search for




 

A survey of viruses and viroids in astringent persimmon (Diospyros kaki Thunb.) and the development of a one-step multiplex reverse transcription-polymerase chain reaction assay for the identification of pathogens
J Plant Biotechnol 2022;49:193-206
Published online September 30, 2022
© 2022 The Korean Society for Plant Biotechnology.

Boram Kwon ・Hong-Kyu Lee ・Hee-Ji Yang ・So-Yeon Kim・Da-Som Lee ・ChanHoon An ・Tae-Dong Kim・ Chung Youl Park ・Su-Heon Lee

School of Applied Biosciences, Kyungpook National University, Daegu 41566, Republic of Korea
Forest Microbiology Division, National Institute of Forest Science, Suwon 16631, Republic of Korea
Forest Tree Improvement and Biotechnology Division, National Institute of Forest Science, Suwon
Division of Wild Plant Seeds Research, Baekdudaegan National Arboretum, Bonghwa 35208, Republic of Korea
Correspondence to: e-mail: suheon@knu.ac.kr, doonas@koagi.or.kr
Received July 11, 2022; Revised August 5, 2022; Accepted August 5, 2022.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Astringent persimmon (Diospyros kaki Thunb.) is an important fruit crop in Korea; it possesses significant medicinal potential. However, knowledge regarding the pathogens affecting this crop, particularly, viruses and viroids, is limited. In the present study, reverse transcriptionpolymerase chain reaction (RT-PCR) and high-throughput transcriptome sequencing (HTS) were used to investigate the viruses and viroids infecting astringent persimmons cultivated in Korea. A one-step multiplex RT-PCR (mRT-PCR) method for the simultaneous detection of the pathogens was developed by designing species-specific primers and selecting the primer pairs via combination and detection limit testing. Seven of the sixteen cultivars tested were found to be infection-free. The RT-PCR and HTS analyses identified two viruses and one viroid in the infected samples (n = 51/100 samples collected from 16 cultivars). The incidence of single infections (n = 39/51) was higher than that of mixed infections (n = 12/51); the infection rate of the Persimmon cryptic virus was the highest (n = 31/39). Comparison of the monoplex and mRT-PCR results using randomly selected samples confirmed the efficiency of mRT-PCR for the identification of pathogens. Collectively, the present study provides useful resources for developing disease-free seedlings; further, the developed mRT-PCR method can be extended to investigate pathogens in other woody plants.
Keywords : astringent persimmon, Citrus viroid VI, multiplex RT-PCR, Persimmon cryptic virus, Persimmon virus A
Introduction

The persimmon, native to East Asia (Telis et al. 2020), taxonomically belongs to the Ebenaceae family (Jing et al. 2013). China produces the most persimmons, followed by Korea and Japan (Yonemori et al. 2008); nevertheless, persimmon is rapidly expanding as a new fruit crop worldwide (George et al. 1997). Persimmons are largely divided into two types (astringent and sweet). Astringent persimmons have a high concentration of water-soluble tannins (Kim et al. 2017; Wei et al. 2014). Moreover, depending on the astringent taste of mature fruits and the formation of seeds, persimmons are subdivided into four types: pollination-constant non-astringent, pollination-variant non-astringent, pollination-constant astringent, and pollination-variant astringent (Kajiura 1946). Approximately 190 species of Diospyros are distributed worldwide (Seo et al. 2013), of which only 4 species (D. kaki Thunb., D. louts L., D. virginiana L., and D. oleifera Cheng.) are used as the fruit crops (Hwang et al. 2010; Lim et al. 2008).

Persimmons are an abundant source of carbohydrates, vitamins A and C, terpenoids, and tannins, which are beneficial for various physiological functions and help alleviate oxidative stress (Kim et al. 2006; Suzuki et al. 2005). Dietary persimmon products are effective against several diseases such as heart disease, arteriosclerosis, and high blood pressure (Hong and Chae 2005; Joung et al. 1995; Kim and Kim 2005). For these reasons, persimmons are being consumed as processed foods rather than as fresh fruits. Astringent persimmon has a strong astringent taste due to the tannin component called diospyrin and has a lower consumption than sweet persimmon (Yoo et al. 2019). In Korea, astringent persimmons are mainly used as dried persimmons, oysters, persimmon vinegar, persimmon wine, and persimmon jam, while sweet persimmons are mainly consumed fresh.

Persimmon is one of six major fruits cultivated in Korea, including apples, pears, and grapes. It is a native species considered the most important genetic and breeding resource. Traditionally, the southern region of Korea was the main production area, but the growing temperature has shifted the cultivation sites northward (Kim et al. 2010). Changes in the climatic conditions of the orchard cultivation area affect not only the growth of the fruit tree but also the quality of the fruit, harvest time, and fruit storage. Therefore, several studies have been conducted to cope with climate change, leading to the successful development of varieties suitable for high-temperature, such as ‘Sanggamdongsi’ (Kim et al. 2016). Furthermore, climate change also imposes serious threats regarding the increased incidence of diseases and pests. In particular, infection by pathogens, such as viruses and viroids, causes severe quality and quantity loss of astringent persimmons (Kim et al. 2015). However, the identification and management of important pathogens in astringent persimmons has gained little attention except for a few recent studies mostly focused on sweet persimmons.

Reverse transcription (RT)-PCR and high-throughput transcriptome sequencing (HTS) have been widely used to investigate the viral and viroid outbreak patterns in several crops, including persimmons. Furthermore, multiplex RT-PCR (mRT-PCR) allows rapid and low-cost detection owing to its ability to simultaneously detect multiple target pathogens in a single reaction (Asano et al. 2015; Yao et al. 2014). Therefore, diagnostic methods based on mRT-PCR have been developed for the diagnosis of viral pathogens in various plants, such as beans (Park et al. 2018a), cherries (Park et al. 2018b), garlic (Nam et al. 2015), and pears (Kim et al. 2019).

In this study, viral and viroid outbreak patterns for astringent persimmons cultivated in Korea were investigated using RT-PCR and HTS. In addition, we aimed to develop a -step mRT-PCR method that could quickly and accurately diagnose the pathogens of astringent persimmons in a single reaction. The study renders an useful tool for identification of pathogens and also provides useful resources that could serve as initial materials for developing disease free persimmon.

Materials and Methods

Sample collection

In 2018, persimmon leaf samples (n = 100) from 16 cultivars showing leaf curl, mild mottle, mosaic, vein banding, yellowing symptoms, and symptomlessness were collected from Cheongdo (n = 84) and Yeongam (n = 16) counties, Korea. Of the 16 persimmon culti-vars, 15 cultivars (Cheongdo, Cheongdobansi, Daehaeckmu, Danseongsi, Eunpungjunsi, Gojongsi, Hamansusi, Hiratanenashi, Mihyang, Sagoksi, Sanggamdungsi, Sangju-Dungsi, Suhong, Wolhasi, and Yaoki) were collected in Cheongdo city, and one cultivar (Hachiya) was collected in Yeongam city (Table 1; Supplementary Fig. S1). The collected samples were stored in a refrigerator at -70°C until use.

Information regarding the astringent persimmon cultivars collected

Cultivar Cheongdo Cheongdobansi Daehaeckmu Danseongsi Eunpungjunsi Gojongsi Hamansusi Hiratanenashi

No. of Samples 12 17 3 5 5 2 3 2


Cultivar Mihyang Sagoksi Sangamdungsi Sangjudungsi Suhong Wolhasi Yaoki Hachiya

No. of Samples 4 5 13 2 4 4 3 16


Total RNA extraction

Total RNA was extracted depending on the purpose using two total RNA extraction kits: WizPrep Plant RNA and Maxwell RSC RNA Tissue Kits. To confirm viral infection, total RNA from each leaf sample was extracted using the WizPrep Plant RNA Kit (Wizbiosolutions, Seongnam, Korea). For HTS analysis, individual samples were cut and pooled in equal amounts to compose one sample and ground using liquid nitrogen. The total RNA was extracted using the Maxwell RSC RNA Tissue Kit (Promega, Madison, WI, USA) following the manufacturer’s protocols. DNA contamination was eliminated using DNase.

Known virus and viroid diagnosis

Virus and viroid infection tests were carried out by performing RT-PCR using SuPrimeScript RT-PCR Premix (GenetBio, Daejeon, Korea) with specific primers. For this purpose, a total of eight specific primer pairs were used, of which information on six primer pairs was obtained from previous studies. The remaining two primer pairs [Persimmon virus B (PeVB); forward and reverse primers) and Persimmon viroid 2 (PVd2; forward and reverse primers)] were designed in this study (Table 2). The PVd2 primer pair was designed based on the complete nucleotide sequence of GenBank accession no. NC025967 and NC021720.

Primers used for detecting the viruses and viroids causing infections in persimmon

Virus name Primer name Oligonucleotide sequence (5′ to 3′) Product size Reference
PeCV PeCV-F TTCCAATGGCAGACCAAGG 526 bp Cho et al. (2016)

PeCV-R TGT GTA GGT CGG ATG ACG
PeLV Chry-f CGATCCACTGACCTGATCAAC 251 bp Ito et al. (2013)

272568r TAGAGCACGCGCAAATACTC
PeVA PeVAfor AGGATCATTACAAAATCCGTGAGG 250 bp Morelli et al. (2014)

PeVArev TTCCCGAAAGACAATCTGTCCC
PeVB BF1 AATACGCAAGCGATTCCCGA 541 bp The present study

BR1 CATTCCCAACTAGTCGAGTC
AFCVd AFCVd-C1 GCCCGCAGGGAAAAATAGGA 355 bp Nakaune and Nakano (2008)

AFCVd-H1 GCCCGGTCGTGGATACCTAG
CVd-VI CVdOS-C1 CGACAGGTGAGTCTCCTTGC 330 bp Nakaune and Nakano (2008)

CVdOS-H1 TCGTCGACGAAGGCATGTGA
PVd PVd-C1 CGGCAGGGAGCCTTGCGAAC 396 bp Nakaune and Nakano (2008)

PVd-H1 AGCTCGGGGCTGGAGCTTGG
PVd2 PVd2 2-4(F) GTCGTCGGATGGCCTCCGAG 358 bp The present study

PVd2 2-3(R) TGAAGCTCCCCGTGACGAGC


The RT-PCR reaction was performed in a 20 μL final volume comprising 10 μL pre-mix, 1 μL each forward and reverse primers, 2 μL total RNA, and 6 μL distilled water. The RT-PCR conditions were as follows: RT at 50°C for 30 min; activation at 94°C for 10 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and a final exten-sion at 72°C for 5 min. All amplicons were electrophoresed on a 1.5% agarose gel (PhileKorea, Seoul, Korea), stained with ethidium bromide (EtBr), and screened using a SmartView Pro 2100 UV illuminator (Major Science, CA, USA). Positive amplicons were sequenced using direct sequencing at Macrogen Co. (Seoul, Korea) using an ABI Prism 3730XL Analyzer sequencer (Applied Biosystems, CA, USA). The obtained sequence was identified using BLASTn against the reference sequences available in the National Center for Biotechnology Information (NCBI) database.

High-throughput transcriptome sequencing (HTS)

HTS was performed using an Illumina HiSeq 4000 sequencing system (Illumina, San Diego, CA, USA) with 101 bp paired-end reads. Ribosomal RNA was removed using a Ribo zero RNA removal kit (Illumina). Random cDNA priming and library construction were performed using the TruSeq Stranded Total RNA LT Sample Prep Kit for Plants (Illumina).

Raw data statistics, quality checking, and adapter sequence trimming were per-formed using FastQC v0.11.7 and Trimmomatic 0.38. De novo transcriptome assembly from the clean reads was performed using the Trinity program (version: trinityr-naseq_r20140717), and viral contigs were annotated to reference sequences using DIA-MOND software (ver:0.9.21) and NCBI BLAST (ver:2.4.0+).

Nucleotide identities and phylogenetic analysis

Nucleotide homology and phylogenetic analyses were performed using nucleotide sequences obtained from direct sequencing. The partial sequences of Persimmon cryptic virus (PeCV), Persimmon virus A (PeVA), and Citrus viroid VI (CVd-VI) obtained were compared with previously registered sequences in NCBI GenBank. The pairwise nucleotide identity and phylogenetic trees were generated using the DNAMAN software pro-gram (ver. 6.0).

Species-specific primer design and Monoplex RT-PCR

For two viruses (PeCV and PeVA) and one viroid (CVd-VI) primer design, 9, 5, and 18 sequences were obtained from NCBI GenBank (Supplementary Tables S1-S3). The sequences were aligned using the DNAMAN software, and the conserved regions were identified. In addition, by comparing the species belonging to the target genus, a specific primer was designed for a non-common region. A total of 10, 12, and 7 forward and re-verse primers were designed for PeCV, PeVA, and CVd-VI, respectively. All primers were synthesized by Bioneer Inc. (Daejeon, Korea).

One-step RT-PCR and cloning

The reference primer reported in the paper was also used, and one-step RT-PCR was performed using various combinations of the designed primers. One-step RT-PCR was performed following the same conditions as described above. The concentrations of all specific primers were 10 pmol/μL. The annealing temperature was determined by searching for the optimum temperature within the range of 50-60°C using the gradient function of the PCR machine.

Positive amplicons were cloned into the TA vector (RBC Bioscience, Taipei, Taiwan) using a DNA ligation kit ver. 2.1. (Takara Bio Inc., Shiga, Japan). The ligate was transformed into competent E. coli DH5a (RBC Bioscience), and positively transformed clones were selected based on the ampicillin resistance blue-white colony selection method. The plasmids of at least four clones per primer set were extracted, and sequencing was performed.

Multiplex RT-PCR (mRT-PCR) primer selection and detection limit test

Based on the monoplex one-step RT-PCR results, six primer combinations capable of multiple diagnoses were selected. For mRT-PCR, 2 µL mixed positive RNA was used to perform the test with 10 µL premix, 1 µL each forward and reverse primers (each 10 pmol), and double-distilled water in a final volume of 20 µL. The following reaction conditions were used for one-step mRT-PCR conditions: initial cDNA synthesis step at 50°C for 30 min, pre-denaturation 95°C for 10 min, followed by 37 cycles at 95°C for 30 s, 55°C for 30 s, 72°C for 1 min 30 s; and a final extension at 72°C for 5 min. mRT-PCR products were electrophoresed on a 1.5% agarose gel stained with EtBr in 0.5X TAE buffer and confirmed under ultraviolet light. Positive multibands were gel extracted and purified using the Wizard SV Gel and PCR clean up system (Promega, Madison, WI, USA) and sequenced bidirectionally. The detection limit of the final mRT-PCR primer set was confirmed by 10-fold serial dilutions. The extracted total RNA was adjusted to an initial concentration of 10 ng/µl, and mRT-PCR was performed following the method described above. The detection limit was confirmed by serial dilution of total RNA to 10-7.

Comparison of monoplex and mRT-PCR

One-step monoplex and mRT-PCR were performed using species-specific primers. Fourteen randomly samples with confirmed single infections, mixed infections, and one negative sample were used for this purpose. The amplified product was electrophoresed on an agarose gel, and the results were compared.

Results

Viral and viroid infection patterns

Using seven specific primers, RT-PCR performed on the 100 collected samples identified two viruses (PeCV and PeVA) and one viroid (CVd-VI) in 51 leaf samples. Of these, PeCV was detected in 42 samples (detection rate: 42%), PeVA in 18 samples (18%), and CVd-VI in 7 samples (7%). The remaining two viruses [Persimmon latent virus (PeLV), PeVB) and two viroids [Apple fruit crinkle viroid (AFCVd) and PVd)] were not detected.

The rate of single infection (n = 39/51; 76.5%) was higher than that of mixed infection (n = 12/51; 23.5%). The single infection by PeCV was the highest at 79.5% (n = 31/39), followed by PeVA at 15.4% (6/39) and CVd-VI at 5.1% (2/39). The mixed infections comprised the infections of two and three species. The rates of double infections by PeCV+PeVA and PeVA+CVd-VI were 58.3% (n = 7/12) and 8.3% (n = 1/12), respectively. The remaining four samples demonstrated triple infection by PeCV+PeVA+ CVd-VI (rate of infection: 33.3%; n = 4/12).

Analysis of the infection rate according to varieties revealed that five varieties (Mihyang, Eunpungjunsi, Cheongdobansi, Hiratanenashi, and Hamansusi) had an infection rate of 100%, followed by Sanggamdungsi (76.9%), Hachiya (43.8%), Suhong (25%), and Cheongdo (16.7%). Four cultivars (Cheongdobansi, Hachiya, Hiratanenashi, and Sanggamdungsi) showed mixed infection; among them, the Hiratanenashi variety showed only mixed infection without a single infection. In contrast, in seven varieties (Danseongsi, Daehaeckmu, Gojongsi, Sagoksi, Sangjudungsi, Wolhasi, Yaoki, and Hamansusi), no viruses and viroids were detected (Table 3).

Virus and viroid infection rates (%) in astringent persimmon plants collected in the Cheongdo and Yeongam counties, Korea

Cultivar No. of Samples Single infection Mixed infection

Collected Detected PeCV PeVA CVd-VI PeCV+PeVA PeVA+CVd-VI PeCV+PeVA+CVd-VI
Cheongdo 12 2 -b 1 1 - - -
Cheongdobansi 17 17 9 - - 6 - 2
Danseongsi 5 - - - - - - -
Daehaeckmu 3 - - - - - - -
Eunpungjunsi 5 5 5 - - - - -
Hachiya 16 7 - 5 1 - 1 -
Gojongsi 2 - - - - - - -
Hamansusi 3 3 3 - - - - -
Mihyang 4 4 4 - - - - -
Hiratanenashi 2 2 - - - - - 2
Sagoksi 5 - - - - - - -
Sangamdungsi 13 10 9 - - 1 - -
Sangjudungsi 2 - - - - - - -
Suhong 4 1 1 - - - - -
Wolhasi 4 - - - - - - -
Yaoki 3 - - - - - - -

Infection rate (%) 100 (100%) 51 (51%) 31 (60.8%) 6 (11.8%) 2 (3.9%) 7 (13.7%) 1 (2.0%) 4 (7.8%)


The collected samples infected with viruses or viroids generally showed symptoms of dwarfism, and yellowing and chlorotic spots were observed on the leaves and streaks on the fruit surface in some varieties (Fig. 1).

Fig. 1. Symptoms of collected samples of infected with viruses and viroids. (A) ‘Suhong’ cultivar sample showing dwarf and yellowing symptoms after infection with PeCV, (B) ‘Hachiya’ showing chlorotic spot after infection with PeVA, (C) ‘Cheongdo’ showing dwarf and mild yellowing symptoms after infection with CVd-VI, (D) ‘Cheongdobansi’ showing dwarf symptoms after infection with PeCV and PeVA, (E) ‘Hachiya’ showing stripe symptoms after infection with PeVA and CVd-VI, (F) ‘Pyeonghaekmu’ showing dwarf symptoms after infection with PeCV, PeVA, and CVd-VI

Virus and viroid identification by HTS

A total of 106,613,470 raw reads were obtained, and total read bases from the pooled sample were 10.8 Gbp. The GC content and Q30 were calculated as 42.62% and 95.39%, respectively. After trimming using the Trimmomatic tool and the sliding window method, 103,814,526 reads were obtained with Q30 (96.68%). In total, 277,945 transcript contigs were obtained from the de novo assembly of trimmed clean reads. The assembled transcript maximum, minimum, median, and average contig lengths were 20,913; 201; 313; and 51,218 nt. NCBI BLASTn and BLASTp analyses using the assembled contigs identified seven virus and viroid contigs containing two viruses (PeCV and PeVA) and one viroid (CVd-VI).

Of the seven identified contigs, two, four, and one were confirmed as PeCV, PeVA, and CVd-VI contigs. The two PeCV contigs annotated nearly the complete genome of PeCV segments 1 (1,577 nt) and 2 (1,740 nt). These two contigs shared 99.23% and 99.53% nucleotide identity (query coverage: 99% and 85%) with the PeCV SSPI isolates, HE805113 and HE805114, respectively. Four PeVA contigs covered 1098-6522 contigs length, 95.44% - 97.19% nucleotide identity (query coverage: 99%-100%) with the PeVA Kaki13-14 isolate, AB735628. The CVd-VI contig, c214147_g2_i1 (678 nt) showed the 95.45% nucleotide identity; (query coverage: 99%) with the CVd-VI 3Y3-S isolate, AB054603 (Table 4).

Results of the high-throughput transcriptome sequencing analysis of the virus and viroid contigs obtained from 100 astringent persimmon leaf samples

Contig ID Length (bp) Read count BLASTn Description Query Cover Identities (%) Accession No.
c129190_g1_i1 1,577 92 Persimmon cryptic virus segment 1 99 99.23 HE805113
c199670_g1_i1 1,740 8,789 Persimmon cryptic virus segment 2 85 99.53 HE805114
c271454_g1_i1 6,522 1,209 Persimmon virus A 100 97.19 AB735628
c275502_g2_i1 4,894 763 Persimmon virus A 100 95.44 AB735628
c275502_g1_i1 2,208 333 Persimmon virus A 100 96.11 AB735628
c208015_g1_i1 1,098 15 Persimmon virus A 99 95.89 AB735628
c214147_g2_i1 678 31 Citrus viroid VI 99 95.45 AB054603


Phylogenetic analysis of identified viruses and a viroid

To analyze the phylogenetic relationship between the virus and viroids identified in this study, available sequences (PeCV: 6, PeVA: 3, and CVd-VI: 6 isolates) were obtained from NCBI GenBank.

The phylogenetic tree of the PeCV persimmon isolate revealed its close relation with the KO isolate (AB968365) isolated from D. kaki in Korea. The PeVA persimmon isolate clustered near SSPI isolate (HE805114) obtained from D. kaki in Italy. The CVd-VI persimmon isolate was closely related to four isolates (3Y3-S, AK-6, 10SA1-IW, and LJC-4) obtained from Citrus spp. (Fig. 2). Comparing partial sequence identities among the previously reported isolates, PeCV, PeVA, and CVd-VI were confirmed to share nucleotide identity of 94.4%-100%, 96.3%-96.8%, and 94.9%-96.6%, respectively.

Fig. 2. The maximum likelihood method was used to construct a phylogenetic tree using the partial genome sequences of the (A) PeCV, (B) PeVA, and (C) CVd-VI isolates from persimmon (in this study) and the previously reported PeCV, PeVA, and CVd-VI isolates. The bootstrap percentages are based on 1000 replications; the scale bar indicates 0.05. The accession numbers of the isolates used in the present study are as follows: PeCV isolates from persimmon (in the present study), KO (AB968365.1), SSPI (HE805114.1), Algemesi (KX352444.1), MK-PeCV-1 (MK722176.1), FuyuTCGA4 (MF804511.1), Samsun_S3 (KT962117.1); PeVA isolates from persimmon (in the present study), Kaki13-14 (AB735628.2), SSPI (KM407515.1), KO (LC177111.1); CVd-VI isolates from persimmon (in the present study), LJC-4 (KC769200.1), 3Y3-S (AB054603.1), 10SA1-IW (AB054602.1), MK (AB054600.1), NRCV06 (KT725634.1), AK-6 (KC769208.1), and E-77 (AJ630358.1)

Development of one-step mRT-PCR and validation

A one-step mRT-PCR method was developed for rapid and accurate diagnosis of viruses and viroids identified using RT-PCR and HTS. By constructing various combinations of the designed primers, four sets of PeCV, six sets of PeVA, and three sets of CVd-VI specific primers were selected by monoplex RT-PCR (Supplementary Table S4). Six combinations of the selected primer pairs were constructed based on the expected size. Duplex and triplex RT-PCRs were performed using the six selected combinations, and dimers, non-amplification, and sensitivity were excluded from selecting multiplex diagnostic primers (Fig. 3A). The selected multiplex diagnostic primers reacted strongly within the annealing temperature range of 50-56°C. In addition, the detection-limit assay demonstrated that the reaction worked up to a concentration range of 1 ng (Fig. 3B).

Fig. 3. Products obtained after using the finally selected primer combinations for one-step multiplex RT-PCR (mRT-PCR) analysis for the simultaneous detection of pathogens from astringent persimmon leaves. (A) One-step monoplex-, duplex-, and mRT-PCR results, Lane M: 100-bp size marker, Lane 1 to 3: PeCV, PeVA, and CVd-VI, Lane 4: PeVA+CVd-VI, Lane 5: PeCV+CVd-VI, Lane 6: PeCV+PeVA, Lane 7: PeCV+PeVA+CVd-VI. (B) Sensitivity test for the mRT-PCR results, Lane 1 to 8: total RNA diluted by 10-1 to 10-8

To confirm the efficiency of the mRT-PCR method developed in this study, the obtained results were compared with those of the monoplex RT-PCR. Comparison of the mRT-PCR and monoplex RT-PCR data of 14 randomly selected samples demonstrated consistent results (Fig. 4).

Fig. 4. Comparison and validation of one-step mRT-PCR and monoplex RT-PCR amplification from 14 randomly selected samples. (A) mRT-PCR results and (B–D) monoplex RT-PCR results for PeCV, PeVA, and CVd-VI
Discussion

Despite the development of science and technology, climate change and food crises imposes serious threats worldwide. The impacts of climate change are closely related to crop cultivation, and in Korea, the average rise in temperature is higher than the average global temperature rise leading to shifted locations for crop cultivation and increased incidence of pests and diseases (Kim et al. 2010). Nevertheless, in the next 40 years, the growth in food demand is expected to outstrip projected crop yields (Khoury et al. 2014; Tilman et al. 2011; Tilman and Clark 2014). Therefore, sustainable research to secure genetic diversity and preserve various plants in situ and overlapping seeds has gained momentum worldwide. Wild crop relatives (CWRs), including crop ancestry and other closely related species, play crucial roles in plant breeding as a source of novel genetic diversity (Gur and Zamir 2004; Hajjar and Hodgkin 2007; Jarvis et al. 2008; Xiao et al. 1996). Wild species in their natural habitat have greater genetic diversity without genetic bottlenecks and genetic uniformity and have been used for more than 100 years to increase resistance to pests and diseases (Mujeeb-Kazi and Kimber 1985). Despite the importance of wild plant species, studies have only been conducted on major cultivated crops in Korea (Yu et al. 2017).

Astringent persimmon, a native species, is cultivated throughout the country and is commonly found in the mountains of Korea (Seo et al. 2013). Astringent persimmon is genetically valuable and is presumed to be a wild relative of sweet persimmon. Moreover, it has also gained research interest worldwide due to its health benefits, particularly ameliorating inflammatory responses (Jing et al. 2013). However, despite its medicinal potential, no studies on viruses and viroids that significantly affect the quantity and quality of the crop (Kim et al. 2015) have been reported. To date, eight viruses, including (PeCV, PeLV, PeVA, PeBV, Persimmon ampelovirus (PAmpV), Persimmon polerovirus (PPolV), Persimmon waikavirus (PWaiV), and Passiflora latent virus (PLV) (Cho et al. 2016; 2021; Ito et al. 2015; Ito and Sato 2020; Morelli and Arli-Sokmen 2016; Morelli et al. 2015), and three viroids, including AFCVd, CVd-VI, and PVd have been reported worldwide (Mujeeb-Kazi and Kimber 1985). Of these, three viruses (PeCV, PeVA, and PLV) (Cho et al. 2016; 2021) and two viroids (CVd-VI and PVd) have been reported in sweet persimmons in the Republic of Korea (Kim et al. 2015). In this study, we investigated the viruses and viroids infecting astringent persimmon. RT-PCR and HTS analysis detected two viruses and one viroid in nine of the sixteen tested varieties. A positive infection was confirmed in 51 of 100 samples, and PeCV showed the highest single infection rate. In addition, for mixed infections (double or triple infection), PeCV+PeVA infected the highest number of samples; however, the rate of single infection was considerably higher than that of mixed infection. Consistent with our findings, a previous study has also identified these two viruses species in sweet persimmons cultivated in Korea (Cho et al. 2016).

In the reported study, PeCV had the highest infection rate (87%) compared with that of mixed infection (PeCV+ PeVA; 11%) (Cho et al. 2016). This similarity between astringent and sweet persimmon virus disease outbreaks could be attributed to the grafting cultivation for the production of persimmon seedlings that uses wild persimmons, such as sweet persimmons and/or astringent persimmons, as stock. Furthermore, PeCV has been reported in persimmons grown in Italy, North Macedonia, Turkey, Spain, and the USA, including Korea (Jevremović, and Paunović 2019), whereas PeVA has been reported only in Korea, Japan, and Italy (Cho et al. 2016; Ito and Sato 2020; Morelli et al. 2015). Therefore, PeCV is considered the most common virus in persimmon trees.

Fruit apex disorder and veinlet necrosis were observed in persimmon trees, for which viruses and viroids were identified in a previous report (Ito et al. 2013; Morelli et al. 2015; Nakaune and Nakano 2008), but dwarf, yellowing, and chlorotic spots were observed in the leaves of astringent persimmon cultivars infected in this study (Fig. 1). Streak symptoms were also observed on the fruit surface, but these symptoms could not be completely correlated with the identified pathogens. It is thought that the reason for this difference in symptoms may be due to differences in cultivars and cultivation environments. Furthermore, in previous studies (Cho et al. 2021; Nakaune and Nakano 2008), viruses and viroids were also detected in asymptomatic samples; therefore, it is difficult to confirm the symptoms associated with the isolated viruses or viroids. Contrary to the virus outbreak in the domestic apple and pear, in which the rate of mixed infection was higher than that of a single infection (Kim et al. 2019; Lee et al. 2020), the virus outbreak in astringent persimmons showed different results. Interestingly, no infection was observed in seven cultivars evaluated in this study. These cultivars could serve as useful resources for developing and cultivating disease-free persimmon tree seedlings and contribute to the national certification program promoted recently in Korea to disseminate virus-free seedlings (Kim et al. 2019).

Extraction of nucleic acids from woody plants is difficult because of the presence of various components, such as polysaccharides and polyphenols, in high concentrations compared with those in herbaceous plants (Suzuki et al. 2003). To overcome this problem, various methods, including CTAB, have been developed (MacKenzie et al. 1997). However, the solution-type extraction method has a disadvantage because it consumes a lot of time when extracting nucleic acids from many samples. In contrast, commercial column-type kits allow easy and quick extraction. Therefore, we used the commercial kits to extract total RNA. However, the yield was very low, with an average concentration of 1-3 ng/µL. Nevertheless, effective amplification was confirmed despite the low concentration of RNA (Fig. 3 and 4). In this study, an mRT-PCR method was developed and validated by comparing its results with those obtained from monoplex RT-PCRs. As mRT-PCR simultaneously detects multiple target pathogens in a single reaction (Asano et al. 2015; Yao et al. 2014), it will require fewer nucleic acids than that required by monoplex RT-PCR, which can compensate for the low nucleic acid yield issues in woody plants. Furthermore, due to climate changes and other parameters, a high incidence of the identified pathogens is expected. Therefore, the developed method mRT-PCR could be useful for investigating a future nationwide outbreak of these pathogens.

In summary, this study could render useful resources for breeding virus-free verities. In addition, the developed mRT-PCR method could serve as a useful tool to screen the important pathogens, assist in developing virus-free astringent persimmon seedlings, and greatly contribute to the success of the national certification program introduced recently in Korea (Kim et al. 2019). Nevertheless, further investigation of domestic persimmon trees could provide in-depth insights into the pathogens infecting persimmon trees to develop a holistic management strategy to deal with future virus outbreaks.

Supplemental Materials
jpb-49-3-193-supple.pdf
Conflict of Interest

The authors declare no conflict of interest.

Data Availability Statement

The partial genome sequences of CVd-VI, PeCV, and PeVA have been deposited in NCBI GenBank under accession numbers LC427232, LC427233, and LC427234, respectively.

Acknowledgement

This research was funded by the National Institute of Forest Science (grant number FG0700-2018-02-2021). We would like to thank Editage (https://www.editage.co.kr) for English language editing.

References
  1. Asano S, Matsushita Y, Hirayama Y, Naka T (2015) Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT‐PCR in dahlias and their distribution in Japanese dahlias. Lett Appl Microbiol 61:113-120
    Pubmed CrossRef
  2. Cho IS, Park MJ, Kwon SJ, Choi GS, Hammond J, Lim HS (2016) First report of Persimmon cryptic virus and Persimmon virus A in Korea. J Plant Pathol 98:694
  3. Cho IS, Yang CY, Yoon JY, Kwon TR, Hammond J, Lim HS (2021) First Report of Passiflora Latent Virus Infecting Persimmon (Diospyros kaki) in Korea. Plant Dis 105:1236
    Pubmed CrossRef
  4. George AP, Mowat AD, Collins RJ, Morley-Bunker M (1997) The pattern and control of reproductive development in non- astringent persimmon (Diospyros kaki L.): A review. Sci Hortic 70:93-122
    CrossRef
  5. Gur A, Zamir D (2004) Unused natural variation can lift yield barriers in plant breeding. PLoS Biol 2:e245
    Pubmed KoreaMed CrossRef
  6. Hajjar R, Hodgkin T (2007) The use of wild relatives in crop improvement: a survey of developments over the last 20 years. Euphytica 156:1-13
    CrossRef
  7. Hong JS, Chae KY (2005) Physicochemical characteristics and antioxidant activity of astringent persimmon concentrate by boiling. Korean J Food Cook Sci 21:709-716 (In Korean)
  8. Hwang JH, Park YO, Kim SC, Lee YJ, Kang JS, Choi YW, Son BG, Park YH (2010) Evaluation of genetic diversity among persimmon cultivars (Diospyros kaki Thunb.) using microsatellite markers. J Life Sci 20:632-638 (In Korean)
    CrossRef
  9. Ito T, Sato A (2020) Three novel viruses detected from Japanese persimmon ‘Reigyoku’ associated with graft-transmissible stunt. Eur J. Plant Pathol 158:163-175
    CrossRef
  10. Ito T, Sato A, Suzaki K (2015) An assemblage of divergent variants of a novel putative closterovirus from American persimmon. Virus Genes 51:105-111
    Pubmed CrossRef
  11. Ito T, Suzaki K, Nakano M (2013) Genetic characterization of novel putative rhabdovirus and dsRNA virus from Japanese persimmon. J Gen Virol 94:1917-1921
    Pubmed CrossRef
  12. Jarvis A, Lane A, Hijmans RJ (2008) The effect of climate change on crop wild relatives. Agric Ecosyst Environ 126:13-23
    CrossRef
  13. Jevremović D, Paunović SA (2019) First report of persimmon cryptic virus in persimmon in North Macedonia. J Plant Pathol 101:1285-1285
    CrossRef
  14. Jing Z, Ruan X, Wang R, Yang Y (2013) Genetic diversity and relationships between and within persimmon (Diospyros L.) wild species and cultivated varieties by SRAP markers. Plant Syst Evol 299:1485-1492
    CrossRef
  15. Joung SY, Lee SJ, Sung NJ, Jo JS, Kang SK (1995) The chemical composition of persimmon (Diospyros kaki, Thumb) leaf tea. J Korean Soc Food Nutr 24:720-726 (In Korean)
  16. Kajiura M (1946) Persimmon cultivars and their improvement. 2 Breed Hortic 1:175-182
  17. Khoury CK, Bjorkman AD, Dempewolf H, Ramirez-Villegas J, Guarino L, Jarvis A, Rieseberg LH, Struik PC (2014) Increasing homogeneity in global food supplies and the implications for food security. Proc Natl Acad Sci 111: 4001-4006
    Pubmed KoreaMed CrossRef
  18. Kim CG, Lee SM, Jeong HK, Jang JK, Kim YH, Lee CK (2010) Impacts of climate change on Korean agriculture and its counterstrategies. Korea Rural Economic Institute, Seoul (In Korean)
  19. Kim DH, Kim IS, Lee G, Cho IS, Cho KH, Shin IS, Kim SH, Chun JA, Choi IM (2015) Current occurrence of Persimmon viroid and Citrus viroid in persimmon in JellaNam-do and testing for viroid inactivation methods. J Plant Biotechnol 42:43-48 (In Korean)
    CrossRef
  20. Kim ID, Dhungana SK, Chae YG, Son NK, Shin DH (2016) Quality characteristics of ‘Dongchul’persimmon (Diospyros kaki Thunb.) fruit grown in Gangwondo, Korea. Korean J Plant Resour 29:313-321 (In Korean)
    CrossRef
  21. Kim IH, Kim JY, Nam HJ, Lee KU, Cho DH, Lee YJ (2017) Effect of PE film thickness and storage temperature in MAP deastringency of ‘Sanggamdungsi’ astringent persimmon. Korean J Food Preserv 24:727-733 (In Korean)
    CrossRef
  22. Kim NY, Lee HJ, Kim NK, Oh J, Lee SH, Kim H, Moon JS, Jeong RD (2019) Occurrence pattern of viral infection on pear in Korea and genetic characterization of apple scar skin viroid isolates. Hort Sci Technol 767-778
  23. Kim SY, Jeong SM, Kim SJ, Jeon KI, Park E, Park HR, Lee SC (2006) Effect of heat treatment on the antioxidative and antigenotoxic activity of extracts from persimmon (Diospyros kaki L.) peel. Biosci Biotechnol Biochem 70:999-1002
    Pubmed CrossRef
  24. Kim YJ, Kim BK (2005) Effect of dietary persimmon peel powder on physico-chemical properties of pork. Korean J Food Sci Anim Resour 25:39-44 (In Korean)
  25. Lee S, Cha JS, Kwon Y, Lee YS, Yoo SE, Kim JH, Kim D (2020) Occurrence status of five apple virus and viroid in Korea. Res Plant Dis 26:95-102 (In Korean)
    CrossRef
  26. Lim TH, Choi YH, Song IK, Kim KR, Lee DW, Lee SM (2008) Survey of actual condition of management of persimmon orchards in Sangju, Gyeongbuk in 2007 and 2008. Korean J Pestic Sci 12:414-420 (In Korean)
  27. MacKenzie DJ, McLean MA, Mukerji S, Green M (1997) Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription- polymerase chain reaction. Plant Dis 81:222-226
    Pubmed CrossRef
  28. Morelli M, Arli-Sokmen M (2016) First report of persimmon cryptic virus in Turkey. J Plant Pathol 98:183
  29. Morelli M, Chiumenti M, De Stradis A, La Notte P, Minafra A (2015) Discovery and molecular characterization of a new cryptovirus dsRNA genome from Japanese persimmon through conventional cloning and high-throughput sequencing. Virus Genes 50:160-164
    Pubmed CrossRef
  30. Morelli M, Chiumenti M, La Notte P, Minafra A, Martelli GP (2014) First report of Persimmon virus A in Italy. J Plant Pathol 96:610
  31. Mujeeb-Kazi A, Kimber G (1985) The Production, Cytology and Practically of Wide Hybrids in the Triticeae. Cereal Res Commun 111-124
  32. Nakaune R, Nakano M (2008) Identification of a new Apscaviroid from Japanese persimmon. Arch Virol 153:969-972
    Pubmed CrossRef
  33. Nam M, Lee YH, Park CY, Lee MA, Bae YS, Lim S, Lee JH, Moon JS, Lee SH (2015) Development of multiplex RT-PCR for simultaneous detection of garlic viruses and the incidence of garlic viral disease in garlic genetic resources. Plant Pathol J 31:90-96
    Pubmed KoreaMed CrossRef
  34. Park CY, Min HG, Lee HK, Maharjan R, Yoon Y, Lee SH (2018a) Development of a Multiplex Reverse Transcription-Polymerase Chain Reaction Assay for the Simultaneous Detection of Three Viruses in Leguminous Plants. Res. Plant Dis 24:348-352
    CrossRef
  35. Park CY, Park J, Lee G, Yi SI, Kim BH, Eom JS, Lee SG, Kim H (2018b) Development of a Multiplex RT-PCR for the Simultaneous Detection of Three Viruses in Cherry Plants. Res Plant Dis 24:233-236
    CrossRef
  36. Seo DH, Jung KM, Kim SJ, Kim KM (2013) Development of EST-SSR markers and analysis of genetic diversity using persimmon (Diospyros kaki Thunb) cultivars collecting from domestic. Korean J Plant Resour 26:491-502 (In Korean)
    CrossRef
  37. Suzuki T, Someya S, Hu F, Tanokura M (2005) Comparative study of catechin compositions in five Japanese persimmons (Diospyros kaki). Food Chem 93:149-152
    CrossRef
  38. Suzuki Y, Hibino T, Kawazu T, Wada T, Kihara T, Koyama H (2003) Extraction of total RNA from leaves of Eucalyptus and other woody and herbaceous plants using sodium isoascorbate. Biotechniques 34:988-993
    Pubmed CrossRef
  39. Telis VRN, Gabas AL, Menegalli FC, Telis-Romero J (2020) Water sorption thermodynamic properties applied to persimmon skin and pulp. Thermochim Acta 343:49-56
    CrossRef
  40. Tilman D, Clark M (2014) Global diets link environmental sustainability and human health. Nature 515:518-522
    Pubmed CrossRef
  41. Tilman D, Balzer C, Hill J, Befort BL (2011) Global food demand and the sustainable intensification of agriculture. Proc Natl Acad Sci 108:20260-20264
    Pubmed KoreaMed CrossRef
  42. Wei X, Liu F, Qiu Z, Shao Y, He Y (2014) Ripeness classification of astringent persimmon using hyperspectral imaging technique. Food Bioprocess Technol 7:1371-1380
    CrossRef
  43. Xiao J, Grandillo S, Ahn SN, McCouch SR, Tanksley SD, Li J, Yuan L (1996) Genes from wild rice improve yield. Nature 384:223-224
    CrossRef
  44. Yao B, Wang G, Ma X, Liu W, Tang H, Zhu H, Hong N (2014) Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR. J Virol Methods 196:113-119
    Pubmed CrossRef
  45. Yonemori K, Honsho C, Kanzaki S, Ino H, Ikegami A, Kitajima A, Sugiura A, Parfitt DE (2008) Sequence analyses of the ITS regions and the matK gene for determining phylogenetic relationships of Diospyros kaki (persimmon) with other wild Diospyros (Ebenaceae) species. Tree Genet Genomes 4:149-158
    CrossRef
  46. Yoo SK, Kim JM, Park SK, Kang JY, Han HJ, Park HW, Kim CW, Heo HJ (2019) Chemical compositions of different cultivars of astringent persimmon (Diospyros kaki Thunb.) and the effects of maturity. Korean J Food Sci Technol 51:248-257 (In Korean)
  47. Yu HB, Lim TH, Jung MG, Kim JE, Park CJ, Song JH, Lee DW (2017) Survey on actual pest management condition of persimmon orchards in sancheong, gyeongsangnam-do and yeongdong, chungcheongbuk-do. Korean J Pestic Sci 21: 417-426 (In Korean)
    CrossRef


September 2022, 49 (3)
Full Text(PDF) Free
Supplementary File

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM