search for




 

Development of specific single nucleotide polymorphism molecular markers for Angelica gigas Nakai
J Plant Biotechnol 2021;48:71-76
Published online June 30, 2021
© 2021 The Korean Society for Plant Biotechnology.

Shin-Woo Lee ?Soo Jin Lee ?Eun-Hee Han ?Yong-Wook Shin ?Yun-Hee Kim

(Department of Plant & Biomaterials Science, Chilam Campus, Gyeongsang National University, JinJu, Korea)
(Gyeongsangnam-do Agricultural Research and Extension Services, Jinju 52733, Korea)
(Department of BiologyEducation, College of Education, IALS, Gyeongsang National University, Jinju, Korea)
Correspondence to: e-mail: cefle@gnu.ac.kr
Received April 16, 2021; Revised May 11, 2021; Accepted May 11, 2021.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Angelica is a perennial plant used widely for medicinal purposes. Information on the genetic diversity of Angelica populations is important for their conservation and germplasm utilization. Although Angelica is an important medicinal plant genus registered in South Korea, no molecular markers are currently available to distinguish individual species from other similar species in different countries, in particular, China and Japan. In this study, we developed single nucleotide polymorphism (SNP) markers derived from internal transcribed spacer regions of the nuclear ribosomal DNA to identify a distinct domestic species, Angelica gigas Nakai, via a high-resolution melting (HRM) curve analyses. We also performed HRM curve analysis of intentionally mixed genomic DNA samples from five Angelica species. Finally, we investigated A. gigas Nakai and A. sinensis using varying ratios of mixed genomic DNA templates. The SNP markers developed in this study are useful for rapidly identifying A. gigas species from different countries.
Keywords : Angelica, High-resolution melting, Internal transcribed spacer regions of rDNA, Single nucleotide polymorphisms
서 언

산형과(Umbelliferae)의 Angelica속에 속하는 당귀는 coumarin계의 umbelliferon, β-sitosterol, decursin, nodakenetin 등의 성분이 함유된 것으로 알려져 있으며(Kim et al. 2007), 약용 성분 및 식용 가치 측면에서 다양한 영양소 및 유용물질을 함유하고 있어 한약재와 함께 기능성 고부가 가치 식품으로서 개발 가치가 높은 편이다(Kim and Joung 2006). 그러나 우리나라는 참당귀(Angelica gigas Nakai)를 당귀 약재의 기원식물로 규정하고 있으나, 중국은 중국당귀(Angelica sinensis), 일본은 일당귀(A. acutiloba)로 각각 그 기원식물을 달리하고 있다. 이들은 기능성 화합물과 지표성분과 약효 등이 서로 상이한 종이 다른 것임에도 불구하고 이름이 유사한 당귀로 혼·오용이 심각한 실정이다(Kim et al. 2011).

특히 이들 식물체의 형태학적 성상이 상호 구분이 어렵고, 일부 부분적인 가공에 의한 말린 절편 또는 분말가루로 유통되기 때문에 유통시장에서 더욱더 혼란을 가중시키고 있다. 뿐만 아니라 유럽의 구당귀(歐當歸. Levisticum officinale W.D.J.Koch)는 아예 속명이 다른 종임에도 불구하고 중국당귀라는 이름으로 유통되는 사례가 빈번히 발생하고 있다 (Kim et al. 2016). 또한, 세발당귀(Angelica gigas Jiri)는 우리나라의 지리산 고산지대에서 자생하는 토종 당귀로 일반 노지에서는 재배가 어려워 농가에서 대량으로 재배하지 못하기 때문에 시중에 유통되는 대부분의 세발당귀는 자연산 참당귀일 가능성이 높다. 하지만 참당귀와 비교하여 형태학적 특성은 매우 유사하여 구분이 어려우며 단지 세발당귀의 뿌리가 참당귀에 비하여 가늘다는 차이만 알려져 있다(Lee et al. 2021).

최근, 약용작물을 포함한 다양한 식물종의 분자생물학적 구분에 관한 연구는 차세대 염기서열 분석(next generation sequencing, NGS) 등의 염기서열분석 기술의 발달과 함께 급속도로 발전하고 있다. 특히 바코드(barcode) 기술을 이용한 종의 판별에 관한 기술은 기존의 형태학적 특성이나 성상으로는 구분이 어렵고 애매하여 혼·오용이 심각한 한약재에 대한 종의 기원 판별에 큰 발전을 가져오게 하였다. 특히 PCR 기법을 이용한 단일염기다형성(single nucleotide polymorphism, SNP) 및 simple sequence repeat (SSR) 등은 소량의 DNA를 이용하여 식물의 생장과 관계없이 모든 조직에서 안정적으로 탐색할 수 있으며 비교적 적은 비용으로 빠른 시간 안에 분석할 수 있다는 장점을 가진다(Jo et al. 2013).

당귀 속 식물에서는 현재까지 RAPD 및 SSR 분자마커 등을 사용한 종 식별에 대한 연구 사례들이 보고된 바 있으며(Jeong et al. 2019; Lee et al. 2001; Liao et al. 2013; Mei et al. 2015), 최근 본 연구팀에서는 핵내 리보솜 RNA를 암호 하는 유전자 단편 내 Internal Transcribed Spacer (ITS) 영역의 염기서열을 비교하여 SNP를 확인하고 이를 이용한 Amplification Refractory Mutation System (ARMS)-PCR기술을 적용하여 국내 토종 당귀계통인 참당귀와 세발당귀를 외래 당귀 계통인 일당귀, 중국당귀, 구당귀와 판별한 바 있다(Lee et al. 2021). 최근에는 이러한 SNP를 포함하는 특정 barcode단편을 이용하여 High Resolution Melting (HRM) curve 패턴 분석기술로 특정 계통의 판별에 관한 연구보고가 많아지고 있다. HRM curve 패턴 분석기술은 SNP를 포함하는 약 200 bp의 DNA단편을 대상으로 서서히 온도를 상승시키면서 나타나는 melting curve 패턴을 비교하여 계통 간의 구분이 가능할 뿐만 아니라 이들 계통들이 서로 혼재되어 있는 경우 그 농도까지 예측이 가능한 기술이다(Han et al. 2015; Kim et al. 2018). 실지로 가짜 올리브오일을 판별하기 위하여 해바라기, 땅콩, 옥수수, 참깨, 쌀 등에서 추출한 오일과 올리브오일을 대상으로 HRM curve패턴을 비교한 결과 상호 구분이 가능하였으며 이들이 혼재되어 있는 경우에도 판별이 가능하였다고 하였다(Vietina et al. 2013). 또한 Jaakola et al. (2010)은 HRM 분석기술을 이용하여 야생형을 포함한 다양한 베리(berry)계통의 판별이 가능하였다고 보고하였다. 또한 크리스마스 장미(Helleborus niger)와 영국에서 “Black Hellebore”로 불리우는 Veratrum niger가 1:1,000의 비율로 혼재되어 있는 경우에도 판별이 가능하였다고 하였다(Mader et al. 2011). 본 연구팀에서도 국내외에서 수집한 다양한 엉겅퀴 계통(Thistle)들의 엽록체 DNA단편내 단일염기다형성을 포함하는 ITS 유전자 단편을 대상으로 HRM분석을 수행하여 상호 구분이 가능하였을 뿐만 아니라, 서로 혼합되어 있는 경우에 혼입 농도의 추정도 가능하였다(Lee et al. 2019). 이러한 연구결과를 바탕으로 본 연구에서는 한국산 국내 토종 및 해외에서 수집된 다양한 당귀계통을 대상으로 핵내 리보솜 RNA를 암호 하는 유전자 단편 내 ITS 영역에서 SNP를 이용한 판별 프라이머를 확보하였으며, 이를 이용하여 HRM 분석기술을 적용하여 시중에서 혼·오용 사례와 건제품 또는 분말로 혼합하여 유통되는 사례 등을 확인하는데 적용이 가능한 기술을 개발하기 위하여 본 연구를 수행하였다.

재료 및 방법

실험 재료

실험에서 사용한 당귀 계통은 선행연구에서 사용된 국내 자생하는 참당귀(Angelica gigas Nakai) 및 세발당귀(A. gigas Jiri), 일당귀(A. acutiloba), 중국당귀(A. sinensis), 및 구당귀(Levisticum officinale)를 대상으로 조사하였다(Lee et al. 2021). 이들 계통들은 국립원예특작과학원 인삼특작부, 경남농업기술원 약용자원연구소, 경북농업기술원(봉화), 충북농업기술원(오창), 미국(horizon Herbs, Williams, OR)과 국내 한약재 유통 회사 등으로 부터 수집하였다. 수집된 계통들은 DNA를 추출하여 5.8S와 25S rRNA를 포함하는 ITS2 영역에 대한 염기서열분석 후 NCBI를 통하여 등록된 염기서열과 비교하여 진위 여부를 확인한 후 HRM 분석 연구를 수행하였다.

DNA 분리

수집된 계통별로 일정량의 식물체, 종자 및 한약재 재료 등을 액체질소에 급속 냉동시킨 후 곱게 갈아서 얻은 분말을 이용하여 GeneAll사의 ExgeneTM Plant SV 키트를 이용하여 회사에서 제공한 실험방법에 따라 염색체 DNA를 분리하였다. 정제된 DNA는 1% agarose gel에서 전기영동을 실시하여 DNA의 분리 과정에서의 분해 정도를 확인한 후 Micro-spectrometer (BioPrince, SD-2000, Gangwon, South Korea)를 이용하여 234 nm, 260 nm, 280 nm에서 각각 흡광도를 측정하여 A260/A280 값이 1.8-2.2 범위 그리고 A234/A260 값이 0.5-0.8 범위 내 포함 여부를 조사하여 RNA 및 단백질 등의 오염 정도를 확인하여 순수한 DNA를 확인하였다.

ITS의 증폭 및 염기서열 분석

ITS 유전자 내의 SNP를 확인하고자 유전자 단편의 증폭을 위하여 유전자의 염기서열정보를 사용하여 선행연구에서 제작된 프라이머를 이용하였다(Lee et al. 2021). 유전자의 증폭은 iNtRON 회사(Gyeonggi Province, South Korea)에서 제공하는 PCR 반응용 완충 용액 및 i-pfu DNA polymerase를 사용하여 중합반응과정에서 야기될 수 있는 돌연변이를 최소화하였다. 제조사에서 제공하는 실험방법에 따라 순수 분리한 DNA 50 ng과 프라이머를 각각 10 pmole을 혼합한 후 94℃에서 5분간 DNA를 변성 시킨 후 94℃에서 30초, 60℃에서 10초, 72℃에서 30초를 1 cycle로 하여 35 cycle 반복 후 72℃에서 5분간 연장반응을 시킨 후 4℃에서 반응을 종료하고 증폭된 DNA밴드는 2.0% agarose gel을 이용하여 전기영동 하여 그 결과를 확인하였다. 증폭되어진 각 유전자 단편의 클로닝 과정에서 돌연변이가 일어날 수도 있으므로 클로닝을 하지 않고 증폭된 DNA단편을 ExpinTM PCR SV (GeneAll, Seoul, South Korea) Kit를 사용하여 순수 정제한 후 직접 염기서열분석을 의뢰하였다. 또한 최종적으로 확인된 SNP는 최소 5반복 이상 수행하여 검정하였다.

HRM 분석

Table 1에서 제시된 프라이머를 이용하여 HRM (High Resolution Melting) curve 패턴을 분석하기 이전에 이들 프라이머가 목표 유전자 단편을 정확하게 증폭 하는지의 여부를 조사하기 위하여 각각의 프라이머 조합을 이용하여 각 당귀 시료들에서 분리한 DNA를 주형으로 PCR로 증폭시켜 전기영동을 통해 확인하였다. 또한 확인된 밴드들을 순수 정제하여 염기서열분석을 한 결과 각각의 종에서 확인된 ITS 유전자와 100% 일치하는 것을 확인한 후 HRM curve 패턴 분석을 실시하였다. 각 당귀 시료에서 분리한 DNA를 각각 10 ng씩 넣고, 프라이머를 각각 5 pmol 넣고 10 μl의 SsoFast™ EvaGreen Supermix BIO-RAD, 172-5200 premixture를 넣고 전체 반응액을 20 μl로 맞춘 후 Mx3005P QPCR Systems (Agilent Technologies, Santa Clara, USA)을 사용하여 HRM curve 분석을 수행하였다.

Primer sequences for high-resolution melting analysis of the internal transcribed spacer (ITS) fragments

Gene Primers Sequences (5'–3') Tm (°C) Size (bp)
ITS Forward CGAGTCTTTGAACGCAAGTT 54.6 244
Reverse CTAAGATGACGAGGATTCGC 54.4

결과 및 고찰

당귀 계통의 판별을 위한 ITS 유전자 단편의 HRM 분석

선행연구에서 국내 토종 당귀[참당귀(A. gigas Nakai) 및 세발당귀(A. gigas Jiri)]와 해외에서 수집된 [일당귀 (A. acutiloba), 중국당귀(A. sinensis), 구당귀(Levisticum officinale)] 시료들의 ITS 유전자 단편의 염기서열 분석을 한 결과, 동일한 Angelica속이라도 국내에서 자생하는 참당귀(A. gigas, Nakai) 및 세발당귀(A. gigas Jiri)와 종이 다른 일당귀(A. acutiloba), 중국당귀(A. sinensis), 구당귀(Levisticum officinale)사이에는 많은 수의 SNP를 확인할 수 있었다(Lee et al. 2021). 본 연구에서는 핵 내의 ITS 유전자를 이용한 HRM 패턴 분석용 프라이머는 염기서열을 비교하여 가장 많은 SNP를 포함하는 단편으로 약 200 bp 이내의 단편을 증폭할 수 있도록 5종의 당귀계통의 ITS 단편을 증폭할 수 있는 범용 프라이머를 제작하였다(Table 1 and Fig. 1A). 제작된 프라이머를 이용하여 PCR 분석을 통해 증폭된 ITS 유전자 단편을 전기영동한 결과, 5종의 당귀계통에서 모두 동일한 위치에 증폭된 밴드가 확인되었으며, 특히 국내 토종당귀인 참당귀와 세발당귀, 그리고 구당귀의 밴드가 강하게 증폭되는 것을 확인할 수 있었다(Fig. 1B). PCR로 증폭된 DNA 단편을 이용하여 HRM 패턴을 비교 분석한 결과, 5종의 당귀 계통의 구분이 가능하였으며 특히 참당귀와 세발당귀는 증폭된 염기서열에서 단 하나의 SNP를 포함하지만 구분이 가능하여 HRM 패턴 비교기술의 정확성을 확인할 수 있었다(Fig. 1C).

Fig. 1. Sequence alignment, PCR products, and high-resolution melting (HRM) curve analysis using the internal transcribed spacer (ITS) nuclear intergenic regions in five Angelica species. (A) Sequence alignment and position of HRM primers of the ITS nuclear intergenic region in each species. The gray box indicates the same sequences in two or three species, whereas the black box indicates the same sequence in all species. Arrows indicate the positions of the ITS primers developed in this study. (B) PCR results using ITS primers. M, marker. (C) Melting curves of ITS from various samples using ITS primers. Experiments for the HRM curve pattern analyses were repeated at least three times with each set of collected samples

ITS 유전자 단편을 이용한 HRM 분석에 의한 참당귀의 농도 및 다른 당귀 계통의 혼합 비율 분석

HRM 분석을 위해 사용될 참당귀 시료의 적정량을 조사하기 위해, 참당귀에서 순수 분리한 DNA를 희석하여 50, 25, 6, 3, 1%를 포함하도록 만든 일정 용액을 대상으로 HRM 패턴을 분석하였다(Fig. 2A). DNA의 농도에 따라 비교분석을 수행한 결과, 점차적으로 농도에 비례하여 melting curve의 peak가 상대적으로 낮아지는 것을 확인할 수 있었으며, 이 결과를 이용하여 표준 농도곡선으로 한다면 어느 정도의 농도를 추산할 수 있을 것으로 사료되었다. 또한, 참당귀를 기준으로 다른 당귀 계통의 DNA를 동일 비율로 혼합한 시료에 대한 HRM 패턴을 비교한 결과, 많은 종류의 시료가 혼합될수록 melting curve의 peak가 비례하여 낮아지는 결과를 확인 할 수 있었다(Fig. 2B). 이는 Fig. 2A의 참당귀의 농도가 낮아지는 경우와 유사한 패턴을 보임으로서, 실제로 표준 곡선을 활용하여 혼재된 시료 내의 참당귀의 순도를 확인할 수 있을 것으로 생각된다.

Fig. 2. High-resolution melting curve analysis of intentionally mixed genomic DNA samples from five Angelica species. (A) Melting curve in the differentially purified DNA samples of A. gigas Nakai. (B) Melting curve of intentionally mixed genomic DNA samples from A. gigas Nakai and the others. All experiments were repeated at least three times with collected samples

ITS 유전자단편을 이용한 HRM 분석에 의한 중국당귀와의 혼합 비율 분석

실제로 시중에서 참당귀가 중국당귀와 혼재되어 있는 경우를 가정하여 참당귀와 중국당귀의 순수 분리한 DNA를 일정비율로 혼합하여 HRM 패턴을 분석하였다(Fig. 3). 참당귀를 기준으로 하여 중국당귀의 농도별( 50, 25, 6, 3, 1%) 비율로 혼합한 경우. 혼합한 중국당귀의 농도가 낮아짐에 따라 peak가 낮아지는 경향을 보이는 것을 확인 할 수 있었다(Fig. 3A). 반대로, 중국당귀를 기준으로 참당귀를 동일한 비율로 혼합한 경우에도 유사한 패턴을 보였다(Fig. 3B). 즉 순수한 중국당귀의 경우 고유한 낮은 peak를 보이는 것이 50%의 비율로 참당귀를 혼합한 경우, 참당귀의 패턴과 유사하게 peak가 증가한 후 농도가 낮아짐에 따라 점차 peak가 비례하여 낮아지는 경향을 보였다. 결론적으로 종합하면, 순수한 하나의 계통만을 대상으로 한 경우에는 농도가 높아짐에 따라 비례하여 peak가 증가하지만, 다른 당귀 계통을 혼합한 경우 간섭에 의하여 peak가 달라지며 혼합 계통의 농도가 증가함에 따라 peak도 높아지는 것을 알 수 있었다. 그러나 3종류 이상의 다양한 당귀계통을 혼합 할 경우는 패턴의 예측이 쉽지 않은 경향을 보였다.

Fig. 3. High-resolution melting curve analysis of intentionally mixed genomic DNA samples from A. gigas Nakai and A. sinensis. (A) Melting curve in the differential ratio DNA samples of A. sinensis and A. gigas Nakai. (B) Melting curve in the differential ratio DNA samples of A. gigas Nakai and A. sinensis. All experiments were repeated at least three times with collected samples

이상의 연구결과를 종합하여 보면 ITS 단편내 단일염기다형성을 포함하도록 제작한 범용 프라이머 조합은 국내외에서 수집된 5종의 다양한 당귀계통들에 대하여 정확하게 예상한 크기의 DNA 단편을 확인하였다. 이들 증폭된 DNA단편에 대한 염기서열 분석을 통하여 핵산증폭반응 과정에 어떠한 변이현상이 일어나지 않았음을 확인한 후, HRM 패턴을 비교한 결과 5계통을 확실하게 구분할 수 있었다. 특히 국내 자생종인 세발당귀는 참당귀와 비교할 때 식물의 형태학적으로 거의 구분이 불가능한 자생형 ecotype으로 본 연구에서 확인한 ITS 단편내에도 단 하나의 SNP만 확인될 정도로 염기서열도 거의 동일하였다. 하지만 서로 다른 HRM 패턴을 보여 본 기술의 정확도를 확인할 수 있었다. 따라서 선행연구에서 보고된 ARMS-PCR 기술을 적용하여 개발한 판별 마커(Lee et al. 2021)를 사용하여 시중에서 수집된 시료를 대상으로 먼저 진위 여부를 확인하고 HRM 분석기술로 재확인을 한다면 유통시장에서 무작위로 수집된 시료에 대한 판별의 신뢰도를 높이는데 크게 기여할 수 있을 것으로 사료된다.

이에 더하여, 순수 분리한 DNA의 농도를 달리한 경우에 확인된 농도 별 HRM 패턴은 향후 표준곡선으로 활용이 가능할 것으로 사료되었다. 또한, 다양한 당귀 계통들이 식물 그 자체 또는 건조 등의 부분적인 가공과정을 거친 시료들이 서로 혼합하여 유통되는 경우에도 확인이 가능할 것으로 조사되었다. 하지만 본 연구에서는 공인된 당귀계통들에 대한 시료를 확보하여 염기서열분석을 통하여 해당 당귀 계통의 진위여부를 확인한 계통들을 대상으로 순수 분리 정제한 DNA를 서로 혼합하여 수행한 연구결과로, 향후 유통현장에서 실용화하기 위하여서는 생체 시료, 건제품 또는 분말 상태에서 혼합된 시료를 대상으로 한 분석이 먼저 수행되어야 할 것이다. 또한, DNA가 분해되기 쉬운 탕재 및 각종 가공된 한약재와 식품 등을 대상으로 추가 연구가 수행되어야 할 것으로 사료된다.

적 요

당귀는 약용으로 널리 사용되는 대표적인 다년생 식물이다. 다양한 당귀 계통의 유전적 다양성에 대한 정보는 당귀의 유전자원의 발굴 및 보존의 차원에서 매우 중요하다. 당귀는 현재 한국에 등록 된 중요한 약용 식물 종이지만, 다른 나라의 다른 유사한 종과 구별 할 수 있는 분자표지가 없는 실정이다. 그러므로, 본 연구에서는 HRM 분석을 통해 국내 토종 당귀계통인 참당귀를 식별하기 위해 유전체 염기서열의 핵 리보솜 DNA 내부(ITS)영역에서 단일염기다형성(SNP) 분자표지를 개발하였다. 본 연구에서는 또한 5가지 당귀계통들의 혼합된 염색체 DNA 시료를 이용하여 HRM 분석을 수행하였으며, 최종적으로는 혼합된 염색체 DNA의 다양한 비율을 사용하여 혼용되는 대표적인 당귀계통인 참당귀와 중국당귀를 재료로 HRM 분석을 진행하였다. 그러므로, 본 연구에서 개발된 SNP 분자표지는 다양한 지역 또는 국가에서 서식하는 당귀 계통들의 신속한 확인을 위해 매우 유용하게 이용될 것으로 생각된다.

사 사

본 연구는 농림축산식품부 농생명산업기술개발사업(과제번호:314021-03-1-SB050)에 의해 이루어진 결과입니다.

References
  1. Han EH, Kim YH, Lee SW (2015) Development of molecular biological techniques for the differentiation of medicinal plant species. J Plant Biotechnol 42:6-12
    CrossRef
  2. Jaakola L, Suokas M, Haggman (2010) Novel approaches based on DNA barcoding and high-resolution melting of amplicons for authenticity analyses of berry species. Food Chem 123:492-500
    CrossRef
  3. Jeong DH, Park YM, Kim KY, Park HW, Jeon KS, Kim MJ, Gil JS, Lee Y, Um Y (2019) Genetic diversity of Angelica gigas Nakai collected in Korea using genome-wide SSR markers. Kor J Med Crop Sci 27:376-382
    CrossRef
  4. Jo IH, Bang KH, Kim YC, Kim JU, Shin MR, Moon JY, Noh BS, Hyun DY, Kim DH, Cha SW and Kim HS. (2013) Analysis of mitochondrial DNA sequence and molecular marker development for identification of Panax species. Kor J of Med Crop Sci 21:91-96
    CrossRef
  5. Kim HS, Joung SW (2006) Effective components and nitrite scavenging ability of root and leaves a Angelica gigas Nakai. Kor J Food Cook Sci 22:957-965
  6. Kim JY, Yoon YD, Ahn JM, Kang JS, Park SK, Lee K, Song KB, Kim HM, Han SB (2007) Angelan isolated from Angelica gigas Nakai induces dendritic cell maturation through toll-like receptor 4. International Immunopharmacol. 7:78-87
    Pubmed CrossRef
  7. Kim SA, Oh HK, Kim JY, Hong JW, Cho SI (2011) A review of pharmacological effects of Angelica gigas, Angelica sinensis, Angelica acutiloba and their bioactive compounds. J Kor Ori Med 32:1-24
  8. Kim WJ, Moon BC, Yang S, Han KS, Choi G, Lee AY (2016) Rapid authentication of the herbal medicine plant species Aralia continentalis Kitag. and Angelica biserrata C.Q. Yuan and R.H. Shan using ITS2 sequences and multiplex-SCAR markers. Molecules 21:270-276
    Pubmed KoreaMed CrossRef
  9. Kim YH, Shin YW, Lee SW (2018) Practical application of the Bar-HRM technology for utilization with the differentiation of the origin of specific medicinal plant species. J Plant Biotechnol 45:9-16
    CrossRef
  10. Lee MY, Ju YS, Kim HJ and Ko BS. (2001) Discrimination of Aralia continentalis root by the random amplified polymorphic DNA analysis and morphological characteristics. Kor J Ori Med 7:145-152
  11. Lee SW, Lee SJ, Kim YH (2019) Development of specific SNP molecular marker from Thistle in the DNA sequences of chloroplast TrnL-F and MatK region using HRM analysis. J Life Sci 29:524-529
  12. Lee SW, Lee SJ, Han EH, Shin YW, Kim YH (2021) Development of molecular marker for the differentiation of Angelica gigas Jiri line by using ARMS-PCR analysis. J Plant Biotechnol 48:26-33
    CrossRef
  13. Liao C, Downie SR, Li Q, Yu Y, He X and Zhou B (2013) New insights into the phylogeny of Angelica and its allies (Apiaceae) with emphasis on east Asian species, inferred from nrDNA, cpDNA, and morphological evidence. Sys Bot 38:266-281
    CrossRef
  14. Mader E, Ruxicka J, Shimiderer C, Novak J (2011) Quantitative high-resolution melting analysis for detecting adulterations. Anal Biochem 409:153-155
    Pubmed CrossRef
  15. Mei Z, Zhang C, Khan A, Zhu Y, Tania M, Luo P and Fu J (2015) Efficiency of improved RAPD and ISSR markers in assessing genetic diversity and relationships in Angelica sinensis (Oliv.) Diels varieties of China. Elect J Biotechnol 18:96-102
    CrossRef
  16. Viteina M, Agrimoni C, Narmiroli N (2013) Detection of plant oil DNA using high resolution melting (HRM) post PCR analysis: A tool for disclosure of olive oil adulteration. Food Chem 141:3820-3826
    Pubmed CrossRef


June 2021, 48 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM