있다(Noguchi and Hayashi 1981). 이 유전자의 기능은 색소 생성과는 직접적으로 관계가 없지만 ‘Redfield’에서는 G 염기서열이 ‘Granny Smith’에서 A로 바뀌어서 적색 과육 사과 10품종과 백색 과육 사과 11품종을 구분할 수 있었다(Fig. 1A). SNP ID, MDC005247.512의 유래는 ribosomal protein S4 (RPS4A) family protein으로 ribosomal RNA에 binding 하는 기능을 갖고 있는 것으로 알려져 있으며(Lin et al. 1999), ‘Redfield’에서는 G 염기서열이 ‘Granny Smith’에서 A로 바뀌어서 21품종의 사과를 적색과 백색 2군으로 구분할 수 있었다(Fig. 1B).

Fig. 1.

HRM analysis of 10 red flesh apple cultivars (Redfield, Jay Darling, Pink Wood, Makamilk, May Pole, Okanagan, Red Flesh, M. pulila Royalty, Crimson Glory, Purple Wave) and 11 white flesh apple cultivars (Court Pendu, Priam, End Blue Green, Mutsu, Northwest Greening, Lodi, Kinsei, Tumange, Bulmer Normern, Amere, Granny Smith). (A) Normalized graph of SNP ID, MDC000453.153 (B) Normalized graph of SNP ID, MDC005247.512. Green line colors indicate white flesh apple cultivars and blue line colors indicate red flesh apple cultivars


MdMYB10 유전자에서 유래한 기존의 SNP 분자표지 개발 방법은 MdMYB10 유전자의 인트론 부분의 4개의 염기서열에서 indel을 발견하여 SNP 분자표지로 개발하였으며(Chagne et al. 2007) 본 연구에서는 기존에 알려진 anthocyanin pathway에 관여하는 유전자뿐만 아니라 다른 기작에 의해서도 사과 적육계와 백육계를 구분할 수 있는 SNP 분자표지를 개발하고자 RNA-Seq data를 사용하였다. 본 연구에서 개발한 2개의 SNP 분자표지가 적육계 사과 품종과 백육계 사과 품종을 구분할 수 있는 정확한 기작에 대해서는 앞으로 연구를 계속 진행해야 할 것이다. 또한 더 많은 유전자원과 교배집단에 적용하여 분자표지로서의 가능성이 있는지 확인할 필요가 있다. HRM 분석 방법에 의한 SNP 분자표지 개발은 재현성 실험 결과가 확보되어야 하고, 구분하고자 하는 개체수가 많을수록 정확성이 높다고 볼 수 있다. 고부가 기능성 사과 품종을 육성하는데 있어 전통육종방법은 적색과육과 같은 특정형질만 발현시키는 데 오랜 시간과 노력이 필요하다. 과수분야에서 특정 유전자를 발현시키는 분자육종은 국내에서도 사과, 포도, 키위 등에서 연구가 되고 있다(Kim and Song 2010). 또한 비교적 일차 대사율이 낮은 종자나 과실 등의 조직에서는 특이적으로 flavonoid 생합성을 유도하는 것이 프로모터의 개발을 통해 가능한 결과지만(Allan et al. 2008) 현실적으로 과수 형질전환체의 개발과 보급은 단시간 내에 이루어질 수 있는 연구가 아니기 때문에 전통육종방법을 활용하여 식미가 좋은 적육계 계통의 사과를 육성하는 것이 시급하다. 사과는 재식 후 2~3년이 경과되어야 과실의 특성을 볼 수 있기 때문에 적육계 계통 선발을 위한 교배 집단에서 분자표지의 개발은 육종 연한을 단축시킬 수 있는 중요한 수단이다. 본 연구에서는 고부가 기능성 품종으로 사과 적육계 계통을 육성하기 위해 전사체 분석방법으로 적육계와 백육계에서 차등으로 발현되는 유전자들을 분석하였고, HRM 방법을 이용한 SNP 분자표지를 개발하여 사과 유전자원 21품종에 적용하므로써 과육색을 구분할 수 있는 분자표지의 가능성을 검토하였다. 앞으로 anthocyanin의 내재 생합성 조절 기작에 대한 연구를 통해 기존에 보고되지 않은 새로운 유색관련 분자표지를 개발하고 이를 다양한 유전자원과 교배집단에 적용하여 육종연한을 단축할 수 있는 방향을 제시하고자 한다.

적요

과육색이 다르게 발현되는 사과(Malus domestica L.) 품종의 유전자 발현을 비교하기 위해 2개의 cDNA library를 제작하였다. 붉은 색 과육 품종인 ‘Redfield’와 백색 과육 품종인 ‘Granny Smith’의 유전자 발현 차이를 보기 위해 차세대 염기서열 분석(NGS) 기술을 사용하였고 두 품종으로부터 얻은 EST의 염기서열을 결정하고 기존에 보고된 유전자와의 상동성을 분석하였다. HRM 기술은 붉은 색 과육 품종 사과와 백색 과육 품종 사과의 짧은 PCR 증폭산물에서 한 개의 서로 다른 염기서열을 구분하여 분리해낼 수 있다. ‘Redfield’와 ‘Granny Smith’의 EST database로부터 103쌍의 단일염기다형성(SNP) 분자표지를 선발하였고, 붉은 색 과육 품종 10개와 백색 과육 품종 11개를 구분할 수 있는 SNP 분자표지를 HRM 방법으로 분석하였다. 본 연구에서는 사과 EST database를 기반으로 HRM 분석 방법을 이용하여 사과 품종의 적육계와 백육계를 구분할 수 있는 효율적인 SNP 분자표지를 개발하였다. 이러한 SNP 분자표지는 사과육종에 유용하게 사용할 수 있으며 사과 품종의 다양한 색 변화에 관한 분자 기작 연구에 좋은 참고자료가 될 수 있을 것이다.

사사

본 연구는 농촌진흥청 연구과제(세부과제번호:PJ010272 022017)의 지원에 의해 이루어진 것임.

References
  1. Allan AC, Hellens RP, and Laing WA. (2008) MYB transcription factors that colour our fruit. Trends Plant Sci 13, 99-102.
    CrossRef
  2. Ban Y, Honda C, Hatsuyama Y, Igarashi M, Bessho H, and Moriguchi T. (2007) Isolation and functional analysis of a MYB transcription factor gene that is a key regulator for the development of red coloration in apple skin. Plant Cell Physiol 48, 958-970.
    Pubmed CrossRef
  3. Chagne D, Carlisle CM, Blond C, Volz RK, Whitworth CJ, Oraguzie NC, Crowhurst RN, Allan AC, Espley RV, Hellens RP, and Gardiner SE. (2007) Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple. BMC Genomics 8, 212.
  4. Cheng F, Weeden N, and Brown S. (1996) Identification of co-dominant RAPD markers tightly linked to fruit skin color in apple. Theor Appl Genet 93, 222-227.
    Pubmed CrossRef
  5. Espley RV, Hellens RP, Putterill J, Stevenson DE, Kutty-Amma S, and Allan AC. (2007) Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. The Plant Journal 49, 414-427.
    Pubmed KoreaMed CrossRef
  6. Floss DS, and Walter MH. (2009) Role of carotinoid cleavage dioxygenase1 (CCD1) in apocarotenoid biogenesis revisited. Plant Signal Behav 4, 172-175.
    Pubmed KoreaMed CrossRef
  7. Forkmann G, and Martens S. (2001) Metabolic engineering and applications of flavonoids. Curr Opin in Biotech 12, 155-160.
    CrossRef
  8. Kim JH, and Song KJ. (2010) Current status and outlook on genetic transformation of fruit trees in Korea. Journal of Plant Biotech 37, 408-413.
    CrossRef
  9. Kim JI, Kwon SI, Kim MJ, Jun JH, Heo S, Kim SH, and Cho KH. (2011) High-resolution melting analysis for fruit color identification using SNP markers in apple. Kor J Hort Sci Tech 29, 49.
  10. Kim SH, Cho KH, Park SJ, Kim DH, and Choi IM. (2015) Transcriptome analysis between red flesh apple cultivar and white flesh apple cultivar using next generation sequencing. Fruit Sci and Tech In Korea 1, 111-116.
  11. Lin X, Kaul S, Rounsley S, Shea TP, Benito MI, Town CD, Fujii CY, Mason T, Bowman CL, Barnstead M, Feldblyum TV, Buell CR, Ketchum KA, Lee J, Ronning CM, Koo HL, Moffat KS, Cronin LA, Shen M, Pai G, Van Aken S, Umayam L, Tallon LJ, Gill JE, Adams MD, Carrera AJ, Creasy TH, Goodman HM, Smerville CR, Copenhaver GP, Preuss D, Nierman WC, White O, Eisen JA, Salzberg SL, Fraser CM, and Venter JC. (1999) Sequence and analysis of chromosome 2 of the plantAradidopsis thaliana. Nature 402, 761-768.
    Pubmed CrossRef
  12. Markussen T, Kruger J, Schmidt H, and Dunemann F. (1995) Identification of PCR-based markers linked to the powdery-mildew-resistance genePl 1fromMalus robustain cultivated apple. Plant Breeding 114, 530-534.
    CrossRef
  13. Noguchi T, and Hayashi S. (1981) Plant leaf alanine:2-oxoglutarate aminotransferase. Peroxisomal localization and identity with glutamate:glyoxylate aminotransferase. Biochem J 195, 235-239.
    Pubmed KoreaMed CrossRef
  14. Prince JP, Zhang Y, Radwanski ER, and Kyle MM. (1997) A versatile and high-yielding protocol for the preparation of genomic DNA fromCapsicum spp. (pepper). Hortscience 32, 937-939.
  15. Sassa H, Mase N, Hirano H, and Ikehashi H. (1994) Identification of self-incompatibility-related glycoproteins in styles of apple (Malus×domestica). Theor Appl Genet 89, 201-205.
  16. Shujun C, Jeff P, and John C. (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11, 113-116.
    CrossRef
  17. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, and Pryor RJ. (2003) High-resolution genotyping by amplicon melting analysis using LCGreen. Clinic Chem 49, 853-860.
    CrossRef
  18. Yang H, and Kruger J. (1994) Identification of a RAPD marker linked to theVfgene for scab resistance in apple. Euphytica 77, 83-87.
    CrossRef
  19. Yanmin Z, Kate E, and Cameron P. (2011) Utility testing of an apple skin colorMdMYB1marker in two progenies. Mol Breeding 27, 525-532.
    CrossRef


December 2017, 44 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM