search for




 

Stable expression of brazzein protein, a new type of alternative sweetener in transgenic rice
J Plant Biotechnol 2018;45:63-70
Published online March 31, 2018
© 2018 The Korean Society for Plant Biotechnology.

Ye Rim Lee, Shahina Akter, In Hye Lee, Yeo Jin Jung, So Young Park, Yong-Gu Cho, Kwon Kyoo Kang, and Yu Jin Jung

Department of Horticultural Life Science, Hankyong National University, Anseong 17579, Korea,
Institute of Genetic Engineering, Hankyong National University, Ansung 17579, Korea,
Biological ResourcesDivision, National Institute of Biological Resources, 42, Hwangyeong-ro, Seo-gu, Incheon, 22689, Korea,
Department of Horticultural Science, Chungbuk National University, Cheongju 28644, Korea,
Department of Crop Science, Chungbuk National University, Cheongju 28644, Korea
Correspondence to: e-mail: yuyu1216@hknu.ac.kr
Received March 26, 2018; Revised March 26, 2018; Accepted March 26, 2018.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Brazzein is the smallest sweet protein and was isolated from the fruit pulp of Pentadiplandra brazzeana Baillon, native to tropical Africa. From ancient times, the indigenous people used this fruit in their diet to add sweetness to their daily food. Brazzein is 500 to 2000 times sweeter than sucrose on a weight basis and 9500 times sweeter on a molar basis. This unique property has led to increasing interest in this protein. However, it is expensive and difficult to produce brazzein other than in its native growing conditions which limits its availability for use as a food additive. In this study, we report high production yields of, brazzein protein in transgenic rice plants. An ORF region encoding brazzein and driven by the 2 x CaMV 35S promoter was introduced into rice genome (Oryza sativa Japonica) via Agrobacterium-mediated transformation. After transformation, 17 regenerated plant lines were obtained and these transgene-containing plants were confirmed by PCR analysis. In addition, the selected plant lines were analyzed by Taqman PCR and results showed that 9 T0 lines were found to have a single copy out of 17 transgenic plants. Moreover, high and genetically stable expression of brazzein was confirmed by western blot analysis. These results demonstrate that recombinant brazzein was efficiently expressed in transgenic rice plants, and that we have developed a new rice variety with a natural sweetener.

Keywords : Brazzein, Overexpression, Sweetener, Transgenic rice
서언

당은 다양한 음식에 필요한 대중적인 감미료지만 당의 섭취가 높아짐에 따라 고혈압, 당뇨병, 비만 및 치아 우식증과 같은 수많은 복잡성질환을 유발할 수 있다. 이러한 유형의 질병을 앓고 있는 환자는 저칼로리 인공 감미료인 아세설팜칼륨, 아스파탐, 사이클러메이트 및 사카린 등을 사용해왔다. 그러나 이들 인공 감미료는 방광암, 뇌종양, 심부전 및 정신적 질환과 같은 몇 가지 다른 복합성 질환을 야기한다고 하였다(Kant 2005). 따라서 인공 감미료나 설탕 대신에 단맛의

특성을 발휘하거나 미각을 수식할 수 있는 안전하고 건강한 대체 감미료의 연구가 필수적이다. 지금까지 알려진 미각감미단백질은 9종으로 brazzein (Ming and Hellekant 1994), mabinlin (Liu et al. 1993), thaumatin (Wel and Loeve 1972), monellin (Wel 1972; Moris and Cagan 1972), pentadin (Wel et al. 1989), eggwhite lysozyme (Masuda et al. 2001), curculin (Yamashita et al. 1990), neoculin (Shirasuka et al. 2004; Suzuki et al. 2004) miraculin (Kurihara and Beidler 1968) 등이 단백질의 구조가 밝혀져 있으며, 대부분이 열대과실에서 존재하는 단백질로 토착민들의 단맛원료로 사용되고 있다. 미각감미단백질은 설탕에 비해 매우 낮은 농도로 단맛을 유도 할 수 있으며, 모든 미각감미단백질의 기원은 lysozyme을 제외하고는 자연의 식물 열매로부터 유래되었다. 그 중 brazzein은 가장 작은 분자량의 당 단백질로서 아프리카 식물 Pentadiplandra brazzeana Baillon의 열매에서 분리되었다(Ming and Hellekant 1994). Brazzein은 분자량이 적고, 내열성 및 광범위한 pH에서 안정성을 보이며, 당과 단맛이 유사한 특징을 가지고 있고, sucrose보다 분자량 기준으로 500 ~ 2000배, 몰 기준으로 9500배 당도가 높아 감미료로써 매우 높은 평가를 받고 있다(Ming and Hellekant 1994; Assadi-Porter et al. 2000). 열대식물인 P. brazzeana Baillon에서 brazzein단백질의 대량생산은 용이하지 않아, 이를 위해서는 유전공학 기법을 통한 단백질의 고 발현 시스템 확립 등의 연구가 필수적이라고 하였다(Faus 2000; Masuda and Kitabatake 2006). 이미 Escherichia coli (Assadi-Porter et al. 2000; Assadi-Porter et al. 2008; Lee et al. 2010), 옥수수 (Lamphear et al. 2005), Lactococcus lactis (Berlec et al. 2006; Berlec and Strukelj 2009), Pichia pastoris (Rachid et al. 2009), mice (Yan et al. 2013), Kluyveromyces lactis (Jo et al. 2013) 등에서 brazzein 단백질을 발현시킨 연구가 보고되었다. 그러나 벼에서 brazzein 유전자 도입을 통한 안정적 발현 시스템에 대해 보고한 예가 없다. 벼(Oryza sativa L.)는 세계 인구의 약 50%가 주식으로 하고 있기 때문에 매우 중요한 작물로 외래유전자 도입을 통해 단백질의 안정적 생산을 위한 좋은 재료로 적합하다.

따라서 본 연구에서는 천연 감미단백질로 알려진 brazzein 단백질을 벼 세포에 발현시키고자, brazzein 관련 유전자가 삽입된 Ti-plasmid를 Agrobacterium법에 의해 형질전환 한 후, 벼 게놈에 도입 및 발현 여부를 분석하여 brazzein단백질의 안정적 발현 계통을 육성하고자 한다.

재료 및 방법

플라스미드 벡터 구축

식물 발현용 플라스미드 벡터를 구축하기 위하여 NCBI ( https://www.ncbi.nlm.nih.gov/)로 부터 brazzein 유전자 정보(EU883595)를 확보하여 제한 효소 XhoI 및 BamHI을 포함하는 염기서열의 합성을 ㈜바이오니아( https://www.bioneer.co. kr/index.php/)에 의뢰하여 진행하였다(Shahina et al. 2016). 합성된 brazzein 유전자는 총 239 bp로 제한효소 BamHI 및 XhoI을 사용하여 pPZP-3’PinII-Bar Ti-plasmid 벡터에 클로닝 하였다. 이때 유전자의 발현 조절을 위한 프로모터는 2xCaMV 35S (duel cauliflower mosaic virus 35S promoter)를 사용하였으며, 형질전환체 선발을 위하여 bar 유전자를 이용하였다(Fig. 1). 구축된 벡터는 Agrobacterium tumefaciens EHA105에 형질전환하여 초저온 냉동고(-80°C)에 저장하였고 일부는 식물형질전환에 사용하였다.

Fig. 1.

Development of transgenic rice plants with brazzein genes. (A) Ti-plasmid vector construction for overexpression of brazzein genes in rice. T-DNA region of pinII-brazzein. RB, right border; LB, left border; brazzein::FLAG, brazzein gene with FLAG-tag; Bar, bar gene; Nos-T, nopaline synthase terminator; 2xCaMV 35S, duel cauliflower mosaic virus 35S promoter. (B) Agrobacterium- mediated transformation procedures in rice plants. a-b, seed sowing and callus formation; c, callus infection; d-e, callus formation after infection; f, multi-shoot differentiation; g, regenerated plants in rooting medium; h, acclimation in soil. (C) Phenotype of the wild type and 17 regenerated plants


형질전환체 육성 및 유전자 도입 확인

형질전환 벼 육성을 위하여 농촌진흥청으로부터 분양 받은 동진 벼(Oryza sativa L. var. Japonica cv. Dongjinbyeo) 종자를 70% EtOH 및 2.5% sodium hypochlorite, 멸균된 증류수를 이용하여 소독 한 후 2 mg/L 2,4-D가 포함된 N6 고체배지에 파종하여 28°C에서 4주간 암 배양하였다. 4주간 암배양하여 형성된 callus를 선발하여 100 mM acetosyringon이 들어간 Agrobacterium 현탁액에 담가 10분간 접종한 다음 callus를 멸균된 필터페이퍼 위에 5분간 건조시킨 후 2 mg/L 2,4,-D와 10 mg/L glucose, 100 mM acetosyringon이 포함된 N6 고체배지에 치상하여 25°C에서 3일간 공동배양 하였다. 3일 후 감염된 callus를 멸균된 증류수로 3회이상 세척하여 400 mg/L carbenicillin과 6 mg/L PPT(phosphinothricin)가 들어간 N6 고체배지에 16개씩 치상하고 28°C에서 4주간 암배양한 다음 0.2 mg/L NAA, 2 mg/L Kinetin, 400 mg/L carbenicillin, 6 mg/L PPT가 포함된 MS고체배지에 2주마다 계대배양을 실시하여 재분화를 유도하였다(Jung et al. 2014; Jung et al. 2017). 재분화 식물체 잎으로부터 brazzein 유전자의 도입을 확인하기 위해 genomic DNA를 분리하여 PCR분석을 실시하였다. 이때 사용한 primer set는 table 1과 같이 bar-fw 및 nos-rv로 제작하여 95°C에서 5분간 pre-denaturation 시킨 후, 94°C에서 30초간 denaturation, 58°C에서 30초간 annealing, 72°C에서 1분간 extension 과정을 30 cycles로 수행하였으며, 마지막으로 72°C에서 5분간 extension을 실시하여 분석하였다(Fig. 2).

Primers used for PCR amplification, FST analysis and RT-PCR amplification in this study

Primer nameSequence (primer direction 5’-3’)
TG confirm PCR primers
Bar FwCGTCAACCACTACATCGAGA
Nos RvTTGCGCGCTATATTTTGTTTT
FST analysis
Barcode adaptor Fw (F1) ACACTCTTTCCCTACACGACGCTC
D35sP Rv (R1)TGGAGTAGACGAGAGTGTCGAAGCTTC 
Nos T Fw (F2)TCGTTCAAACATTTGGCAAT
Common adaptor Rv (R2)CTCGGCATTCCTGCTGAACCGCTCTT
RT-PCR primer
Brazzein RT-FwGAAAACTACCCGGTGTCCAA
Brazzein RT-RvGGTTGCGTTTTTCGTCGTAG
Actin-FwATGGTTGGGATGGGTCAAAAA
Actin-RvTCTTTAATGTCACGGACGATT

Copy number frequency of pinII-brazzein region in T0 generation by TaqMan PCR analysis

LinesTaqMan copy assaySingle copy (%)

 1 copy  2 copies  Multi copies 
1792652.9

Fig. 2.

Molecular characterization of overexpressing plants. (A) PCR analysis of bar and nos terminator region. M, molecular marker; W, wild type as negative control plant; P, positive control; 1 to 17, transgenic plant lines. (B) Quantitative RT-PCR analysis of RNA extracted from transgenic lines and control (wild type and mock). CT values were calculated based on actin expression level as a control. Bars show the standard error of the mean for three replicate measurements


형질전환체 발현 분석

형질전환 벼로부터 brazzein 유전자의 발현량과 단백질 축적 여부를 확인하기 위하여 RT-PCR과 western blot 분석을 수행하였다. Total RNA는 FavorPrepTM Plant Total RNA Mini Kit (Favorgen, Korea)를 사용하여 분리하였고, IncloneTM One-step RT-PCR kit (Inclone Biotech, Korea)를 사용하여 total RNA로부터 cDNA를 합성 하였다. PCR 반응은 94°C에서 4분간 pre- denaturation 시킨 후, 94°C에서 30초간 denaturation, 55°C에서 30초간 annealing, 72°C에서 1분간 extension 과정을 30 cycles로 하였으며, 마지막으로 72°C에서 5분간 extension을 실시하였다. PCR 산물은 1.5% agarose gel상에 영동 한 후, ethidium bromide로 염색하여 band를 확인하였다(Table 1 and Fig. 2). Western blot 분석을 위하여 brazzein 유전자가 도입되어 mRNA의 발현량이 높은 형질전환체와 wild type의 잎으로부터 extraction buffer 2.0M KPO4 (pH 7.8), 0.5M EDTA, Triton X-100, 1.0 M dithiothreitol (DTT), 80% glycerol and dH2O 200 µl를 사용하여 총 단백질을 추출 하였다. 세포 분쇄액을 4°C에서 13,000 rpm으로 20분간 원심 분리하고 상층액을 수집하여 추가 분석에 사용 하였다. 총 단백질은 Bradford (1976)에 따라 소혈청알부민을 표준으로 사용하는 Bio-Rad 단백질 염색을 사용하여 검출되었다. 각각의 T0 라인으로부터 동일한 양의 총 단백질 20 µg/lane을 12% SDS polyacrylamide gels에서 분리하고(Laemmli, 1970), semi-dry transfer (5 mA /m2, 15분)에 의해 PVDF membrane (Bio-Rad, Korea)으로 옮겼다. FLAG HRP anti- flag을 1차 항체(1 : 1000, v/v)로 사용하고, anti-rabbit IgG-alkaline phosphatase (Roche, Korea)를 2차 항체(1 : 3000, v/v)로 사용 하여 검출하였다.

형질전환체 후대 육성

Brazzein 유전자가 안정적으로 발현하는 형질전환 식물체들로부터 유전자가 single copy로 도입된 개체를 효율적으로 선발하기 위하여 TaqMan PCR 분석을 수행하였다(Jung et al. 2015). TaqMan probe PCR 반응 조건은 95°C에서 10분간 predenaturation 시킨 후, 95°C에서 20초 denuaturation, 56°C에서 1분 annealing을 40회 반복 실시하였고, annealing 반응 중에 fluorescein FAM이 활성화 될 때마다 탐지된 cycle수는 amplification plots로 표현하였다. TaqMan probe PCR 검사로 증폭된 산물은 nos terminator의 특이적인 labeling한 probe primer를 이용하여 분석되었다. 각 T0 형질전환 식물체들로부터 선발된 single copy 개체들을 이용하여 도입 유전자의 삽입위치를 확인하기 위해 Thole et al. (2009)이 보고한 adapter PCR 방법을 개량하여 FSTs (flanking sequence tags) 분석을 수행하였다(Jung et al. 2015). 일차 PCR 분석은 RB인접서열 분석을 위하여 Barcode adaptor Fw (F1) 및 D35sP Rv (R1) primers를 이용하여 95°C에서 5 분간 pre-denaturation 시킨 후, 94°C에서 30초, 67°C에서 1분, 72°C에서 1분간을 총 20 cycles로 증폭하였으며, 72°C에서 10분간 extension을 실시하였다. 이차 PCR은 일차 PCR 생성물 1 µl을 주형으로 하여 Nos T Fw (F2) 및 Common adaptor Rv (R2) primers를 이용하여 95°C에서 5 분간 pre-denaturation 시킨 후, 94°C에서 30초, 60°C에서 30초, 72°C에서 1분 30초간을 총 40 cycles로 증폭하였으며, 마지막으로 72°C에서 10 분간 extension을 실시하였다. 증폭된 PCR 반응산물은 1% agarose gel에 전기영동 하여 ethidium bromide로 10 분간 염색하여 band를 확인하였다. 증폭된 DNA 밴드는 HiYield™Gel/PCR DNA Extraction Kit (RBC Bioscience, Taipei, Taiwan)를 이용하여 정제하였으며 LB 2 또는 RB 2 primer를 이용하여 염기서열을 분석하였고, 분석된 염기서열 정보는 RAP-DB program과 NCBI의 Blast 프로그램( http://blast.ncbi.nlm. nih.gov/)을 이용하여 분석되었다.

결과

형질전환체 육성 및 도입 유전자 확인

감미단백질 brazzein 관련 유전자 (EU883595)를 벼 게놈에 도입시키고자, 먼저 식물형질전환용 Ti-plasmid에 2 x CaMV 35S 프로모터에 의해 지배되어 발현하도록 하고, 선발 마커로 bar 유전자가 삽입된 식물발현 벡터를 구축하여 A. tumefaciens EHA105에 형질전환시켜 벼 캘러스에 도입하였다(Fig. 1). 감염된 캘러스로부터 얻어진 재분화 식물체는 총 17개체였으며, 이들 잎을 이용하여 DNA를 추출한 후, 유전자 도입 여부를 확인하기 위하여 bar 유전자와 nos 터미네이터 영역의 프라이머를 작성하여 PCR 분석을 수행하였다(Fig. 2). 그 결과 wild-type (WT)에 비하여 17개의 재분화 식물체에서 PCR 밴드가 보였다. 따라서 재분화 식물체들은 brazzein유전자가 벼 게놈에 안정적으로 도입된 것을 확인하였다(Fig. 2).

형질전환체 발현 분석 및 후대육성

확인된 17개 형질전환 벼에서 brazzein 유전자의 발현여부를 확인하기 위하여 각각의 잎으로부터 total RNA를 추출하여 RT-PCR 분석을 수행한 결과 WT과 mock control (MC)에 비하여 유전자가 높게 발현 되고 있음을 확인하였다(Fig. 2). 유전자가 안정적으로 발현하는 형질전환 17개체로부터 후대 육성을 위하여 single copy로 도입된 형질전환체를 선발하고자 TaqMan PCR 분석을 수행한 결과 17 개의 형질전환 T0 세대의 개체들 중 9개체에서 도입유전자가 single copy로 삽입되어 있었다(Fig. 3). Single copy로 선발된 9개의 형질전환체로부터 intergenic 개체를 선발하여 후대 육성을 하기 위해 FST분석을 수행하였다(Fig. 4). 형질전환체의 RB와 LB 인접서열을 이용하여 FST 분석을 수행한 결과 T-DNA가 intergenic으로 확인된 식물체를 5개체(TG4, TG8, TG10, TG11, TG12) 선발하였다. 이들 식물체는 염색체 Os02g0672250과 Os02g0672300, Os04g0548500과 Os04g0548700, Os03g0672400과 Os03g0672500 및 Os07g0481000과 Os07g0481200사이의 영역에 안정적으로 삽입된 것을 확인하였다(Fig. 4). 따라서 brazzein 유전자가 벼 게놈에 single copy 도입되고, intergenic으로 삽입된 개체를 선발하여 western blot 분석을 실시하였다(Fig. 5). 형질전환하여 얻어진 17개체중 TG4, TG8, TG10, TG11, TG12 등 5개체 모두 도입한 brazzein 유전자가 전사 및 번역과정을 걸쳐 단백질 생산을 하고 있는 것으로 나타났다. 그 중 TG11 개체에서 단백질의 발현이 가장 높았다(Fig. 5). Western blot분석으로 검출된 단백질은 기 보고(Ming and Hellekant 1994)된 천연 brazzein의 분자량인 6.5 kDa과 일치하였다. 따라서 본연구에서 개발한 형질전환 벼에서 brazzein 단백질이 안정적으로 발현하여, 후대 호모 종자를 육성하였다.

Fig. 3.

TaqMan PCR analysis for copy number assays using TaqMan probe for selected single copy in T0 transgenic rice. Homo, T2 Homo; Hetero, T2 Hetero; NT, Negative control and TG1~1, transgenic lines; +, single copy; -, multi copy. Each level is generated from the DNA template of independent T0 transgenic lines. (target gene probe, 3’NOS; reference probe, tubulin1)


Fig. 4.

Identification of pinII-brazzein insertion transgenic plants. The genomic structures of insertion alleles were determined by FST analysis in which boxes, bold lines, and triangles indicate exons, introns, and pPZP::brazzein, respectively. The arrow and arrowhead indicate gene specific primer pairs from genomic DNA


Fig. 5.

Western blot analysis in T0 generation of transgenic rice plants with the FLAG-tag (DYKDDDDK). Protein was isolated from both transgenic and wild type rice. WT, wild type; 1 to 5, transgenic plant lines


고 찰

고칼로리 정제된 당의 섭취는 비만과 이와 관련된 충치, 수면 무호흡증, 당뇨병 및 관절염과 같은 수많은 복합성 질병을 유발하며, 뇌종양, 방광암, 심장 질환에 걸릴 확률이 높아 정신 장애와 같은 다른 부작용을 야기한다고 하였다(Kant 2005). 인공 감미료는 설탕 대안으로 사용될 수는 있지만 여전히 좋지 않은 영향을 미친다고 하였다(Kant, 2005; Sun et al. 2006; Price et al. 1970; Akter et al. 2016). 따라서 식품, 음료 및 의약품에 안전하게 사용할 수 있는 저칼로리 및 천연 감미료의 연구가 시급하며, 그 중 감미단백질 brazzein이 저칼로리 감미료로써 잠재적인 대안이 될 수 있을 거라 생각되어진다. 이와 관련하여 재조합 단백질 생산 시스템으로 형질전환 식물체의 개발과 생물 반응기를 이용하여 유용한 물질 생산에 관련된 연구가 보고된다(Howard and Hood 2005; Hood and Jilka 1999; Yoshida and Shinmyo 2000; Daniell et al. 2001; Hood et al. 2002; Horn et al. 2004; Streatfield and Howard 2003; Streatfield 2007). 식물 발현 시스템은 형질전환 후대 종자의 유용단백질의 안정적 발현과 장기간 보관이 가능하며, 식물 세포는 박테리아에서 볼 수 없는 글리코실화반응과 같은 복잡한 단백질 번역 후 변형(Post-translational modification)이 잘 일어나 유용물질 생산에 가치가 있다고 보고된다(Lamphear et al. 2005; Sun et al. 2007). 열대식물인 P. brazzeana Baillon의 과실유래 brazzein은 본래의 환경 이외의 다른 곳에서 재배하는 것은 비용이 많이 들고 때로는 재배가 불가능하기 때문에 brazzein 단백질의 이용 가능성을 높이기 위한 대체 생산 시스템으로 형질전환 식물체 육성 하고자 하였다.

본 연구에서는 brazzein 감미단백질을 벼에 도입하여 얻어진 형질전환 벼로부터 유전자의 안정적 발현 및 후대 육성에 대하여 기술 하였다. 선발된 형질전환 계통은 single copy이면서 intergenic 계통을 선발하여 도입 유전자 brazzein 단백질의 발현이 가장 높은 TG11 계통을 선발하고 후대 종자를 확보하였다. 이들 계통은 brazzein 단백질의 높은 생산을 위한 대량 생산 시스템을 구축하는데 이용 가능 할 것으로 생각된다. 향후 본 계통을 이용하여 블라인드 테스트 분석에 의해 재조합 brazzein 단백질의 단맛 정도의 평가 및 육종 소재로 활용 가능할 것으로 시사된다.

적요

Brazzein은 열대식물인 P. brazzeana Baillon의 과실에서 분리 된 가장 작은 감미단백질로 토착민들의 단맛원료로 사용되어 왔다. Brazzein은 sucrose보다 분자량 기준으로 500 ~ 2000배, 몰 기준으로 9500배 당도가 높아 감미료로써 매우 높은 평가를 받고 있다. 그러나 이 감미단백질은 재배가 어렵고 생산 비용이 높아서 brazzein 단백질의 이용 가능성을 높이기 위한 대체 생산 시스템으로 형질전환 식물체 육성 하고자 하였다. 본 연구에서는 brazzein 관련 유전자를 벼에 도입하기 위하여 식물형질전환용 Ti-plasmid에 2 x CaMV 35S 프로모터에 의해 지배되어 발현하도록 하고, 선발 마커로 bar 유전자가 삽입된 식물발현 벡터를 구축하여 A. tumefaciens EHA105에 형질전환시켜 17개의 재분화 식물체를 육성하였다. 17개 재분화 식물체는 PCR 및 RT-PCR 분석을 통하여 유전자 도입 및 발현을 확인하였으며, TaqMan PCR을 통해 single copy로 도입된 T0 세대 9개체를 선발하였다. 또한 FST 분석을 통하여 도입 유전자가 intergenic으로 삽입된 개체 5개를 선발하였다. 이들 5개체를 이용하여 western blot 분석에 의해 단백질 발현량을 분석한 결과 선발된 모든 개체에서 발현 밴드를 확인하였다. 그 중 brazzein 단백질의 발현량이 높은 개체를 TG11으로 계통화하여 후대 종자를 육성하였다. TG11 계통은 천연 감미료 brazzein을 생산하는 새로운 벼 품종을 개발하기 위한 육종 소재로 활용 가능하다고 시사된다.

사사

본 성과물은 농촌진흥청 차세대바이오그린21 연구사업 (세부과제번호: PJ01368902)의 지원 및 2017년도 정부(교육부)의 재원으로 한국연구재단의 지원을 받아 수행된 기초연구사업(과제번호: 2017R1C1B5017833)에 의해 이루어진 것임.

References
  1. Akter S, Huq MA, Jung YJ, Cho YG, and Kang KK. (2016) Application of sweet and taste modifying genes for development in plants: current status and prospects. J Plant Biotechnol 43, 397-404.
    CrossRef
  2. Assadi-Porter FM, Aceti DJ, Cheng H, and Markley JL. (2000) Efficient production of recombinant brazzein, a small, heat-stable, sweet-tasting protein of plant origin. Arch Biochem Biophys 376, 252-258.
    Pubmed CrossRef
  3. Assadi-Porter FM, Aceti DJ, and Markley JL. (2000) Sweetness Determinant Sites of Brazzein, a Small, Heat-Stable, Sweet-Tasting Protein. Arch Biochem Biophys 376, 259-265.
    CrossRef
  4. Assadi-Porter FM, Patry S, and Markley JL. (2008) Efficient and rapid protein expression and purification of small high disulfide containing sweet protein brazzein in E. coli. Protein Expr Purif 58, 263-268.
    Pubmed KoreaMed CrossRef
  5. Berlec A, Jevnikar Z, Majhenic AC, Rogelj I, and Strukelj B. (2006) Expression of the sweet-tasting plant protein brazzein in Escherichia coli and Lactococcus lactis: a path toward sweet lactic acid bacteria. Appl microbiol biot 73, 158-165.
    Pubmed CrossRef
  6. Berlec A, and Strukelj B. (2009) Large increase in brazzein expression achieved by changing the plasmid/strain combination of the NICE system in Lactococcus lactis. Lett Appl Microbiol 48, 750-755.
    Pubmed
  7. Bradford MM. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254.
    CrossRef
  8. Daniell H, Streatfield SJ, and Wycoff K. (2001) Medical molecular farming:production of antibodies, biopharmaceuticals and edible vaccines in plants. Trends Plant Sci 6, 219-226.
    CrossRef
  9. Faus I. (2000) Recent developments in the characterization and biotechnological production of sweet-tasting proteins. Appl Microbiol Biot 53, 145-151.
    CrossRef
  10. Hood EE, and Jilka JM. (1999) Plant-based production of xenogenic proteins. Curr Opin Biotech 10, 382-386.
    CrossRef
  11. Hood EE, Woodard SL, and Horn ME. (2002) Monoclonal antibody manufacturing on transgenic plants–myths and realities. Curr Opin Biotech 13, 630-635.
    CrossRef
  12. Horn ME, Woodard SL, and Howard JA. (2004) Plant molecular farming: systems and products. Plant Cell Rep 22, 711-720.
    Pubmed CrossRef
  13. Howard JA, and Hood E. (2005) Bioindustrial and biopharmaceutical products produced in plants. Adv Agron 85, 91-124.
    CrossRef
  14. Jo HJ, Noh JS, and Kong KH. (2013) Efficient secretory expression of the sweet-tasting protein brazzein in the yeast Kluyveromyces lactis. Protein Expres Purif 90, 84-9.
    Pubmed CrossRef
  15. Jung YJ, Bae SS, Lee GJ, Seo PJ, Cho Y G, and Kang KK. (2017) A novel method for high-frequency genome editing in rice, using the CRISPR/Cas9 system. J Plant Biotechnol 44, 89-96.
    CrossRef
  16. Jung YJ, Nogoy FM, Cho Y G, and Kang KK. (2015) Development of high tryptophan GM rice and its transcriptome analysis. J Plant Biotechnol 42, 186-195.
    CrossRef
  17. Jung YJ, Nou IS, and Kang KK. (2014) Overexpression of Oshsp16.9 gene encoding small heat shock protein enhances tolerance to abiotic stresses in rice. Plant Breed Biotech 2, 370-379.
    CrossRef
  18. Kant R. (2005) Sweet proteins, potential replacement for artificial low calorie sweeteners. Nutrition 4, 5.
    Pubmed KoreaMed CrossRef
  19. Kurihara Y, and Beidler LM. (1968) Taste-modifying protein from miracle fruit. Science 161, 1241-1243.
    Pubmed CrossRef
  20. Laemmli UK. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.
    Pubmed CrossRef
  21. Lamphear BJ, Barker DK, Brooks CA, Delaney DE, Lane JR, Beifuss K, Love R, Thompson K, Mayor J, Clough R, Harkey R, Poage M, Drees C, Horn ME, Streatfield SJ, Nikolov Z, Woodard SL, Hood EE, Jilka JM, and Howard JA. (2005) Expression of the sweet protein brazzein in maize for production of a new commercial sweetener. Plant Biotechnology Journal 3, 103-114.
    Pubmed CrossRef
  22. Lee JJ, Kong JN, Do HD, Jo DH, and Kong KH. (2010) Design and efficient soluble expression of a sweet protein, brazzein and minor-form mutant. B Kor Chem Soc 31, 3830-3833.
    CrossRef
  23. Liu X, Hu Z, Maeda S, Aiuchi T, Nakaya K, and Kurihara Y. (1993) Purification, complete amino acid sequence and structure characterization of the heat stable sweet protein, mabinlin II. Eur J Biochem 211, 281-287.
    Pubmed CrossRef
  24. Masuda T, and Kitabatake N. (2006) Developments in biotechnological production of sweet proteins. J Biosci Bioeng 102, 375-389.
    Pubmed CrossRef
  25. Masuda T, Ueno Y, and Kitabatake N. (2001) Sweetness and enzymatic activity of lysozyme. J Agr Food Chem 49, 4937-4941.
    CrossRef
  26. Ming D, and Hellekant G. (1994) Brazzein, a new high-potency thermostable sweet protein from Pentadiplandra byamarazzeana. B. FEBS Lett 355, 106-108.
    CrossRef
  27. Moris JA, and Cagan RH. (1972) Purification of monellin, the sweet principal for Dioscoreophyllum cumminsii. Biochim Biophys Acta 261, 114-122.
    CrossRef
  28. Price JM, Biava CG, Oser BL, Vogin EE, Steinfield J, and Ley HL. (1970) “Bladder tumors in rats fed cyclohexylamine or high doses of a mixture of cyclamate and saccharin”. Science 167, 1131-1132.
    Pubmed CrossRef
  29. Rachid A, Belloir C, Chevalier J, Desmetz C, and Miller ML et al. (2009) Optimization of the Production of Recombinant Brazzein Secreted by the Yeast Pichia pastoris. Chem senses 34, A80-A80.
  30. Shirasuka Y, Nakajima K, Asakura T, Yamashita H, Yamamoto A, Hata S, Nagata S, Abo M, Sorimachi H, and Abe K. (2004) Neoculin as a new taste-modifying protein occurring in the fruit of Curculigo latifolia. Biosci Biotech Bioch 68, 1403-1407.
    CrossRef
  31. Streatfield SJ. (2007) Approaches to achieve high-level heterologous protein production in plants. Plant Biotechnol J 5, 2-15.
    Pubmed CrossRef
  32. Streatfield SJ, and Howard JA. (2003) Plant-based vaccines. Int J Parasitol 33, 479-493.
    CrossRef
  33. Sun HJ, Cui ML, Ma B, and Ezura H. (2006) Functional expression of the taste-modifying protein, miraculin, in transgenic lettuce. FEBS Lett 580, 620-626.
    Pubmed CrossRef
  34. Sun HJ, Kataoka H, Yano M, and Ezura H. (2007) Genetically stable expression of functional miraculin, a new type of alternative sweetener, in transgenic tomato plants. Plant Biotechnol J 5, 768-777.
    Pubmed CrossRef
  35. Thole V, Alves SC, Worland B, Bevan MW, and Vain P. (2009) A protocol for efficiently retrieving and characterizing flanking sequence tags. (FSTs) in Brachypodium distachyon T-DNA insertional mutants. Nature 4, 650-661.
    CrossRef
  36. Van der Wel H. (1972) Isolation and characterization of the sweet principal for Dioscoreophyllum cumminsii (Stapf) Diels. FEBS Lett 21, 88-90.
    CrossRef
  37. Van der Wel H, and Loeve K. (1972) Isolation and characterization of thaumatin I and II, the sweet-tasting proteins from Thaumatococcus daniellii Benth. Eur J Biochem 31, 221-225.
    Pubmed CrossRef
  38. Van der Wel H, Larson G, Hladik A, Hladik CM, Hellekant G, and Glaser D. (1989) Isolation and characterization of pentadin, the sweet principle of Pentadiplandra brazzeana Baillon. Chem Senses 264, 6655-6659.
  39. Yamashita H, Theeraship A, Nakaya T, Nakamura Y, and Kurihara Y. (1990) Purification and complete amino acid sequence of a new type of sweet protein with taste-modifying activity, curculin. J Biol Chem 265, 15770-15775.
    Pubmed
  40. Yan S, Song H, Pang D, Zou Q, Li L, Yan Q, Fan N, Zhao X, Yu H, Li Z, Wang H, Gao F, Ouyang H, and Lai L. (2013) Expression of Plant Sweet Protein Brazzein in the Milk of Transgenic Mice. PloS one 8, e76769.
    CrossRef
  41. Yoshida K, and Shinmyo A. (2000) Transgenic expression systems in plants, a natural bioreactor. J Biosci Bioeng 90, 353-362.
    CrossRef


September 2018, 45 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM