search for




 

Enhanced biosynthesis of artemisinin by environmental stresses in Artemisia annua
J Plant Biotechnol 2022;49:307-315
Published online December 31, 2022
© 2022 The Korean Society for Plant Biotechnology.

Kyung Woon Kim ・ Cheol Ho Hwang

(TissenBioFarm Yunghapgisulro, Heunghaeeup, Bukgu, Pohang 37563, Korea)
(Department of Crop Science and Biotechnology, Dankook University, Cheonan 31116, Korea)
Correspondence to: e-mail: sfeho@dankook.ac.kr
Received November 9, 2022; Revised November 25, 2022; Accepted November 25, 2022.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Artemisinin is a secondary metabolite of Artemisia annua that shows potent anti-malarial, anti-bacterial, anti-viral, and anti-tumor effects. The supply of artemisinin depends on its content in Artemisia annua, in which various environmental factors can affect the plant’s biosynthetic yield. In this study, the effects of different light-emitting diode (LED)-irradiation conditions were tested to optimize the germination and growth of Artemisia annua for the enhanced production of artemisinin. Specifically, the ratio between the red and blue lights in the irradiating LED was varied for investigation as follows: [Red : Blue] = [6 : 4], [7 : 3], and [8 : 2]. Furthermore, additional stress factors like UV-B-irradiation (1,395 μW/cm2), low temperature (4°C), and dehydration were also explored to induce hormetic expressions of ADS, CYP, and ALDH1, which are essential genes for the biosynthesis of artemisinin. Quantitative polymerase chain reaction (qPCR) was used to analyze the expression levels of the respective genes and their correlation with the specified conditions. [8 : 2] LED-irradiation was the most optimal among the tested conditions for the cultivation of Artemisia annua in terms of both fresh and dry weights post-harvest. For the production of artemisinin, however, [7 : 3] LED-irradiation with dehydration for six hours pre-harvest was the most optimal condition by inducing around twofold enhancement in the biosynthetic yield of artemisinin. As expected, a correlation was observed between the expression levels of the genes and the contents of artemisinin accumulated.
Keywords : Artemisia annua, Hormesis, Metabolite, Physical stress, Dehydration, UV-B, Low temperature
서 론

개똥쑥(Artemisia annua L.)의 artemisinin은 말라리아의 치료 외 항암, 기생충 감염 등 다양한 질병의 치료제로 사용되어 국제적 수요가 크다. 그러나 개똥쑥 식물체로부터 artemisinin 추출농도는 건물중의 0.01~1.4%로 낮고(Liu et al. 2006), 유전적 요인 또는 재배환경 조건에 따라 생산능력의 변이가 커서 대량생산에 어려움이 있다(Ferreira et al. 2005). 대체 방안으로 개발된 화학적 생산법은 그 과정의 복잡성으로 인해 산업화에 적용되지 못하고 있다(Geldre at al. 1997). 식물에서 artemisinin의 합성량을 높이기 위한 시도로는 유량계통의 선발, 돌연변이, 잡종강세 육종 등과 생합성 관련 유전자들의 형질전환을 통한 대사공학적 연구들이 있었다(Pandey and Pandey-Rai 2015). 그러나 고농도의 artemisinin이 식물독성으로 작용하여 뿌리의 생육을 저하하여 역으로 artemisinin의 농도를 감소시키는 악순환이 보고된 바 있다(Arsenault 2010). 이에 재배가 완료된 식물체에 수확 전 시점에 artemisinin의 농도를 증가시키는 세밀한 방식이 요구된다.

낮은 수준의 스트레스 처리로 생물에 긍정적인 효과를 유도하는 현상인 hormesis는 다양한 환경스트레스에 반응하여 식물생육 외에도 이차대사산물의 합성을 유도한다(Vargas-Hernandez et al. 2017). 저온(Yang et al. 2010), 염(Qureshi et al. 2005), 영양분 부족(Ferreira 2007), 건조(Marchese et al. 2010) 등의 처리를 통해 개똥쑥의 artemisinin 농도의 증가를 확인하려는 연구들이 있었다. 적절한 수준의 환경 스트레스의 처리로 유도된 식물의 방어기작을 목적 물질의 생합성 증진 가능성을 확인하였다. 이에 정교하게 조절된 환경스트레스 처리는 식물의 생장저해로 인한 수량감소 없이 artemisinin의 합성을 유도할 수 있다(Pandey and Pandey-Rai 2015). 물리적 처리에 의한 hormesis 유도는 재배환경 및 생산 식물체에 화학적 오염으로부터 안전하게 이차대사물의 생산 및 축적을 높이기 위한 재배생산환경 제어 방식으로 식물공장에 간편하게 적용할 수 있다.

Artemisinin 생합성 경로의 다양한 효소들 중에서 해당 유전자의 형질전환을 통한 과발현 유도 식물체에서 artemisinin 생산이 증가를 확인하였다. ADS 유전자 과발현 식물들 중에서 최대 7.65배(Alam and Abidin 2011), CYP는 FPS와 CPR과 함께 과발현하였을 때 3.6배로 artemesinin의 생산량이 증가 되었다(Chen et al. 2012). 저온, 건조, 자외선을 처리한 개똥쑥 식물체의 artemisinin 농도를 확인하였고, 동시에 ADS, CYP의 유전자의 전사체의 발현이 증가함을 확인하였다(Yang et al. 2010). 이는 식물 이차대사물의 정량방법으로 전처리에 시간과 노력 그리고 시료가 많이 요구되는 화학물의 직접적인 측정방법을 대체하여 생합성 관련 유전자들의 전사체를 정량의 대상으로 활용할 수 있다. 특별히 다양한 환경 스트레스 처리조건의 식물체들에서 대사관련 유전자 발현량과 artemisinin의 축적량의 양적 상관을 확인하여, qPCR을 통해 간접적으로 arteminin의 정량이 가능할 것이다.

Artemisinin 생합성 효소들 중에서 ADS (amorpha-4,11-diene synthase), CYP (cytochrome P450 mono-oxygenase), ALDH1 (alcohol dehydreogeanse I)는 과발현을 통한 유전공학적 방법으로 artemisinin 생합성의 주효소로 확인되었다(Lv et al. 2016; Pandey and Pandey-Rai 2015). 이외에 artemisinin 생합성이 활발한 trichome에서 3종의 유전자들의 높은 발현량과 artemisinin 생합성과의 연관성이 관찰하였다(Olofsson et al. 2012). 따라서 이들 유전자의 발현을 증가시키는 재배환경 및 스트레스 처리조건은 개똥쑥의 artemisinin 생산성을 높이는 방법으로 활용될 수 있을 것으로 기대된다.

재료 및 방법

식물재료 및 LED 재배 조건

시중에서 구입 가능한 다수의 개똥쑥 종자들 중에서 발아특성이 우수한 종자(다농, KS종묘)를 선발하여, 50구 모종판에 흩뿌리기로 파종하였다. 파종 2주 후 발아한 개체를 일정한 밀도로 포트에 이식하고, 각기 LED (Red : Blue) 6 : 4, 7 : 3, 8 : 2 광조건의 생장장에서 재배하였다. 각 생장장의 조도는 36~46 μM/m2/s (6 : 4), 29~47 μM/m2/s (7 : 3), 23~47 μM/m2/s (8 : 2)이다(Fig. 1).

Fig. 1. Growth box equipped with three different LEDs for optimal cultivation of Artemisia annua. (A-C) [Red : Blue] = (A) [6 : 4] at 36~46 μm/M2/s, (B) [7 : 3] at 2~47 μm/M2/s, and (C) [8 : 2] at 23~47 μm/M2/s

파종한 식물들은 온도 25°C, 습도 60~80%의 조건에서 16시간 광/8시간 암조건에서 재배하였다. 파종 35일 후에 수확전 hormesis 유도를 위한 스트레스 처리를 하였고, 생육조사는 일부 식물의 지상부를 수확후 생체중을 측정한 후 dry oven에서 72°C에서 42시간 동안 건조하여 건물중을 3반복으로 측정하였다. Artemisinin 생합성 유전자 발현분석과 artemisinin 정량분석에는 다농의 식물을 사용하였다.

스트레스 처리에 의한 Hormesis 유도

파종 후 35일이 생장한 식물체에 Hormesis를 유도하기 위하여 세 가지 물리처리(UV-B, Low temperature, dehydration) 조건에 각기 0, 3, 6, 9, 12시간 동안 노출시켰다. 처리가 완료된 후에는 잎을 수확하여 밀봉한 후 액체질소로 급속냉각하여 -80°C에 보관하였으며 PCR 및 Artemisinin 정량분석에 사용하였다.

UV-B처리는 6개의 UVB Broadband lamp (TL 20W/12, Philips사)를 50 cm 높이의 처리시설에 부착하여 램프로부터 30 cm 떨어진 위치의 1,395 µW/cm2 광도에서 정해진 시간 동안 식물에 조사하였다(Fig. 2-A).

Fig. 2. (A) UV-B-irradiation, (B) low incubation temperature, and (C) dehydration were applied to Artemisia annua to induce hormetic expressions of favorable genes. The UV-B lamp (1,395 µW/cm2) was placed 50 cm above the plant subjects. The plant growth chamber with fluorescent light (4711 LUX) was set at 4°C to provide a low incubation temperature. For dehydration, the plant subjects were placed in water for six hours and dried on Whatman paper. All treatments were performed for 0, 3, 6, 9, and 12 hours

저온처리는 포트를 온도 4°C, 습도 60~80%의 생장장으로 옮겨 형광등(64 μM/m2/s) 하에서 정해진 시간 동안 처리하였다(Fig. 2-B).

건조처리는 식물체를 포트에서 꺼내어 뿌리를 씻어준 후 증류수가 담긴 병에 넣어 6시간 충분한 수분을 공급한 후에 Whatman 여과지 위에 식물체를 놓고 25°C, 40%의 습도에서 정해진 시간 동안 건조하였다(Fig. 2-C).

DNA 바코드 분석

사용한 식물시료의 정확한 종 판별을 위하여 DNA 바코드 분석을 진행하였다. 식물의 잎 0.5 g에서 CTAB 방법으로 genomic DNA를 추출한 후, ITS, rbcL, matK 프라이머를 이용하여(Moon et al. 2013; White et al. 1990; Table 1) 95°C 5분(1회), 95°C 30초, 55°C (matK)와 58.9°C (rbcL) 40초, 72°C 1분(35 반복), 72°C 5분(1회)의 조건으로 PCR을 수행하였다. 증폭되지 않은 ITS는 제외하고, PCR 밴드로부터 DNA를 분리한 후 pGEM T-easy vector (Promega)에 클로닝하고 코스모진텍(사)에 의뢰하여 염기서열 분석을 수행하였다. 염기서열은 MEGA6.06 프로그램으로(Neighbor-joining, Bootstrap replication: 1,000, Kimura 2-parameter model의 설정) phylogenic tree 분석하였다.

Primer sequences for ITS, matK, and rbcL (Moon et al. 2013)

Primer sequence (5′ → 3′)
ITS F TCCGTAGGTGAACCTGCGG
R TCCTCCGCTGATTGATATGC

matK F CTATATCCACTTATCTTTCAGGAG
R AAAGTTCTAGCACAAGAAAGTCGA

rbcL F ATGTCACCACAAACAGAAAC
R TCCTTTTAGTAAAAGATTGGGCCGAG


Total RNA 추출 및 cDNA 합성

Trizol Reagent (Ambion사)를 이용하여 개똥쑥 잎 조직으로부터 RNA를 추출하고 Power cDNA Synthesis kit (iNtRON, Korea)를 이용하여 cDNA를 제작하였다.

프라이머 디자인 및 클로닝

Artemisia annua L.의 artemisinin 생합성 과정 중의 주요 효소로로 간주되는 ADS, CYP71AV1, ALDH1를 표적 유전자로 선택하여, Erum 등(2015)에서 보고한 염기배열 정보를 참고하여 ADS, CYP71AV1, ALDH1 유전자들의 프라이머를 합성하였다(Table 2). 프라이머의 최적 annealing 온도를 찾기 위하여 95°C 5분(1회), 95°C 30초, 60~75°C 40초, 72°C 1분(35 반복), 72°C 5분(회)의 조건의 gradient PCR을 수행하였다. 이후 증폭된 유전자는 pGEM-T Easy vector에 클로닝하였고, 바이오닉스(사)에서 염기서열 분석을 진행하였다.

Primer sequences used for the qPCR analysis of ADS (amorpha-4,11-diene synthase), CYP (cytochrome P450 mono-oxygenase), and ALDH1 (alcohol dehydrogenase I) genes, which are essential for the biosynthesis of artemisinin

Primer sequence (5′ → 3′)
ADS F ATTACTGGCGGTGCTAAC
R GTGCAGAGACAGCCCATT

CYP F ATTACTGGCGGTGCTAAC
R GTGCAGAGACAGCCCATT

ALDH1 F CAGGAGCTAATGGAAGTTCTAAGTCAG
R TTTCTTCCTTCGGCCACTGTTG


Real time qPCR

표적 유전자로 개똥쑥의 ADS, CYP71AV1, ALDH1 그리고 내부 대조용 유전자로 actin의 발현량을 측정하기 위해 Rotor Gene SYBR kit (Qiagen사)과 Step One Plus (Applied Biosystem사)를 이용하여 실시간 qPCR (quantitative PCR)을 수행하였다.

스트레스 처리가 완료된 식물의 RNA로부터 합성된 cDNA를 주형으로 사용하고 actin 유전자를 내부대조로 샘플 간의 차이를 보정하였다. 무처리의 대조구를 NC (negative control)로 설정하여 재배 LED 광조건과 스트레스 처리에 따른 차이를 비교하고, 표적 유전자의 발현량에서 actin의 발현량을 나누어 각 처리 간 표적 유전자들의 발현량을 보정하였다. 3종의 스트레스 처리의 3반복의 시료를 만들고, 각 시료당 2반복의 qPCR을 진행하여 총 6반복의 qPCR을 진행하였다.

Artemisinin 추출 및 정량분석

Bharati와 Sabat (2010)의 방법을 일부 변형하여 개똥쑥 잎 조직의 artemisinin을 추출하였다. 동결건조시킨 잎 0.01 g을 상온에서 막자와 막자사발을 이용하여 갈아준 뒤 100% ethanol을 1 ml 넣고 20분 동안 갈아준 후 1 ml의 ethanol을 추가한 후 시험관으로 옮겼다. 최종 농도가 3%가 되도록 TCA 용액을 넣어준 후 22,000 xg에서 10분 동안 원심분리하였다. 상층액을 얻어 최종 농도가 0.05 N이 되도록 NaOH를 넣어준 뒤 30분 후에 1/100으로 희석하여 291 nm에서 흡광도를 측정하였다.

Standard curve는 Artemisinin (Tokyo Chemical Industrial, Tokyo)을 ethanol에 녹여 위와 동일한 용액(ethanol, 3% TCA, 0.05N NaOH)에 10 m M-50 mM까지 희석하였으며 291 nm에서 흡광도를 측정하여 표준곡선(r2 = 0.9992)을 작성하여 artemisin 정량에 활용하였다.

결과 및 고찰

LED 재배조건에 따른 생장 비교

LED 6 : 4 (R : B), 7 : 3, 8 : 2의 광조건에서 35일간 재배한 개똥쑥 식물 지상부의 생체중과 건물중 모두 8 : 2에서 가장 높았고, 6 : 4에서 가장 낮았다(Fig. 3). 식물종에 따라 차이가 있으나 대체적으로 적색광과 혼합광 조건에서 청색광을 증가할 수록 지상부 건물중과 광합성 효율에 증가한다는 Massa 등(2008)의 보고와 일치하지 않았다. 이는 총량의 광원을 제한하여 청색광의 증가와 더불어 적색광이 상대적으로 줄어드는 본 실험설계에 영향을 받은 것으로 여겨진다. 대표적 엽채류인 상추에서 LED 혼합광 조건에서의 생육을 비교한 연구에서 생체중과 건물중 모두 8 : 2 조건에서 가장 높고, 6 : 4에서 가장 낮은 것으로 보고된 바 있다(Choi et al. 2014). Artemisinin 생산을 목적으로 식물공장에서 개똥쑥을 재배할 때 최고의 생체중을 생산에는 8 : 2의 광조건이 적합할 것으로 생각된다.

Fig. 3. Biomass production of Artemisia annua cultivated under different LED-irradiation conditions. [Red : Blue] = [6 : 4], [7 : 3], and [8 : 2]; FW = fresh weight; DW = dry weight

DNA 바코드 분석

시중에서 구입한 종자의 정확한 종 동정을 목적으로 식물의 잎에서 추출한 DNA를 주형으로 종간 변이가 큰 rRNA 사이의 ITS 서열(internal transcribed spacer), 인트론 제거효소 유전자, matK (maturase K), 그리고 rbcL (rubisco large subunit)를 기초한 세 종류의 프라이머를 이용하여 PCR를 해당 DNA 단편을 증폭하였다. 개똥쑥 시료의 정확한 종 판별을 위한 DNA barcode 분석에서 사용된 3종의 단편들 중에서 ITS를 제외한 matK와 rbcL에서 예상된 1.4 kb, 1.5 kb 크기의 DNA를 증폭하였다(Fig. 4). ITS의 primer는 White 등(1990)에서 인용한 곰팡이류의 ITS를 증폭시키기 위한 서열로써 개똥쑥 DNA의 증폭에 적절하지 않은 것으로 판단되었다. 증폭된 matK와 rbcL의 DNA 단편들은 클로닝 후 염기분석을 통해 해당 서열을 확인하였다.

Fig. 4. Gradient PCR was used to amplify the DNA fragments of ITS, matK, and rbcL for barcode analysis. M: 1kb DNA ladder; annealing temperatures of (a) 75°C, (b) 73.5°C, (d) 67.2°C, (f) 58.9°C, and (h) 55°C; (A) Artemisia annua KS; (B) Artemisia annua Danong

NCBI의 Artemisina annua L.의 엽록체 서열과 비교한 phylogenic tree 분석을 통해. 구입하여 사용한 2종의 개똥쑥의 matK과 rbcL 염기배열이 상호 유연관계가 가장 높았고, 그 다음으로 NCBI의 개똥쑥의 서열과 가까웠다. 이에 시중에서 구입하여 본 연구에 사용한 종자가 NCBI의 수록된 개똥쑥과 차이가 없는 개똥쑥 종자로 판단하였다(Fig. 5).

Fig. 5. Phylogenic tree analysis for (a) matK and (b) rbcL genes cloned from (A) Artemisia annua Danong and (B) Artemisia annua KS using the MEGA6.06 software

증폭된 표적 유전자 판별

PCR로 증폭된 3종의 artemisinin 생합성 유전자의 예상 밴드 사이즈인 94 bp (ADS), 107 bp (CYP71AV1), 157 bp (ALDH1)의 단편들을 확인하였다(Fig. 6). 각 단편들의 확인된 염기배열(Table 3)을 상응하는 유전자로 동정하기 위한 NCBI의 BLAST 분석을 하였다. ADS, CYP71AV1, 그리고 ALDH1 모두 각기 97%, 100%, 99%의 정확도로 개똥쑥의 amorpha-4,11-diene synthase, Cytochrome P450 mono-oxygenase, aldehyde dehydrogenase로 동정하였다. 이를 통해 3종류의 프라이머가 artemisinin 생합성의 주요 효소에 해당하는 유전자들을 증폭하는 것을 확인하였다.

The target genes were cloned and sequenced to confirm the suitability of the primer designs for ADS (amorpha-4,11-diene hase), CYP (cytochrome P450 mono-oxygenase), and ALDH1 (alcohol dehydrogenase I)

Target gene sequence (5′ → 3′)
ADS AATTACTGGCGGTGCTAACCTGCTTACAACATTCTTGTTATCTTGGCATGAGTGATATATTCACAAAAGAGTCTGTCGAATGGGCTGTCTCTGCACA

CYP CTTCCTCATCCACAATCGAATGGGCGATTTCGGAACTCATAAAGTGTCCGAAAGCAATGGAGAAAGTACAAGCGGA

ALDH1 CAGGAGCTAATGGAAGTTCTAAGTCAGCAAGCCATAAAATCAAGTTCACCAAGCTTTTTATCAATGGCGAATTTGTTGATTCTATTTCAGGAAACACTTTTGACACGATTAATCCAGCGACAGAAGAAGTGTTAGCAACAGTGGCCGAAGGAAGAAAA


Fig. 6. DNA products were amplified by gradient PCR for ADS, CYP, and ALDH1 genes. Annealing temperatures for the gradient PCR were as follows: A) 75°C, B) 73.9°C, C) 72.1°C, D) 69.2°C, E) 65.5°C, F) 63°C, G) 61.1°C, and H) 60°C. The analyzed fragment sizes of the target genes were as expected: 94 bp for ADS, 157 bp for ALDH1, and 107 bp for CYP. The fragment sizes were calculated based on the 1kb DNA ladder marker

3종 물리 처리에 따른 형태적 변화

파종 후 35일간 3종의 LED 조건에서 재배한 개똥쑥 식물체에 3종의 스트레스 처리를 3, 6, 9, 12시간 처리한 후 재배 광조건에 따른 식물의 형태적 차이는 보이지 않았으나, 스트레스 처리 후 차이를 보였다. 3시간 처리시 시각적으로 큰 차이를 보이지 않았지만, UV-B 처리에서만 잎의 색이 짙어지고, 엽면적이 감소하였다. 저온처리는 9시간 처리까지 큰 차이가 보이지 않고, 12시간에 가까워지면 잎이 건조하게 보이며 두께가 얇아졌다. 건조처리는 시간이 지남에 따라 뿌리가 마르고 잎도 함께 수분이 사라지는 것을 확인할 수 있으며, 12시간에 가까워질수록 뿌리는 완전히 수분이 사라져 마른 상태가 되었고 잎은 수분이 약간 남아있으나 두께가 얇아졌다(Data not shown).

식물은 스트레스에 대한 반응으로 다양한 형태적 변화를 유도하는데, 이는 단순히 생장의 정지 외에도 생장요소들의 재분배를 유도하여 잎의 면적이 감소하고 엽록소 함량이 감소하며 줄기의 두께가 증가하는 변화를 보인다(Pasternak et al. 2005). 식물에 가해진 스트레스의 정도를 엽면적의 변화로 예측할 때 3종의 스트레스 처리는 모두 식물 생장에 영향을 주는 스트레스로 작용했다. 특별히 3종 모두 공통적으로 식물체내 산화적 스트레스를 증대하는 것으로 식물의 노화를 유도한다(Yang et al. 2010). 건조처리는 가장 큰 형태적 변화를 초래하여 처리 후에도 식물조직이 회복이 불가능한 상태였다. UV-B 처리에서는 기본적인 식물의 형태를 유지하지만 처리시간이 지날수록 급격하게 엽색이 짙어지고 잎 면적이 감소하였다. 저온처리는 형태적으로 나타나는 변화가 가장 적으며 수분의 감소는 저온처리용 생장장의 낮은 습도로 기인하는 것으로 판단된다.

스트레스 처리에 의한 artemisinin 생합성 유전자 발현 변화

UV-B 처리시간이 길어질수록, 3종의 유전자의 발현은 유사하게 감소하였다. 예외적으로 8 : 2 광조건에서 생육한 식물에서 3시간 처리시 ADS와 CYP 유전자가 일시적으로 발현의 증가를 보였다(Fig. 7-A). 자외선 처리 3시간 이후부터 증가한 식물 잎의 형태적 피해와 ADS와 CYP 유전자의 낮은 발현량은 일치한다. 실제로 UV-B 처리 후에는 식물 잎이 색이 진해지며, 엽면적이 크게 감소하였고, ADS, CYP, ALDH1의 발현량도 감소하였다. 이는 자외선을 처리한 조건이 hormesis 유도 수준보다 높아 식물이 극복하기 어려운 정도의 스트레스로 작용하여 식물조직의 파괴한 것으로 생각된다. UV-B 처리의 경우에 3시간 이하, 저온 처리의 경우에는 3시간, 건조 처리의 경우에는 6시간 이하로 처리하는 것이 적절한 것으로 생각된다. 더 강한 스트레스를 유도할 것으로 예상되는 UV-C를 사용하여 30분간 처리하여 ADS와 CYP 유전자 발현의 증가를 보고한 연구(Lulu et al. 2008; Rai et al. 2011)와 비교하여 UV-B를 사용하여 처리시간을 연장한 본 연구에서는 해당 유전자 발현이 감소하였다. UV-B의 3시간 처리 이전에 이미 hormetic 효과가 시작하여 3시간 이후부터는 식물에 해를 가하는 수준의 스트레스로 작용한 것으로 예상된다. 실내에서 발아 후 재배한 개똥쑥을 자외선 처리한 후 포장으로 이식하여 재배한 식물에서 ADS, CYP 유전자의 발현 증가와 최대 15.7%의 artemisinin 함량의 증가를 확인한 Ray 등(2011)도 자외선 처리로 인한 생체중 감소를 포함한 다양한 생육 장애를 관찰하였다.

Fig. 7. qPCR analysis of the target gene expressions upon stresses of (A) ultraviolet light-irradiation (UV), (B) low incubation temperature (LT), and (C) dehydration (DH). The effects of no treatment control (NC; 0-h), 3-h, 6-h, 9-h, and 12-h treatments were investigated under the specified conditions

저온처리 후 ADS와 CYP의 발현은 처리 3시간에 증가하고 이어서 감소하였다. ALDH1는 8 : 2 광조건에서 생육한 식물에서 스트레스 처리 이전에 높은 수준의 발현을 보였다. 7 : 3 광조건에서 생육한 식물은 3, 6시간에 모든 유전자들의 발현이 증가한 후 감소하는 경향을 보였다(Fig. 7-B). Yang 등(2010)이 4°C에서 24시간 저온 처리한 개똥쑥에서 ADS는 14.2 배, CYP는 3.7배 발현량의 증가를 관찰한 결과에 비해 낮은 수준으로 저온처리 시간을 연장하는 것이 필요할 것 같다.

건조처리한 식물에서 3종 유전자들의 발현은 3시간 처리에 변화가 없고, 6시간에 감소하였다가 다시 9시간에 증가하고 이후 감소하였다. 무처리 식물과 비교하여 건조처리에서는 6시간에 가장 적게 발현하였다(Fig. 7-C). 6시간의 건조처리에 의해 6.9배의 CYP 유전자 발현을 관찰한 Yang 등(2010)와 서로 불일치하는 결과로 이는 스트레스를 처리한 식물의 생육시기의 차이 등과 연관된 것으로 추정된다. 따라서 물리 처리에 따른 세 종류의 유전자의 공통적인 발현 패턴을 보면, UV-B 처리에서는 눈에 띄는 발현 증가가 없이 감소하였고, 저온 처리에서는 3시간까지 증가하며, 건조처리에서는 6시간에서 감소하였다. 저온과 건조처리에서 ADS의 발현은 3시간 처리에서 약간 증가하고 이후 감소하였고, CYP1의 발현은 7 : 3 조건에서 재배한 식물의 저온처리구를 제외하고는 6시간에서 가장 큰 감소를 보이고 이후에 다시 증가하였다(Fig 7-A). 저온처리와 건조처리에 따른 ADS 발현은 6시간에서의 감소 전에 약간 증가한 후에 감소하였고, CYP은 6시간에서 감소하고 9시간에서 다시 증가한 후 계속 그 수준을 유지하였다. 저온처리에서 ALDH1의 발현은 8 : 2 NC를 제외하고 3시간까지 약간의 증가를 보이다 6시간에 감소하고 이후에 증가하였다. 건조처리에서의 ALDH1의 발현도 유사하게 3시간에 증가하고, 6시간에 감소 후의 증가 양상을 보여, CYP의 발현과 유사한 양상을 보였다(Fig. 7-B, C).

대체적으로 3종의 유전자 모두 유사하게 3시간에는 다소 정도의 차이를 보이고, 6시간부터 감소하였다. 3종의 스트레스 처리에서 건조 스트레스만 제외하고 6시간 처리부터 3종 유전자의 발현이 감소하는 경향을 보인다. 건조처리에서만 예외적으로 6시간 처리의 감소 이후 9시간에 일시적 증가를 보였다. 저온처리에서는 12시간까지의 처리에서 형태적 변화는 크게 발견할 수 없지만 3시간의 처리에서 표적 유전자의 확연한 발현 증가를 확인할 수 있다. 따라서 UV-B처리의 경우에 3시간 이하, 저온처리의 경우에는 3시간, 건조처리의 경우에는 6시간보다 짧은 시간동안 처리하는 것이 적절하다.

Artemisinin 함량 비교

자외선 처리시 6 : 4와 8 : 2 광조건의 식물에서 6시간까지 artemisinin 함량은 증가하다가 이후에 감소하였고(Fig. 8-A). 7 : 3의 식물은 6시간 전후에 증가와 감소를 보인 후 점차 증가하여 최고치에 도달하였다. 건조처리에서는 모든 광조건의 식물이 처리 6시간까지 artemisinin 함량의 점진적 증가를 보인 후 9시간의 급격한 감소 후 다시 증가하는 일치된 경향을 보였다(Fig. 8-C). 본 연구 결과를 바탕으로 7 : 3 광조건에서 재배한 식물을 수확 전 6시간 건조처리하는 것이 다른 광조건의 NC와 비교하여 약 2배 증가한 최대 함량의 artemisinin를 생산하는 방법으로 생각된다. Marchese 등(2010)이 38시간의 건조처리에 의해 artemisinin 함량을 29% 증가시킨 결과에 비해 더 높은 유도효과를 관찰하였다.

Fig. 8. Relative contents of artemisinin altered in response to (A) UV-B / UVB, (B) low temperature / LT, (C) dehydration / DH, NC / no treatment control; 3, 4, 9, 12 (hours) for the treatments.

6 : 4와 8 : 2 광조건의 식물에서는 3시간 저온처리에서 artemisinin 함량이 최고로증가를 보였고, 7 : 3 식물에서는 9시간까지 유사한 수준을 유지하다가 12시간에 급격히 감소하였다(Fig. 8-B).

UV-B 처리에서 표적 유전자의 발현은 처리를 길수록 계속 감소하였으나, artemisinin의 함량은 6시간까지 증가하였다(Fig. 7-A, 8-A.). 건조 처리 6시간에 CYP과 ALDH1 유전자의 발현은 감소하고, artemisinin 함량은 3시간 후인 9시간에서 감소하였다(Fig. 7-C, 8-C). UV-B 처리와 건조처리에서 artemisinin 생합성 유전자 발현 3시간 이후 artemisinin 함량의 느리게 증가하는 현상으로 3종의 유전자의 발현과 artemisinin 합성 사이에 약 3시간의 차이가 있음을 추측할 수 있다. 그러나 저온처리에서는 ADS와 CYP의 발현이 3시간에서 증가하였고, 동시에 artemisinin 함량도 증가하였다(Fig. 7-B, 8-B). 저온처리에서 표적 유전자의 발현에서 artemisinin 합성에 이르는 시간이 상대적으로 적게 요구되었다.

Rai 등(2011)의 연구와 유사하게 hormesis를 유도하기 위한 3가지 스트레스 처리에서 artemisinin 생합성 유전자 발현은 재배 및 스트레스 처리 조건에 따라서 서로 다른 경향으로 증가하였다. 생합성 관련 유전자가 증가함에 따라 artemisinin 함량이 증가를 보고한 Pandey와 Pandey-Rai (2015)의 결과와 유사하였다. 특별히 건조스트레스 처리에서 가장 효율적인 artemisinin의 증가를 확인한 것은 수확 전 개똥쑥 식물체를 건조한 상태로 38시간 두었을 때에 식물 생체중의 손실도 없고 artemisinin 햠량을 29% 증가를 보고한 연구(Marchese et al. 2010)와 일치한다.

LED 광조건에 따른 생육량이 6 : 4에 비해 7 : 3과 8 : 2에서 더 높은 양의 지상부를 생산하였고, artemisinin 함량에서는 6 : 4와 8 : 2에 비해 7 : 3에서 상대적으로 높은 함량을 보였다. 따라서 7 : 3의 재배 광조건에서 재배한 개똥쑥이 생체중 생산과 기본적인 artemisinin 함량에서 유리한 조건으로 생각된다.

스트레스 처리 전 식물의 artemisnin 함량은 6 : 4와 8 : 2에서 비슷하고, 7 : 3에서 가장 높은 artemisinin 함량을 보였다. 7 : 3에서 가장 높은 artemisinin 함량을 보이는 조건은 건조 후 6시간이었고, 이에 상응하여 표적 유전자 발현도 3시간에서 가장 높게 발현되었다. 따라서 식물체 내 artemisinin 함량을 증가시키기 위한 hormesis 처리로 가장 효율적인 조건은 7 : 3의 조건에서 3시간 건조 처리 후 수확하는 것으로 생각된다. 추가로 다른 스트레스 처리들과 순차적으로 교차 처리를 하여 각각의 효과를 누적할 가능성을 모색한다면 더 높은 수준의 artemisinin 생산을 기대할 수 있겠다.

적 요

개똥쑥은 말라리아 등 다양한 질병의 치료물질인 artemisinin 제공하나, 식물체 내 농도가 낮고, 생산이 불안정하여 국제적 수요에 대응하지 못하고 있다. 재배환경을 인공적으로 제어하는 식물공장 시스템은 계절이나 장소에 제한 없이 약용식물의 공장식 생산체계가 가능하다(Kim 2010). 본 연구에서는 식물공장에서 개똥쑥의 artemisinin의 대량생산이 가능한 최적의 조건을 찾기 위하여 파종부터 수확까지 적색광(R)과 청색광(B)을 혼합한 3종류의 LED (R : B = 6 : 4, 7 : 3, 8 : 2)에서 생장 및 물질생산에 적합한 광조건을 탐색하였다. 개똥쑥의 수확 전, 1,395 µW/cm2의 UV-B, 4°C의 저온, 그리고 건조 처리로 식물에 hormesis를 유도하여 artemisinin의 생산 증가를 확인하였다. Artemisinin 생합성에 관여하는 효소들 중에서 ADS, CYP, ALDH1의 발현량을 qPCR로 측정하였고, artemisinin 정량을 통해 전사체와 대사물질의 연관성을 확인하고, artemisinin 생산에 적합한 재배 광조건과 hormesis 처리 조건을 탐색하였다.

3종의 LED 비율 중 8 : 2에서 높은 생체중 및 건물중을 생산했으며, hormesis를 유도하기 위한 3종의 물리 처리에서 이를 통해 7 : 3 식물을 수확전 6시간 건조처리했을 때 artemisinin 함량이 약 2배 증가하였다.

사 사

본 연구는 IPET ARC 지원사업(단국대 천연물 신의약소재 산업화 연구센터)의 일부로 수행되었습니다.

References
  1. Alam P, Abdin MZ (2011) Over-expression of HMG-CoA reductase and amorpha-4,11-diene synthase genes in Artemisia annua L. and its influence on artemisinin content. Plant Cell Rep 30:1919-1928
    Pubmed CrossRef
  2. Arsenault PR, Vail DR, Wobbe KK, Weathers PJ (2010) Effect of sugars on artemisinin production in Artemisia annua L.: transcription and metabolite measurements. Molecules 15:2302-2318
    Pubmed KoreaMed CrossRef
  3. Bharati A, Sabat SC (2010) A spectrophotometric assay for quatification of artemisinin. Talanta 82:1033-1037
    Pubmed CrossRef
  4. Chen Y, Shen Q, Wang Y, Wang T, Wu S, Zhang L, Lu X, Zhang F, Jiang W, Qiu B, Gao E, Sun X, Tang K (2012) The stacked overexresssion of FPS, CYP71AV1 and CPR genes leads to the increase of artemisinin level in Artemisia annua L. Plant Biotech Rep 7:287-295
    CrossRef
  5. Choi MK, Back GY, Kwan SJ, Yoon YC, Kim HT (2014) Effect of LED light wavelength on growth, vitamin C and anthocyanin contents. Protect Horti and Plant Factory 23(1):19-25
    CrossRef
  6. Erum D, Cusido RM, Palazon J, Estrada KR, Bonfill M, Mirza B (2015) Enhanced artemisinin yield by expression of rol genes in Artemisia annua. Malaria J 14:424
    Pubmed KoreaMed CrossRef
  7. Ferreira JF (2007) Nutrient deficiency in the production of artemisinin, dihydroartemisinic acid, and artemisinic acid in Artemisia annua L. J Agric Food Chem 55(5):1686-1694
    Pubmed CrossRef
  8. Ferreira JFS, Laughlin JC, Delabays N, Magalhaes PM (2005) Cultivation and genetics of Artemisia annua for increased production of the anti-malarial artemisinin. Plant Gen Res 3:206-229
    CrossRef
  9. Geldre EV, Vergauwe A, Eekhout EV (1997) State of the art of production of antimalarial compound artemisinin in plants. Plant Mol Biol 33:199-209
    Pubmed CrossRef
  10. Kim JH (2010) Trend and direction for plant factory system. J Plant Biotech 37:442-455
    CrossRef
  11. Liu C, Zhao Y, Wang Y (2006) Artemisinin: current state and perspectives for biotechnological production of an antimalarial drug. Appl Microbiol Biotechnol 72(1):11-20
    Pubmed CrossRef
  12. Lulu Y, Chang Z, Ying H, Ruiyi Y, Qingqing Z (2008) Abiotic stress-induced expression of artemisinin biosynthesis genes in Artemisia annua L. Chinese J of App and Env Biol 14(1):1-5
  13. Lv Z, Zhang F, Pan Q, Fu X, Jiang W, Shen Q, Yan T, Shi P, Lu X, Sun X, Tang K (2016) Branch pathway blocking in Artemisia annua is a useful method for obtaining high yield artemisinin. Plant & Cell Physiology 57(3):588-602
    Pubmed CrossRef
  14. Marchese JA, Ferreira JFS, Rehder VLG, Rodrigues O (2010) Water deficit effect on the accumulation of biomass and artemisinin in annual wormwood (Artemisia annua L., Asteraceae). Braz J Plant Physiol 22(1):1-9
    CrossRef
  15. Massa GD, Kim H-H, Wheeler RM, Mitchell CA (2008) Plant productivity in response to LED lighting. Hort Sci 43(7):1951-1956
    CrossRef
  16. Moon BC, Lee YM, Ji Y, Choi G, Chun JM, Kim HK (2013) Molecular authentication and phylogenetic analysis of plant species for Breeae and Cirsii herba based DNA barcodes. Kor J Herbology 28:75-84
    CrossRef
  17. Olofsson L, Lundgren A, Brodelius PE (2012) Trichome isolation with without fixation using laser microdissection and pressure catapulting followed by RNA amplification: Expression of genes of terpene metabolism in apical and sub-apical trichome cells of Artemisia annua L. Plant Science 183:9-13
    Pubmed CrossRef
  18. Pandey N, Pandey-Rai S (2015) Updates on artemisinin: an insight to mode of actions and strategies for enhanced global production. Protoplasma 253:15-30
    Pubmed CrossRef
  19. Pasternak T, Rudas V, Potteers G, Jansen MAK (2005) Morphogenic effects of abiotic stress: reorientation of growth in Arabidopsis thaliana seedlings. Environ and Exp Botany 53:299-314
    CrossRef
  20. Qureshi MI, Israr M, Abdin MZ, Iqbal M (2005) Responses of Artemisia annua L. to lead and salt-induced oxidative stress. Environ Exp Bot 53:185-193
    CrossRef
  21. Rai R, Meena RP, Smita SS, Shukla A, Rai SK, Pandey-Rai S (2011) UV-B and UV-C pre-treatments induce physiological changes and artemisinin biosynthesis in Artemisia annua L.-an antimalarial plant. J of Photochem and Photobiol B: biol 105(3):216-225
    Pubmed CrossRef
  22. Vargas-Hernandez M, Macias-Bobadilla I, Guevara-Gonzalez RG, Romero-Gomez S de J, Rico-Garcia E, Ocampo-Verazquez RV, Alvarez-Arquieta L de L, Torres-Pacheco I (2017) Plant hormesis management with biostimulants of biotic origin in agriculture. Front in Plant Sci 8:1762
    Pubmed KoreaMed CrossRef
  23. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols:. A Guide to Meth and Appl 18:315-322
    CrossRef
  24. Yang R-Y, Zeng X-M, Lu Y-Y, Lu W-J, Feng L-L, Yang X-Q, Zeng Q-P (2010) Senescent leaves of Artemisia annua are one of the most active organs for overexpression of artemisinin biosynthesis responsible genes upon burst of singlet oxygen. Planta Med 2010 76:734-742
    Pubmed CrossRef


December 2022, 49 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM