search for




 

Combining ex vitro thermotherapy with shoot-tip grafting for elimination of virus from potted apple plants
J Plant Biotechnol 2022;49:222-229
Published online September 30, 2022
© 2022 The Korean Society for Plant Biotechnology.

Jae An Chun ・Jiyeong Gwon ・Seon Gi Lee

(Korea Fruit Agricultural Co, Federation, Korea Nursery Tree Management Center, Sangju-si 37155, Korea)
Correspondence to: e-mail: jeaan761@gmail.com
Received July 11, 2022; Revised August 18, 2022; Accepted August 20, 2022.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Apples are the most grown fruit crops in the fruit industry of Korea. However, virus or viroid infection such as apple mosaic virus (ApMV), apple stem grooving capillovirus (ASGV), apple stem pitting virus (ASPV), apple chlorotic leaf spot virus (ACLSV), apple scar skin viroid (ASSVd) causes fruit yield reduction and poor fruit quality. Therefore, in this study, we examined to established an efficient virus-free system to eliminate the most infected ASGV virus in domestic apple orchard. We investigated that the shoot growth rate and the virus removal rate in ASGV infected potted apples that were treated with heat treatment in a growth chamber (constant temperature/humidity device) maintained at 36°C, 38°C and 40°C for 4 weeks. Here we found that the shoot growth rate was the highest in the heat treatment group (36°C) and the virus was removed in the middle and top of the shoot but not in the bottom. The virus was did not removed in the 38°C and 40°C heat treatment group in all section of shoots, and the heat treatment group (40°C) died after 4 weeks of heat treatment without growth of shoots. We performed in vivo shoot-tip grafting using the shoot-tip of potted apple heat-treated at 36 °C, and we also investigated the viability and virus removal rate, which showed 94% viability and 20% virus removal rate. Collectively, our results suggest that it would be possible to produce the virus-free apple plants through heat treatment and shoot-tip grafting.
Keywords : Apple stem grooving capillovirus, virus-free apple plants, heat treatment, shoot-tip grafting, potted apple
서 론

사과는 세계 여러 지역에서 약 12개의 바이러스에 자연적으로 감염되며, 과실 생산과 품질에 피해를 주는 주요 바이러스 및 바이로이드는 apple mosaic virus (ApMV), apple stem grooving capillovirus (ASGV), apple stem pitting virus (ASPV), apple chlorotic leaf spot virus (ACLSV), apple scar skin viroid (ASSVd)로 알려져 있다(Nisar 2013). ApMV는 잎에 밝은 크림색의 반점, 모자이크, 갈변을 발생시켜 생육을 저해하며 (Akbaş and Ilhan 2005), ASGV는 접목부위의 고접병에 의한 접목불친화성을 발생시킬 뿐만 아니라, 생육 저해와 수확량 감소를 유발하는 것으로 보고되어져 있다(Massart et al. 2011). ASPV와 ACLSV는 잠복기를 가지며 단독 또는 복합감염으로 인한 상호작용으로 고접병과 생육저하를 유발하며(Jelkmann and Paunovic 2011; Yanase 1974), ASSVd는 과피에 코르크 반점을 유발하여 착색 불량을 야기시키는 것으로 보고되어 있다(Kim et al. 2010). 주요 바이러스 4종과 바이로이드 1종에 대한 정선, 단양, 예산, 장수, 무주 지역 사과 과수원의 감염률은 97.3%의 높은 감염률을 보였으며, 각각의 감염률은 ASGV 93.4%,ASPV 85.7%, ACLSV 59.0%, ASSVd 6.7%, ApMV 3.6%로써 ASGV의 감염이 가장 높은 것으로 보고하였다(Lee et al. 2020). 바이러스에 감염된 과수는 과실 수확량 감소와 품질 저하를 야기시키며, 접목과 같은 영양번식에 의해 감염이 된다(Cembali et al. 2003). 따라서 이러한 피해를 감소시키기 위해서는 무병묘의 보급이 필요한 실정이다.

일반적으로 감염묘로부터 바이러스를 제거하여 무병묘를 생산하는 방법은 바이러스에 감염된 식물체를 기내로 도입하여 기내에서 열처리 후 생장점 배양을 통한 무병묘 생산(Dĩaz-Barrita et al. 2008; Paprstein et al. 2008)과 기외에서 식물체를 열처리 후 신초의 경정부위를 절취하여 기내에 도입 후 증식하여 무병묘를 생산하는 thermotherapy방법(Vivek and Modgil 2018)이 있다. 항바이러스제를 사용한 chemotherapy방법은 조직배양체 증식배지에 항바이러스제인 ribavirin (Hansen and Lane 1985), 6-azauracil (Hansen 1988), 2-thiouracil (Skiada et al. 2009) 등을 처리하여 바이러스 제거 조직을 유도한 후 증식하여 무병묘를 생산한다. 일부 바이러스는 thermotherapy와 chemotherapy 단독 처리로 바이러스를 제거하기 어려운 경우가 있다. 따라서 열처리와 항바이러스제 처리를 병행하는 방법과(Hu et al. 2015b)과 열처리와 초저온동결 처리를 병행하는 방법(Wang et al. 2009)이 무병화 효율을 높이는 것으로 보고되었다.

국내 사과 농가에 가장 많이 분포하고 있는 ASGV는 굴곡사상바이러스로 600-700 nm × 12 nm의 크기와 6,495-6497개의 염기를 가지며, 241 kDa의 ORF1과 36 kDa의 ORF2를 가지고 있다(James 2008). ASGV는 다른 바이러스와 다르게 생장점에도 감염되어 열처리 후 생장점 배양을 통한 바이러스 제거 효율이 떨어진다(Knapp et al. 1995).

Zhao et al. (2018)은 immunolocalization을 통해 기내에서 배양중인 ASGV 감염체의 바이러스 감염 분포를 관찰한 결과, 경정부분의 생장점과 엽원기에 ASGV가 감염되어 있으며, 열처리 후 생장점 상층부에서는 바이러스가 제거되었으나 생장점 상층부와 인접한 부위에서는 바이러스가 제거되지 않는 것을 확인하였다. 열처리 후 생장점을 배양하여 재분화 배양체의 바이러스 제거율을 조사한 결과 20-40%의 낮은 제거율을 보였으며, 바이러스 제거 효율을 높이기 위해 열처리 후 경정부위를 초저온동결하여 생장점 부위만을 생존시켜 배양한 결과 93-100%의 바이러스 제거율을 보여주었다. 또한 열처리와 항바이러스제를 병행한 무병화 처리는 ASGV 바이러스를 효율적으로 제거하는 것으로 보고되었다(Hu et al. 2015b). 하지만 조직배양과 항바이러스제를 이용한 무병묘 생산은 항바이러스제가 가지고 있는 독성과(Hu et al. 2015b; Paunovic et al. 2007), 고농도의 식물 호르몬 사용과 반복적인 증식 분화, 캘러스의 변이로 인해 유전형질이 변할 가능성이 있다(Dobránszki and da Silva 2010). 따라서 본 연구에서는 이러한 문제점을 해결하기 위해 폿트묘를 이용하여 바이러스가 제거된 경정부위를 생성하는 최적 열처리 온도를 분석하였으며, 기외에서 경정접목을 이용하여 효율적인 무병묘 생산 방법을 찾고자 하였다.

재료 및 방법

식물 재료

열처리와 경정 접목을 이용한 무병묘를 생산하기 위해 중앙과수묘목관리센터에 재식되어 있는 5년생 사과 쓰가루 품종의 1년생 가지로부터 접수를 채취하였으며, 유기물 원료인 피트모스 및 코코피트와 무기물 원료인 제오라이트를 혼합한 상토(슈퍼두배나 상토 2호, 흥농씨앗, Korea)로 채워져 있는 사각심경포트(상부: 140 × 140 mm, 하부: 100 × 100 mm, 높이: 400 mm)에 재식된 MM111 무병대목에 가지접 하였다. 접목 폿트묘는 비가림 육묘장에서 1년간 생육 후 RT-PCR을 이용하여 ASGV에 감염된 9개체가 선발되었으며, 열처리 온도에 따라 각각 3개의 폿트묘가 시험 재료로 사용하였다.

열처리 및 경정 접목

육묘장 생육한 휴면기의 1년생 폿트묘를 이용하여 60% 습도와 36°C, 38°C, 40°C가 유지되는 항온·항습장치에서 16시간 주간, 8시간 야간 조건으로 4주간 열처리 과정을 수행하였다. 각각의 온도에서 3개의 폿트묘가 처리되었으며, 주지로부터 생성된 신초의 길이를 1주 간격으로 4주까지 측정하여 신초의 생육을 조사하였다. 무병묘 생산을 위해 열처리 4주 후 생성된 신초의 경정부위를 1~2 cm 크기로 절취하였으며, 경정접목을 위한 대목으로 M9, M26 보다 세력이 강한 왜성무병대목 MM111에 접목하였다. 접목된 부위는 수분 손실에 의한 고사를 방지하기 위해 빛이 투과되는 플라스틱 캡을 씌워 밀봉하였으며, 항온·항습장치에서 26°C, 60% 습도를 유지하며 16시간 주간, 8시간 야간 조건으로 7일간 육묘하였다. 7일 후 밀봉된 캡을 개방하고 26°C, 60% 습도를 유지하며 16시간 주간, 8시간 야간 조건에서 2개월간 생육 후 생존율 및 바이러스 제거율을 조사하였다. 열처리 온도에 따른 신초생장률 성적은 GraphPad Prism (PRISM 5.0, GraphPAD Software Inc, San Diego, CA, USA) 프로그램을 이용하여 회귀분석을 하였다.

바이러스 검정

열처리 온도와 기간에 따라 폿트묘에서 발생한 신초의 바이러스 제거율을 조사하기 위해 열처리 3, 4주 후 신초의 하단부와 중간부 및 상단부의 잎을 채취하여 바이러스 검정에 사용하였다. Total RNA를 추출하기 위해 조직파쇄기(TissueLyser II, Takara, Japan)를 이용해 샘플을 마쇄하였으며 6M Guanidine HCL 1 ml 첨가하였다. 실온에서 5분간 반응 후 13,000 rpm, 25°C, 10 min 간 원심분리하여 상등액을 취하였으며 자동핵산추출기(NucliENS EasyMAG, bioMérieux, Netherlands)를 사용하여 제조사의 추출 방법에 따라 수행하였다. 추출된 Total RNA는 One-step P·CHECKTM Virus/Viroid kit Detection kit (Nexbio, Korea)를 사용하여 cDNA합성 후 PCR을 수행하였다. RT-PCR 대조구로 Dehydrogenase subunit 5 (Nad5)유전자 증폭이 사용되었으며, PCR 증폭은 2X RT-PCR Mix 15 µl, Oligo mix 10 µl, Total RNA 1 µg를 혼합하였다. ASGV를 검출하기 위한 primer 조합은 Table 1와 같다. 증폭반응은 cDNA 합성을 위해 50°C 30분, 95°C 1분 과정을 1회 반응시켰으며 PCR 반응을 위해 95°C 30초, 58°C 30초, 72°C 5분을 35회 반복하였다.

Multiplication from two explants from an AVVP* bulb

Primers Sequences (5’-3’) Product size References
ASGV-Fa GCCACTTCTAGGCAGAACTCTTTGAA 264 Menzel et al. 2002
ASGV-R AACCCCTTTTTGTCCTTCAGTACGAA
Nad5-Fb GATGCTTCTTGGGGCTTCTTGTT 158 Menzel et al. 2002
Nad5-R CTCCAGTCACCAACATTGGCATAA

aASGV: Apple stem grooving virus

bNad5: Dehydrogenase subunit 5


결과 및 고찰

사과 폿트묘 ASGV 바이러스 진단

폿트묘 열처리를 통한 무병화 재료를 선발하기 위하여 중앙과수묘관리센터 포장에 재식되어있는 5년생 사과 ‘쓰가루’의 1년생 가지로부터 접수를 채취하여 폿트에 재식되어 있는 MM111 대목에 가지접 하였으며, 비가림 육묘장에서 1년간 육묘 후 바이러스를 검사하여 ASGV에 감염된 것을 확인하였다(Fig. 1A).

Fig. 1. Detection of apple virus in potted apple by RT-PCR. (A) Selection of plants infected with the virus. M, size marker; lane 1, positive control (ACLSV: Apple chlorotic leaf spot virus, ASPV: Apple stem pitting virus, ASGV: Apple stem grooving virus, ASSVd: Apple scar skin viroid, ApMV: Apple mosaic virus, Nad5: Dehydrogenase subunit 5); lane 2-10, potted plants. (B) Position of sampling from the lateral shoots resulting from heat treatment

열처리 온도에 대한 신초 생장률

열처리 온도에 따른 폿프묘의 신초 생장률을 조사하기 위하여 36°C, 38°C, 40°C 처리 온도에서 4주간 열처리를 수행하였다. 신초 생장률은 36°C 처리구에서 가장 높았으며(Fig. 2A), 폿트묘 1은 열처리 1주부터 빠른 생장률과 4주까지 가장 높은 신초 생장률을 보였다(Fig. 3A). 폿트묘 2, 3은 열처리 2주부터 신초 생장이 활발하였으며 열처리 4주까지 지속적으로 생장하였다(Fig. 3A). 38°C 처리구 폿트묘 4, 폿트묘 6는 열처리 1주부터 신초의 생장이 시작되었으나 열처리 4주까지 낮은 신초 생장률을 보였으며, 폿트묘 5는 열처리 4주까지 신초가 생장하지 않았다(Fig. 2B, 3B). 40°C 처리구에서는 모든 폿트묘에서 일부 신초만이 발생되고 열처리 기간동안 생장은 정지하였으며, 열처리 3주부터 모든 폿트묘의 고사 증상이 나타나기 시작하여 4주 후에 괴사하였다(Fig. 2C, 3C). 식물은 지속적으로 고온에 노출되면 단백질 변성을 야기시켜며, 이로 인해 효소 및 세포막이 손상되어 뿌리를 통한 수분공급이 원활하게 이루어지지 않는다(Howarth 2005). 따라서 40°C 처리구는 고온 스트레스로 인한 수분 부족에 의해 고사한 것으로 보인다.

Fig. 2. Shoot growth of potted apple after heat treatment for 1, 2, 3, and 4 weeks. (A) Potted apple plants heat-treated at 36°C. (B) Potted apple plants heat-treated at 38°C. (C) Potted apple plants heat-treated at 40°C

Fig. 3. Shoot elongation of potted apple after heat treatment for 1, 2, 3, and 4 weeks. Data are the mean ± SEM. (A) Potted apple plants heat-treated at 36°C; pot 1 (n = 13), pot 2 (n = 15), pot 3 (n = 15). (B) Potted apple plants heat-treated at 38°C; pot 4 (n = 14), pot 5 (n = 16), pot 6 (n = 15). (C) Potted apple plants heat-treated at 40°C; pot 7 (n = 10), pot 8 (n = 11), pot 9 (n = 16).

바이러스는 열처리에 의해 복제와 이동이 제한된다(Cooper and Walkey 1978; Zhao et al. 2018). 따라서 바이러스의 복제와 이동을 억제하는 열처리 온도에서 생성된 신초 신장 부위는 바이러스에 감염되지 않으며, 열처리 과정에서 신초의 생장률이 높을수록 바이러스에 감염되지 않은 경정부위를 획득할 가능성이 높아진다. 하지만 식물은 고온에서는 신초의 생육이 저하되고 열처리 온도가 낮아지면 바이러스의 복제와 이동이 가능해져 적합한 열처리 온도와 기간이 요구된다(Panattoni et al. 2013). 따라서 36°C 처리구는 열처리에 의한 스트레스를 최소화하여 신초의 생장을 유지하며, 바이러스의 복제와 이동을 제한하여 바이러스에 감염되지 않는 경정조직을 생성할 가능성이 높을 것으로 판단된다.

열처리를 통한 바이러스 제거 효율

열처리 온도에 따른 바이러스 제거율을 조사하였으며 열처리 과정에서 신장된 신초는 경정부분에 위치한 T (상단부)와 신초의 가운데에 위치한 M (중간부), 그리고 주지와 근접한 B (하단부) 3구간으로 구분하여 바이러스 제거율을 조사하였다(Fig. 1B). 36°C 처리구는 열처리 3주 및 4주 후의 모든 신초의 하단부에서 바이러스가 검출되었으나 중간부와 상단부에서는 바이러스가 제거되었다. 반면 38°C 처리구에서는 모든 신초의 전 구간에서 바이러스가 검출되었다(Table 2).

Effect of temperatures on elimination of Apple stem grooving virus in potted apple

Heat treatment Treatment period Treated plants Leaf position from the later shoots
Bottom → Middle → Top

Bottom Middle Top
36°C 3 weeks 1 + - -
2 + - -
3 + - -

4 weeks 1 + - -
2 + - -
3 + - -

38°C 3 weeks 1 + + +
2 + + +
3 + + +

4 weeks 1 + + +
2 + + +
3 + + +

40°C 3 weeks 1 + nt nt
2 + nt nt
3 + nt nt

4 weeks 1 + nt nt
2 + nt nt
3 + nt nt

+: positive reaction, -: negative reaction, nt: not tested



높은 열처리 온도는 바이러스의 이동과 복제를 억제하는데 효율적이지만 식물 생장에도 영향을 미쳐 식물의 생존율과 신초의 분화 및 생장에 대한 저해 요인으로 작용한다(Hu et al. 2015b; Uchanski et al. 2004). 따라서 효율적으로 무병묘를 생산하기 위해서는 바이러스의 복제와 이동을 억제하며 동시에 식물 생장을 저해하지 않는 최적의 온도가 요구된다. 36°C 처리는 열처리에 의해 바이러스의 복제와 이동을 제한되어 신장된 신초의 중간부와 상단부는 바이러스에 감염되지 않았으며, 하단부는 신초 생장이 시작되기 전 또는 바이러스 감염 부위와 근접하여 바이러스가 검출되는 것으로 보인다. 38°C 처리는 열처리 스트레스로 인해 낮은 신초 생장률을 보였으며, 열처리 3주부터 4주까지 모든 신초의 전 구간에서 바이러스가 검출되었다. Hu 등(2015b)는 열처리 후 정단부 신초 보다 생장이 활발한 액아에서 발생한 신초의 정단부의 사용이 무병화 효율이 높아짐을 보고하였는데, 38°C 처리구에서 신장한 신초는 낮은 생장률에 의해 상단부와 하단부가 근접하여 바이러스가 제거되지 않은 것으로 보인다. 40°C 처리구는 일부 신초가 발생되었으나 생장이 정지되어 상단부, 중간부, 하단부가 구분되지 않았으며, 모든 폿트묘의 신초에서 바이러스가 검출되었다. 따라서 바이러스에 감염된 조직에 존재하는 바이러스는 열처리에 의해 제거되지 않았으며, 바이러스의 복제와 이동이 제한되며 신초의 생장이 활발한 36°C 처리에서 3주 이상 열처리한 신초의 경정 부위는 바이러스가 100% 제거되었다.

열처리에 의해 바이러스가 제거된 조직이 열처리를 제거하였을 경우 바이러스에 재감염 되는 시기를 조사하기 위해 36°C 온도에서 4주 열처리 후 26°C로 옮겨 생육한 결과, 2주 후 신초의 경정부위에서 바이러스 재감염률은 75%였으며, 3주 후 바이러스 재감염률은 100%였다(Table 3).

Virus reinfection rate of heat treatmented shoots after seeding in green house

Seedling temperature Treatment period Plant Number Shoot Number Leaf position from the later shoots
Bottom → Middle → Top

Bottom Middle Top
1 weeks 1 1 + - -
2 + - -
2 1 + - -
2 + - -
2 weeks 1 1 + - +
26°C 2 + - -
2 1 + + +
2 + - +
3 weeks 1 1 + + -
2 + + +
2 1 + + +
2 + - +

+: positive reaction, -: negative reaction



경정 접목에 의한 무병묘를 만들기 위해 36°C와 38°C에서 4주간 처리된 경정부위(Fig. 4A)를 1~2 cm 절취하여(Fig. 4B) 무병대목 MM111에 접목하였으며(Fig. 4C), 수분손실에 의한 고사를 방지하기 위하여 경정접목 부위를 플라스틱 캡으로 밀봉한 후 7일 간 육묘하였다(Fig. 4D). 접목 7일 후 캡을 제거하고 26°C 온도에서 2개월 동안 육묘하여 접목묘의 생존율과 바이러스 제거율을 조사하였다(Table 4). 36°C 처리구에서 평균 94.2% 생존율을 보였으며, 38°C 처리구에서는 열처리 스트레스에 의해 경정 부위의 갈변이 진행되었으며 50% 생존율을 보였다. Hu 등(2015a)는 열처리 후 신장된 신초의 경정 접목 생존율이 평균 41.2%로 보고하였으며, Hu 등(2019)는 경정 접목 생존율이 평균 66.7%로 보고하였는데, 경정 접목 생존율의 차이는 경정 부위의 열처리에 의한 피해정도와 접목 방법 및 접목 부위의 수분 손실에 따른 고사에 의한 차이로 보여진다.

Survival and elimination rate of plants after thermotherapy and combined with shoot tip grafting

Heat treatment Treated plants No. of grafted shoot tips survival plants (%) ASGV elimination (%)
36°C 1 9 100 11.1
2 11 90.9 30.0
3 12 91.7 18.1

Average 94.2 ± 5.0z 19.7 ± 9.5

38°C 1 1 100 0
2 nt nt nt
3 1 0 0

Average 50.0 ± 70.7 0.0 ± 0.0

40°C 1 nt nt nt
2 nt nt nt
3 nt nt nt

Average nt nt nt

zStandard error

nt: not tested



Fig. 4. A flow chart of production of virus-free apple plants using shoot-tip grafting. (A) Potted apple plants heat-treated at 36°C. (B) Shoot tip. (C) Shoot-tip grafting. (D) Grafted shoot-tip were kept moist with plastic tube

경정 접목 2개월 후 접목묘의 바이러스 제거율을 조사한 결과, 36°C 처리구의 바이러스 제거율은 평균 19.7%였다(Table 4). 열처리 후 생장한 신초의 경정 부위의 바이러스 제거율은 100%였는데(Table 2), 경정 접목 후 폿트묘에서 바이러스가 검출된 것은 열처리 후 신초의 경정부위에 존재하는 바이러스 농도가 낮아 PCR에 검출되지 않았으며, 경정접목 후 육묘과정에서 바이러스가 증식하여 PCR에 검출된 것으로 보인다. 38°C 처리구에서는 바이러스가 제거되지 않았는데, 이러한 결과는 접목을 위해 채취한 경정부위가 바이러스 감염 조직과 근접하여 나타난 결과로 생각된다(Table 4). 따라서 무병화 효율을 높이기 위해 높이기 위해서는 36°C 이상의 열처리 온도에서 신초가 생장하는 조건과 1 cm보다 작은 크기의 경정을 접목할 수 있는 미세접목 기술이 확립되면 효율적인 무병묘 생산이 가능할 것으로 판단된다.

본 연구에서는 ASGV에 감염된 폿트묘를 이용해 열처리 온도와 기간에 따른 바이러스 제거율에 대하여 조사하였으며, 열처리 후 신장된 신초의 경정을 이용한 경정접목을 통해 무병묘를 획득하였다. Lee et al. (2013)은 기외에서 폿트묘 열처리 후 기내에서 경정배양을 통해 무병묘를 생산하였는데, 본 연구의 경정접목을 이용한 무병묘 생산은 무병화 과정을 간략화 하여 무병묘 생산을 가능하게 한다. 하지만 열처리와 항바이러스제처리 또는 초저온동결처리 등과의 복합처리 보다 바이러스 제거율이 떨어진다(Hu et al. 2015b; Zhao et al. 2018). 따라서 더욱 효율적인 무병화 시스템을 개발하기 위해서는 높은 열처리 온도에서 신초 생장이 가능한 시스템 개발이 수행되어야 할 것이다.

적 요

사과는 국내 과수산업에서 가장 많이 재배되고 있는 과종이다. 하지만 apple mosaic virus (ApMV), apple stem grooving capillovirus (ASGV), apple stem pitting virus (ASPV), apple chlorotic leaf spot virus (ACLSV), apple scar skin viroid (ASSVd) 와 같은 바이러스 및 바이로이드에 감염되면 과실의 수확량 감소 및 품질 저하를 야기시킨다. 본 연구에서는 국내 사과 농가에서 가장 많이 감염되어 있는 ASGV 바이러스를 제거하기 위한 효율적인 무병화 시스템을 확립하고자 하였다. ASGV에 감염된 폿트묘를 36°C, 38°C, 40°C가 유지되는 항온·항습장치에서 4주간 열처리를 수행하였으며, 신초 생장율과 바이러스 제거율을 조사하였다. 신초 생장률은 36°C 처리구에서 가장 높았으며 신초의 중간부와 상단부는 바이러스가 제거되었으나 하단부는 바이러스가 제거되지 않았다. 38°C, 40°C 처리구는 신초의 모든 구간에서 바이러스가 제거되지 않았으며, 40°C 처리구는 신초의 생장 없이 열처리 3주 후 고사되었다. 36°C 온도에서 열처리된 폿트묘의 경정을 절취하여 기외에서 접목하였으며 94%의 생존율과 20%의 바이러스 제거율을 보였다. 따라서 열처리 및 경정 접목을 통해 무병묘 생산이 가능할 것으로 판단되었다.

사 사

본 연구는 농림축산식품부의 재원으로 농림식품기술기획평가원의 작물바이러스 및 병해충 대응 산업화 기술개발사업의 지원을 받아 연구되었음(N0. 320040-05).

References
  1. Akbaş B, Ilhan D (2005) Widespread distribution of Apple mosaic virus on apple in Turkey. Plant Dis 89:1010-1010
    Pubmed CrossRef
  2. Cembali T, Folwell RJ, Wandschneider P, Eastwell KC, Howell WE (2003) Economic implications of a virus prevention program in deciduous tree fruits in the US. Crop Protection 22:1149-1156
    CrossRef
  3. Cooper VC, Walkey D (1978) Thermal inactivation of Cherry leaf roll virus in tissue cultures of Nicotiana rustica raised from seeds and meristem‐tips. Ann Appl Biol 88:273-278
    CrossRef
  4. Dĩaz-Barrita A, Norton M, Martĩnez-Peniche R, Uchanski M, Mulwa R, Skirvin R (2008) The use of thermotherapy and in vitro meristem culture to produce virus-free ‘Chancellor’ grapevines. Int J Fruit Sci 7:15-25
    CrossRef
  5. Dobránszki J, da Silva JAT (2010) Micropropagation of apple—a review. Biotechnol Adv 28:462-488
    Pubmed CrossRef
  6. Hansen A (1988) Chemotherapy of plant virus infections. In: New Vaccines and Chemotherapy. Springer, pp.285-299
    CrossRef
  7. Hansen A, Lane W (1985) Elimination of apple chlorotic leafspot virus from apple shoot cultures by ribavirin. Plant Dis 69:134-135
  8. Howarth CJ (2005) Genetic improvements of tolerance to high temperature. Abiotic stresses: plant resistance through breeding and molecular approaches. Howarth Press Inc., New York pp.3-18
  9. Hu G, Dong Y, Zhang Z, Fan X, Ren F (2019) Elimination of apple necrosis mosaic virus from potted apple plants by thermotherapy combined with shoot-tip grafting. Sci Hortic 252: 310-315
    CrossRef
  10. Hu G-J, Zhang Z-P, Dong Y-F, Fan X-D, Ren F, Zhu H-J (2015a) Efficiency of virus elimination from potted apple plants by thermotherapy coupled with shoot-tip grafting. Australas Plant Pathol 44:167-173
    CrossRef
  11. Hu G, Dong Y, Zhang Z, Fan X, Ren F, Zhou J (2015b) Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell, Tissue Organ Cult 121: 435-443
    CrossRef
  12. James D (2008) Apple stem grooving virus. Characterization, Diagnosis and Management of Plant Viruses. 2:37-53
  13. Jelkmann W, Paunovic S (2011) Apple stem pitting virus. Virus and virus-like diseases of pome and stone fruits:35-40
    CrossRef
  14. Kim DH, Kim HR, Heo S, Kim SH, Kim MA, Shin IS, Kim JH, Cho KH, Hwang JH (2010) Occurrence of apple scar skin viroid and relative quantity analysis using real-time RT-PCR. Res Plant Dis 16:247-253.
    CrossRef
  15. Knapp E, da Câmara Machado A, Pühringer H, Wang Q, Hanzer V, Weiss H, Weiss B, Katinger H, da Câmara Machado ML (1995) Localization of fruit tree viruses by immuno-tissue printing in infected shoots of Malus sp. and Prunus sp. J Viro Methods 55:157-173
    CrossRef
  16. Lee GS, Kim JH, Kim HR, Shin IS, Cho KH, Kim SH, Shin JH, Kim DH (2013) Production system of virus-free apple plants using heat treatment and shoot tip culture. Res Plant Dis 19:288-293
    CrossRef
  17. Lee SK, Cha J-S, Kwon YS, Lee YS, Yoo SE, Kim J-H, Kim DE (2020) Occurrence Status of five apple virus and viroid in Korea. Res Plant Dis 26:96-102
    CrossRef
  18. Massart S, Jijakli M, Kummert J (2011) Apple stem grooving virus. Virus and Virus-Like Diseases of Pome and Stone Fruits pp.29-33
    CrossRef
  19. Menzel W, Jelkmann W, Maiss E (2002) Detection of four apple viruses by multiplex RT-PCR assays with complification of plant mRNA as internal control. J Virol Method 99:81-92
    CrossRef
  20. Nisar A (2013) Apple stem grooving virus-a review article. Int J Modern Plant Anim Sci 1:28-42
  21. Panattoni A, Luvisi A, Triolo E (2013) Elimination of viruses in plants: twenty years of progress. Span J Agric Res 11:173-188
    CrossRef
  22. Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M (2008) Results of in vitro thermotherapy of apple cultivars. Plant Cell, Tissue Organ Cult 94:347-352
    CrossRef
  23. Paunovic S, Ruzic D, Vujovic T, Milenkovic S, Jevremovic D (2007) In vitro production of Plum pox virus-free plums by chemotherapy with ribavirin. Biotechnol Equip 21:417-421
    CrossRef
  24. Skiada F, Grigoriadou K, Maliogka V, Katis N, Eleftheriou E (2009) Elimination of Grapevine leafroll-associated virus 1 and Grapevine rupestris stem pitting-associated virus from grapevine cv. Agiorgitiko, and a micropropagation protocol for mass production of virus-free plantlets. J Plant Pathol 91:177-184
  25. Uchanski M, Skirvin R, Norton M (2004) The use of in vitro thermotherapy to obtain Turnip mosaic virus-free horseradish plants Acta Hort 631:175-179
    CrossRef
  26. Vivek M, Modgil M (2018) Elimination of viruses through thermotherapy and meristem culture in apple cultivar ‘Oregon Spur-II’. VirusDisease 29:75-82
    Pubmed KoreaMed CrossRef
  27. Wang Q, Panis B, Engelmann F, Lambardi M, Valkonen J (2009) Cryotherapy of shoot tips: a technique for pathogen eradication to produce healthy planting materials and prepare healthy plant genetic resources for cryopreservation. Ann Appl Biol 154:351-363
    CrossRef
  28. Yanase H (1974) Stuidies of apple latent viruses in Japan. Bull Fruit Tree Res Stn Jpn Ser C 1:47-109
  29. Zhao L, Wang M-R, Cui Z-H, Chen L, Volk GM, Wang Q-C (2018) Combining thermotherapy with cryotherapy for efficient eradication of Apple stem grooving virus from infected in-vitro-cultured apple shoots. Plant Dis 102: 1574-1580
    Pubmed CrossRef


September 2022, 49 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM