search for




 

Genotype analysis of genes involved in increasing grain number per panicle in rice germplasm
J Plant Biotechnol 2017;44:356-363
Published online December 31, 2017
© 2017 The Korean Society for Plant Biotechnology.

Dongjin Shin*, Tae-Heon Kim*, Ji-Yoon Lee, Jun-Hyun Cho, Jong-Hee Lee, You-Chun Song, Dong-soo Park, and Myeong-Kyu Oh

Department of Southern Area Crop Science, National Institute of Crop Science, RDA, Miryang, 50424, Korea,
Research Policy Bureau, RDA, Jeonju, 54875, Korea
Correspondence to: e-mail: jacob1223@korea.kr
Received November 7, 2017; Revised November 13, 2017; Accepted November 13, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

ARice is an important staple food in the world and rice yield is one of the main traits for rice breeding. Several genes involved in increasing the yield have been identified through map-based gene cloning within natural variations in rice. These identified genes are good targets for introducing a genetic trait in molecular breeding. Here, we chose five genes reported to be involved in increasing grain number per panicle in rice; Gn1a, dep1, Apo1, Ghd7, and Nal1. We developed In/Del markers for Gn1a, and dep1, Apo1, and applied the reported SNP markers for Ghd7 and Nal1. We were easily able to examine the genotype of each gene on agarose gel. We tested the genotypes on 479 rice resources that we held with evaluated molecular markers. According to the genotype of each gene, rice resources were divided into 13 haplotypes, and most of the Indica and Japonica varieties were included in haplotypes 1 and 13, respectively. When we examined the effect of each gene on grain number per panicle and panicle number per plant, panicle number per plant in the yield negative allele group for each gene was reduced by approximately 0.3 to 0.8 compared to that in the yield positive allele group. However, the number of yield positive alleles for each gene was higher by about 21 to 27 grains per panicle than that of yield negative alleles. Although most of the varieties were grouped in haplotypes 1 and 13, we believe that this genotype information with evaluated molecular markers will be useful in rice breeding for increasing the yield with grain number per panicle.

Keywords : Rice, Grain number per panicle, Yield, Molecular marker
서언

벼는 약 50%의 세계 인구가 주식으로 이용하는 중요한 작물로서 증가하는 세계 인구의 식량 문제를 해결하기 위하여 단위면적당 벼 수량 증가가 중요한 문제로 대두되었다(Ikeda et al. 2013). 최근에는 아시아뿐 아니라 아프리카에서도 벼의 소비가 확대되고 있어 벼 수량성 향상이 더욱 필요할 것으로 예상된다(Van Ittersum et al. 2016). 수량성이 높은 벼 품종 개발을 위한 방법으로 수량구성요소(yield component)를 향상시킬 수 있는 유전자에 대한 연구가 세계적으로 활발히 진행되었다. 지난 10여년 동안 수량구성요소 중 수당립수(grain number per panicle)와 천립중(1,000-grain weight, TGW)을 조절하여 수량을 증진시킬 수 있는 유전자들이 20여종 보고되었다(Huang et al. 2009;, Ashikari et al. 2005; Wang et al. 2015b; Wang et al. 2012). 특히, Gn1a (Grain number 1a, Cytokinin oxidase 2) 및 dep1(DENSE AND ERECT PANICLE1), Nal1(Narrow leaf1), SCM2(STRONG CULM2), Ghd7(Grain number, plant height, and heading date7) 유전자들은 수당립수를 증진시켜 수량성이

향상되는 것으로 알려졌다(Ashikari et al. 2005; Huang et al. 2009; Ookawa et al. 2010; Xue et al. 2008; Fujita et al. 2013).

Gn1a는 cytokinin을 분해하는 cytokinin oxidase/dehydrogenase 효소로 품종간의 자연변이(natural variation)를 통해 벼 수량성을 향상 시킬 수 있는 최초의 유전자로 보고되었다(Ashikari et al. 2005). Habataki 품종에서 유래된 Gn1a 대립유전자형은 염기서열의 변화로 Koshihikari 품종에서 유래된 gn1a 대립유전자형보다 유전자 발현이 낮아 식물체내 cytokinin의 함량이 높고 벼 이삭의 1차지경 수가 증가된다. 특히, Koshihikari 품종에 Habataki 품종에서 유래된 Gn1a 대립유전자형이 도입된 근동질계통(near isogenic line)의 경우 수당립수가 약 45% 증가하였다(Ashikari et al. 2005). 현재까지 22 종류의 Gn1a 유전자 대립유전자형이 존재하는 것으로 보고되었으며, 5’-UTR 영역의 16bp와 1번 엑손(exon)의 12bp이 결실(deletion)된 대립유전자형의 유전자원이 수당립수가 가장 많은 것으로 알려졌다(Wang et al. 2015a). 또한 CRISPR/Cas9 시스템을 이용한 Gn1a 유전자의 인위적인 돌연변이를 통해 수당립수가 증가되었다(Li et al. 2016).

dep1은 이삭이 직립형(erect-type)이며 수당립수가 많은 Shennong 265 품종에서 수량성을 증진시키는 G protein γ subunit homolog 유전자로 보고되었다(Huang et al. 2009). Shennong 265 품종에서 유래된 dep1 대립유전자형은 DEP1 대립유전자형의 염기서열과 비교하여 5번 엑손에서 637bp가 결실되고 12 bp가 삽입되어 조기 종결(premature stop)된다. Dep1은 질소의 흡수와 대사를 조절하는 기능으로 보고되었으며, 열성인 dep1 대립유전자형이 우성 Dep1 대립유전자형보다 glutamine 합성 활성이 강하며, 질소 동화 효율이 높아 수확지수가 향상 되었다(Sun et al. 2014). 보고된 다른 수량증진 유전자와는 달리 열성인 dep1 대립유전자형이 도입된 근동질계통은 이삭의 절간이 짧아 지고 2차 지경의 수가 증가하여 수당립수가 증가하는 표현형을 나타낸다(Huang et al. 2009). dep1 근동질계통은 식물체당 이삭 수와 천립중이 일부 감소하나, 수당립수가 약 2배정도 증가되어 전체 생산성이 향상된다. 최근 보고에 따르면 중국의 Japonica 품종에서 DEP1 유전자는 7 종류의 대립유전자형이 존재하며 수량성이 높은 직립형의 품종 72종은 dep1 대립유전자형을 보유하고 있다(Zhao et al. 2016).

줄기의 강도를 증가시켜 도복에 강한 유전자로 보고된 APO1/SCM2 (ABERRANT PANICLE ORGANIZATION1/STRONG CULM2)은 F-box-containing protein으로 꽃 화기 발달을 조절하는 애기장대 UFO의 상동유전자(ortholog)이다(Ikeda-Kawakatsu et al. 2012; Ookawa et al. 2010). Koshihikari 품종에 Habakaki 유래 APO1/SCM2 대립유전자형이 도입된 근동질계통(NIL-APO1/ SCM2)은 이삭 수의 변화 없으며, 이삭의 2차 지경이 발달되어 수당립수가 증가한다(Ookawa et al. 2010). Habakaki 유래 APO1/SCM2 대립유전자형이 Koshihikari 유래 apo1/scm2 대립유전자형보다 발현이 2~3배 높은 것으로 알려져 있다. Rashid 등 (2016)의 연구에 따르면 APO1/SCM2 유전자는 7종의 대립유전자형으로 분류되었다. 특히, 일본의 대부분 품종은 APO1/SCM2-5의 대립유전자형을 가지고 있으며, 대부분의 Indica 품종은 APO1/SCM2-4의 대립유전자형을 보유하고 있는 것으로 보고되었으며, APO1/SCM2 -4와 APO1/SCM2-5 대립유전자형간의 3번 엑손의 T/C SNP 염기서열 차이가 도복저항성에 중요하다라고 알려져 있다.

Ghd7은 CCT domain을 가진 단백질로 장일조건에서 발현이 증가되어 출수기 를 지연하며 초장(plant height) 및 이삭 길이(panicle length) 신장을 조절하는 다면발현 유전자(pleiotropic gene)이다(Xue et al. 2008). Minghui 63 품종에서 유래한 Ghd7-1 대립유전형이 도입된 근동질계통은 출수기는 지연되지만 이삭이 길어져 수당립수가 많다. Lu 등은 8종의 Ghd7 유전자에 대한 대립유전자형이 존재하며, 프로모터의 C/T 돌연변이(S_555)는 식물체의 키와 연관 되어 있으며 다른 7개의 SNP 염기서열 변이는 수당립수 조절에만 연관하여 기능한다고 보고하였다(Lu et al. 2012). 또한 Ghd7Ghd8(Grain number, plant height, and heading date8) 그리고 Hd1 (Heading date1)과의 유전형 조합을 통해 생태지리적 적응과 잠재수량에 영향을 주었으며, 대부분의 japonica 품종은 Ghd7-2 대립유전자형을 보유하고 있는 것으로 보고하였다(Zhang et al. 2015).

Nal1/SPIKE/GPS/LSCHL4 (Narrow leaf1/SPIKELET NUMBER/ GREEN FOR PHOTOSYNTHESIS/FLAG LEAF SHAPE AND CHLOROPHYLL CONTENT) 유전자는 돌연변이체를 이용하여 옥신 호르몬의 이동을 조절하여 벼 잎 폭(leaf width)이 성장에 영향을 주는 것으로 보고 되었나(Qi et al. 2008), 열대 자포니카 재래벼인 Daringan 유래 Nal1이 IR64에 도입된 근동질계통과 Nipponbare 유래 Nal1이 93-11에 도입된 근동질계통은 수당립수의 증진과 엽신과 관다발 등의 발달로 수량이 10%이상 증진되는 것으로 알려졌다(Fujita et al. 2013; Zhang et al. 2014). 최근 Nal1(SS1)과 SS2가 상호 결합하여 source/sink 전이(transition) 효율을 조절하여 수량이 향상된다고 보도되었다(Xu et al. 2015). 또한 Nal1 유전자의 기능 상실(loss-of- function) 대립유전자형은 광합성의 효율을 증가하며, 벼 수량을 증가시키는 것으로 보고되었다(Takai et al. 2013). 다른 수당립수 증진 유전자와 달리 NAL1 유전자는 Japonica 품종에서 유래하여 Indica의 수량성 증진에 유용할 것으로 고려되고 있다(Zhang et al. 2014).

벼 수량성 증진 등 육종 효율을 향상하기 위한 방법으로 분자표지(molecular marker)를 이용한 분자육종적(marker-assisted breeding) 접근이 유용한 것으로 고려되고 있다(Hu et al. 2016, Lau et al. 2015). 분자육종적 방법을 이용하기 위하여 유전형 판별이 용이한 분자표지와 형질도입을 위한 유전자원이 필요하다. 본 논문에서는 벼 수당립수 증진을 통해 수량성이 향상된다고 보고된 Gn1a 등 5종의 유전자에 대한 유전자 기반 분자표지(gene-based marker)의 유용성을 검정하였고, 이들 분자표지를 이용하여 수당립수 증진 형질 도입을 위한 벼 유전자원을 탐색하였다.

재료 및 방법

시험재료 및 수량구성요소 분석

본 시험은 밀양지역(N35゚50’)에 있는 국립식량과학원 남부작물부 시험포장에서 수행되었다. 실험재료는 국립식량과학원에서 보유하고 있는 벼 유전자원 및 품종 479점을 이용하였다. 시험재료는 5월 1일 파종하고, 30일 유묘를 이용하여 재식거리 30×15 cm로 1주 1본으로 이앙하였다. 농촌진흥청 벼 표준재배법에 준하여 재배하고 주당 수수 및 수당립수 천립중, 등숙비율(grain filling rate)을 3주씩 5반복으로 조사하였다. 수당립수는 이삭수에 총립수를 나누어 조사하였다. 등숙비율(%)는 염농도 1.04로 비중 수선한 후 완전 등숙립수를 총립수로 나누어 100%로 환산하였다. 천립중은 완전립 1,000립의 무게를 5반복으로 측정하였다(Kim et al. 2016).

Genomic DNA 추출

유전자원 487점을 이앙 후 10일(40일모) 잎을 채취하고 DNA 분리에 이용하였다. 채취한 잎을 TissueLyser II system (QIAGEN, UK)을 이용하여 분쇄하였다. Genomic DNA는 분쇄한 잎 시료에서 C-TAB buffer (2% Cetyltrimethyl ammonium bromide, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris–HCl, pH 8.0, 0.2% mercaptoethanol)을 이용하여 추출하였다.

분자표지 설계 및 대립유전자형 분석

Gn1adep1, SCM2 유전자의 염기서열은 각각 유전자 클로닝에 이용된 유전자원의 염기서열을 NCBI GenBank (www. ncbi.nlm.nih.gov/nucleotide)에서 확보하였다. BioEdit v7.2.6 (Tom Hall) 프로그램을 이용하여 각각의 유전자에 대하여 DNA 다형성 영역을 확인하고 NCBI Primer-BLAST (https://www.ncbi. nlm.nih.gov/tools/primer-blast/)을 이용하여 프라이머를 설계하였다(Table 1). Nal1Ghd7 유전자의 프라이머는 Kim 등의 연구에서 보고된 것을 이용하였다(Kim et al. 2016).

Primer list used for genotyping of each gene

 Gene Primer  Primer sequence (5’ to 3’)
Gn1aGn1a-For5‘-CACAAATTCACACACACACTGACA-3’
Gn1a-Rev5‘-AGCAGCGCGGCGATGT-3’

dep1dep1-For5‘- TAGAGTCCAAGATGGACACTTG-3’
dep1-Rev5‘- AGAACTGGAAGTTTGTAACACTC -3’

Apo1Apo1-For5‘- GACTGTTATCmTATGCATCACT-3’
Apo1-Rev5‘- GTTGTTGTCTGGGTAGCGCAACGC-3’

Ghd7Ghd7-05SNP-F5‘-TGCTTATGCGTACATCTGGAT-3’
Ghd7-05SNP-AR5‘-TGGGTTCAAGCTCTCCACAT-3’
Ghd7-05SNP-TR5‘-TGGGTTCAAGCTCTCCACAA-3’

Nal1 SPIKE-01SNP-GF 5‘-GGTTGGTTTCCTCACTAAACG-3’
SPIKE-01SNP-AF5‘-GGTTGGTTTCCTCACTAAACA-3’
SPIKE-01SNP-R5‘-ATGGGAACTAGGAAGCAGGA-3’

유전자원에서 유전자의 대립유전자형 분석을 위하여 PCR solution은 25 µl로 DNA 100ng, 프라이머 1 µmol, dNTP 20 µM, Taq DNA polymerase 1 unit (GenetBio., Korea)의 조성으로 수행하였다. PCR 조건은 94°C 30초, 58°C 30초, 72°C 30초의 사이클을 35회 반복하였다. Gn1a 유전자 증폭을 위하여 GC rich buffer (Takara, Japan)를 사용하였다. PCR 산물을 3% 아가로스젤에서 50~60분간 전기영동 한 후 UV 조명 하에서 사진을 확보였다. 확보한 전기영동 사진을 예상 PCR 산물의 크기와 비교하여 각각의 유전자에 대한 대립유전자형을 분석하였다.

결과 및 고찰

Gn1adep1, SCM2, Ghd7, Nal1 유전자 특이 분자표지 설계

아가로즈겔을 이용한 전기영동을 통하여 각각의 유전자에 대한 대립유전자형을 편리하게 판독할 수는 분자표지를 설계하였다. Gn1adep1, Apo1 유전자의 대립유전자형은 하나의 아가로즈젤에서 PCR 산물의 크기로 판독할 수 있는 In/del 분자표지를 이용하였으며, Ghd7Nal1유전자의 유전형은 SNP의 염기서열 차이를 이용하여 두개의 아가로즈젤을 이용하여 PCR의 증폭 여부로 판독이 가능한 SNP 분자표지를 이용하였다. 설계한 분자표지를 이용하여 각각의 유전자에 대한 대립유전자형 검정이 가능하지를 검정하기 위하여 일미, 일품 등 자포니카형 품종 5점과 IR64, IR72 등 인디카형 3점, 그리고 통일형 품종인 다산벼, 한아름벼을 선발하여 PCR 산물을 아가로즈겔에서 전기영동하여 유전형을 검정하였다(Fig. 1).

Fig. 1.

Photograph of electrophoresis of genes reported to be involved in increasing grain number per panicle in rice. (A) Gn1a. (B) dep1. (C) Apo1. (D) Ghd7. (E) Nal1. PCR products of Gn1a and dep1, Apo1 were electrophoresed on the 3% agarose gel and the allelic variation for each gene was examined with PCR product size. Ghd7-1 allele was amplified with the Ghd7- 05SNP-F and Ghd7-05SNP-TR primer set and Ghd7-2 allele was amplified with the Ghd7-05SNP-F and Ghd7-05SNP-AR primer set. Nal1-ja allele was amplified with the SPIKE-01SNP-AF and SPIKE-01SNP-Rev primer set and Nal-in allele was amplified with the SPIKE-01SNP-GF and SPIKE-01SNP-Rer primer set. M means marker size


수당립수 증진 유전형인 Gn1agn1a 대립유전자형의 염기서열에서 5’ UTR 영역과 1번 엑손 영역에 각각 16 bp와 6 bp의 결실되어 있다. Gn1a의 유전자에서 이 결실 영역(22 bp)를 이용한 Gn1a 유전자 특이 분자표지를 설계하였다. 수당립수 증진 대립유전자형인 Gn1agn1a 대립유전자형의 예상 PCR 산물 크기는 각각 654 bp과 682 bp이다. Gn1a 유전자는 GC 비율이 68.7%로 높아 일반 PCR 조건에서는 비특이적 PCR 산물이 증폭되었으나, GC rich 버퍼을 이용한 PCR 조건에는 Gn1a 유전자가 특이적으로 증폭되었다. PCR 수행 후 PCR 산물을 아가로즈겔을 이용한 전기영동에서 각각의 대립유전자형 판독이 용이하였다(Fig. 1A).

기능 획득 돌연변이(gain-of-function mutation) 유전형인 dep1Dep1 유전형 염기서열에 중 5번 엑손에 637 bp의 결실과 12 bp가 삽입이 존재하나, 종결코돈 뒤쪽 1Kb 위치에 266 bp의 결실이 존재하여 이 부위를 이용하여 분자표지를 설계하였다. 수량증진 dep1 유전형과 대립 유전형인 DEP1의 PCR 산물 크기는 각각 179 bp와 445 bp로 아가로즈겔에서 쉽게 판독이 가능하였다 (Fig. 1B). dep1DEP1 대립유전자형의 PCR 산물 크기 차이가 커 1% 아가로즈겔에서도 판독이 가능하였다.

Apo1/SCM2 유전자의 분자표지는 프로모터 영역(-445 bp)의 12 bp의 삽입을 이용하여 설계하였다. 수량증진 Apo1 유전형과 대립유전형인 apo1의 예상 PCR 산물 크기는 각각 332 bp과 320 bp으로 3% 아가로즈겔을 이용한 전기영동으로 유전형을 판독하였다(Fig. 1C).

Nal1 유전자와 Ghd7 유전자는 대립 유전형간 다형성이 SNP로 존재하였다. Ghd7 유전자는 2번 엑손의 A/T SNP를 이용한 분자표지를 설계하였으며, Nal1 유전자는 3번 엑손의 G/A SNP를 이용한 분자표지를 각각 사용하였다(Kim et al. 2016). Ghd7Nal1 유전자의 대립유전형은 전기영동 후 각각의 프라이머 조합에 따른 PCR 증폭 여부에 따라 판독하였다. Ghd7-05SNP-F과 Ghd7-05SNP-TR 프라이머를 이용하였을 경우 수당립수 증진 Ghd7-1 대립유전형이, Ghd7-05SNP-F과 Ghd7-05SNP-AR 프라이머를 이용하였을 경우 수당립수 감소되는 Ghd7-2 대립유전형이 증폭되었다(Fig. 1D). Nal1 유전자는 Nal-japonica 대립유전형과 Nal-indica 대립유전전형이 존재하며, Nal-japonica 대립유전형이 인디카 품종의 수당립수를 증진시키는 것으로 보고되었다(Fujita et al. 2013, Zhang et al. 2014). 기존 보고와 같이 SPIKE-01SNP-GF과 SPIKE- 01SNP-R 프라이머를 이용하였을 경우 Nal-indica 대립유전전형이, SPIKE-01SNP-AF 와 SPIKE-01SNP-R 프라이머를 이용하였을 경우 Nal-japonica 대립유전형이 증폭되었다(Fig. 1E).

수당립수를 증진하는 것으로 보고된 5종의 유전자에 대한 대립유전자형을 아크릴아마이드젤을 이용한 대립유전형 판독 시스템보다 아가로즈젤을 이용하여 검정 시간이 단축 할 수 있었다. 특히, 하나의 젤에서 PCR 산물의 크기 비교 및 두개의 젤에서의 PCR 산물의 유무로 대립유전형을 판독함으로써 대량 검정이 가능하였다. 이를 이용하여 벼 수량증진을 위한 MAS 육종 현장에 적용 가능 할 것으로 기대 되었다.

수당립수 증진 유전자 5종에 대한 벼 유전자원의 대립유전자형 검정

수당립수 증진 유전자의 분자표지 개발과 더불어 해당 유전자의 수량증진 유전형을 보유한 유전자원의 정보를 확보하는 것이 중요하다. 이를 위하여 국립식량과학원 남부작물부에서 보유하고 있는 유전자원 479점에 대하여 수당립수 증진 유전자 5종에 대한 각각의 대립유전형을 분석하였다. Gn1a 유전자의 대립유전자형을 분석하였을 경우 수량증진형인 Gn1a 대립유전자형을 보유한 유전자원은 155점이였으며, 수량감소형인 gn1a 대립유전자형을 보유한 유전자원은 324점으로 확인되었다. dep1 유전자는 수량증진형인 dep1 대립유전자형을 보유한 유전자원은 138점이였으며, 수량감소형인 DEP1 유전형은 341점으로 조사되었다. Apo1/SCM2 유전자에 대한 수량증진형(Apo1)과 수량감소형(apo1) 대립유전형은 각각 150점, 329점으로 검정되었다. Ghd7 유전자는 Ghd7-1 유전형은 151점, Ghd7-2 유전형은 328점으로 분류되었다. Nal1/SPIKE 유전자는 Nal1-Indica 대립유전형과 Nal1-Japonica 유전형을 각각 175점, 304점 보유하고 있는 것으로 조사되었다.

수당립수 증진 유전자 5종의 대립유전형에 따라 유전자원의 haplotype을 분류하였다. 5종의 유전자에 따른 haplotype의 종류가 이론적으로는 총 16 가지이나, 본 논문에서 활용한 유전자원(479점)은 총 13개의 haplotype으로 나누어졌다(Table 2). 이 중 haplotype 1와 haplotype 13 그룹이 각각 133점과 291점으로 가장 많았다. 특히, 대부분의 Indica 품종은 품종 haplotype 1 그룹에 속하였고, 대부분의 Japonica 품종은 haplotype 13 그룹에 속하였다. 이 결과는 Japonica 및 Indica 아종간에 공통적인 대립유전형을 보유하고 있다는 것을 의미하며, 지금까지의 대부분의 육종이 아종 내에서의 Japonica 품종 개발을 위하여 Japonica 유전자원을 활용하였으며, Indica 품종 개발을 위하여 Indica 유전자원을 활용한 교잡 육종을 통해서 발전 하였음을 의미한다. 이들 두 haplotype을 제외한 유전형 그룹은 모두 55점으로 각각의 haplotype에 따른 유전자원은 1점에서 23점으로 Japonica 유전자원과 Indica 유전자원간에 교잡 육종을 통해 육성된 유전자원일 가능성이 높았다. 또한 이들 55점의 유전자원은 벼 육종 및 유전체 분석을 위한 유전 다양성을 위해 중요한 유전자원으로 판단되었다(Table 2).

Classification of haplotypes based on gene allelic variation. Genotype information for each gene of the variety was obtained after separating PCR products on the gel. Each variety was grouped into haploptype 1 to 13 according to the genotype combination for Gn1a and dep1 and Apo1, Ghd7, Nal1

HaplotypeGenotype  Variety name (number of variety)Grain no./panicle
Haplotype 1Gn1a + dep1 + APO1 + Ghd7-1 + Nal1-InApo, BR29, Chen Shin Ai4, Cheongcheongbyeo, Congshengla and etc (134) 142 ± 23.9
Haplotype 2Gn1a + dep1 + APO1 + Ghd7-1 + Nal1-JaD4050-S, Spike (2)131 ± 41.0
Haplotype 3Gn1a + Dep1 + APO1 + Ghd7-1 + Nal1-InMajado, NEPHUONG, P1401, PEBI HUN, SAHEL108, Suwon566 (6)132 ± 15.7
 Haplotype 4 Gn1a + Dep1 + APO1 + Ghd7-1 + Nal1-JaGillimcollection 1 (1)(173)
Haplotype 5Gn1a + Dep1 + apo1 + Ghd7-1 + Nal1-InKantoPL 12 (1)(151)
Haplotype 6Gn1a + Dep1 + apo1 + Ghd7-2 + Nal1-InDharial, EM76, Hosiaoba (3)(111 ± 16.8)
Haplotype 7Gn1a + Dep1 + apo1 + Ghd7-2 + Nal1-JaDeuraechan, Dragon Eye ball 100, EM47, Iksan581, IRBB110 and etc (9)120 ± 12.6
Haplotype 8gn1a + dep1 + APO1 + Ghd7-1 + Nal1-InChen Ma Ai, IR65192-4B-17-3, Milyang279 (3)(135 ± 21.5)
Haplotype 9gn1a + Dep1 + APO1 + Ghd7-1 + Nal1-InTetep, TN1, TW16 (3)(107 ± 11.3)
Haplotype 10gn1a + Dep1 + APO1 + Ghd7-2 + Nal1-InGia Loc 101, Rantaiemas (2)(114 ± 12.12.7)
Haplotype 11gn1a + Dep1 + apo1 + Ghd7-1 + Nal1-InNohong (1)(78)
Haplotype 12gn1a + Dep1 + apo1 + Ghd7-2 + Nal1-InBasmati389, Boseogchal, Danmi, Gwangmyeongbyeo, Hawn and etc (23)91 ± 17.0
Haplotype 13gn1a + Dep1 + apo1 + Ghd7-2 + Nal1-JaAranghyangchal, Baegjinju1, Baegogchal, Boseog, Chilbo and etc (291)115 ± 19.6

수당립수 증진 유전자의 대립유전자형에 따른 수량구성요소 특성 분석

근동질계통 및 형질전환체를 이용한 연구를 통하여 수당립수 증진 유전자 5종의 수량증진 효과가 규명되었다. 수량 형질은 양적형질로 다양한 유전자와 재배환경조건에 영향을 받는다. 또한 유전자원에서는 각각의 유전자원에 따라 해당 유전자를 제외한 유전자 다양성이 존재하며, 염색체상의 유전자의 다양성으로 해당 유전자의 효과가 각각의 유전자원에서 효과가 다르게 나타난다. 유전자원에서의 이들 수당립수 증진 유전자 5종의 수량증진 효과를 분석하기 위하여 유전형 분석에서 활용한 479점의 유전자원 중 식량과학원 남부작물부 시험포장에 정상 생육하는 396점의 유전자원 선발하고 수당립수 및 수수 등 수량구성요소를 조사하였다. Gn1a 유전자의 경우 수량증진형인 Gn1a 대립유전자형을 보유한 유전자원 155점의 평균 주당 이삭수가 수량감소형인 gn1a 대립유전자형을 보유한 유전자원 324점의 평균 주당 이삭수에 비하여 주당 이삭 수는 0.8개 감소하였으나, 각각의 대립유전자형을 보유한 유전자원의 평균 수당립수는 142.8개 ± 23.77, 115.3개 ± 19.29로 수량증진형인 Gn1a이 수량감소형인 gn1a 보다 수당립수가 27.6개 증가하였다(Table 3). Gn1a 유전자의 대립유전자형에 따른 유전자원의 등숙비율 및 천립중에는 영향을 미치지 못하는 것으로 것으로 판단되었다.

Yield positive genotype of each gene had higher grain number per panicle than yield negative genotype. Panicle number was measured at 35 to 40 days after flowering. Grain number per panicle and grain filling rate, 1,000-grain weight was observed after harvesting. Each variety of yield components was examined with 3 plants. Genotype effect of each gene on yield components was analyzed with the mean values of each variety

Gene name Genotype  Panicle no. Grain no./panicle Grain filling rate 1,000-grain weight
Gn1aGn1a12.8 ± 2.45142.8 ± 23.7784.3 ± 6.9721.0 ± 3.89
gn1a13.6 ± 2.24115.3 ± 19.2986.8 ± 6.4121.0 ± 3.04

Depdep112.9 ± 2.42144.8 ± 21.9883.6 ± 7.1521.0 ± 3.96
Dep113.6 ± 2.27115.6 ± 19.9187.0 ± 6.2521.0 ± 3.05

Apo1Apo113.0 ± 2.45143.5 ± 23.6483.6 ± 7.2220.9 ± 3.95
apo113.6 ± 2.26115.1 ± 19.0387.1 ± 6.1521.0 ± 3.01

Ghd7Ghd7-113.0 ± 2.46144.0 ± 23.3583.7 ± 7.2020.8 ± 3.96
Ghd7-213.6 ± 2.26115.1 ± 19.0587.0 ± 6.2021.0 ± 3.01

Nal1Nal1-ja13.5 ± 2.20116.3 ± 18.4787.1 ± 6.1321.0 ± 3.09
Nal1-in13.2 ± 2.57138.4 ± 27.6283.9 ± 7.1921.0 ± 3.74

dep1 유전자의 경우 수량증진형인 dep1 보유 유전자원과 수량감소형인 Dep1 보유 유전자원의 주당 이삭 수는 12.9개 ± 2.42, 13.6개 ± 2.27로 수량증진형인 dep1 대립유전자형의 유전자원 평균 주당 이삭 수가 0.7개 작았다. 하지만 수량증진형인 dep1 대립유전자형을 보유한 유전자원의 평균 수당립수는 144.8개 ± 21.98로 Dep1 보유 유전자원보다 29.2개 많았다. Apo1 유전자의 경우 수량증진형인 Apo1 대립유전자형 유전자원보다 수량감소형인 apo1 대립유전형 유전자원에 비하여 주당 이삭 수는 0.6개 감소하였으나, 수당립수는 143.5개 ± 23.64로 28.4개 증가하였다. Ghd7 유전자의 경우 수량감소형인 Ghd7-1 대립유전자형 보유 유전자원이 수량감소형인 Ghd7-2 대립유전자형 보유 유전자원에 비하여 주당 이삭 수는 0.6개 감소하였며, 수당립수는 28.9개 증가하였다. Gn1a 유전자와 같이 dep1Apo1, Ghd7 유전자들의 대립유전자형에 따라 등숙비율은 약 2.5~3.5%정도 차이를 나타내었으나, 통계적 유의성은 나타내지 않았다. 또한 천립중도 이들 유전자의 대립유전자형과는 무관하게 21.0g ± 3.95 내외로 비슷하게 조사되었다. 위 시험 결과를 바탕으로 이들 유전자들은 수수 감소 폭보다 수당립수 증가 효과가 강하여 단위면적당 벼 수량이 증진할 수 있을 것으로 예상되었다.

다른 수당립수 증진 유전자와 달리 NAL1는 Japonica 품종에서 유래하여 Indica의 수당립수 증진를 증진하는 유전자로 보고되었다(Zhang et al. 2014). 하지만 본 논문에서 검정한 396점의 유전자원의 수량구성요소를 분석한 결과 수량증진 대립유전자형으로 판단한 Nal1-japonica 보유 유전자원의 평균 주당 이삭수는 13.5 ± 2.20으로 수량감소 대립유전자형보다 0.3개 많았으며, 수당립수는 116.3 ± 18.47로 22.1개 적었다. 이 결과는 Nal1은 다른 4종의 수당립수 증진 유전자보다 수당립수 효과가 크지 않거나, 유전자원의 유전적 배경에 따라 Nal1의 수당립수 증진 효과가 차이 날 것으로 추측되었다. 이러한 가능성을 분석하기 위하여 Nal1의 대립유전자형은 다르며, 이외 4종의 수당립수 유전자의 대립유전자형이 동일한 haplotype을 이용하여 분석하고자 하였다. 각각의 haplotype중 유전자원의 수가 분석 가능한 haplotype 12과 haplotype 13을 비교하였다. 이 결과 Nal1-japonica 대립유전자형을 가지고 있는 haplotype 13의 수당립수 평균은 115 ± 19.6이였으며, Nal1-indica 대립유전자형을 가지고 있는 91 ± 17.0이였다. 이 결과를 통하여 Nal-japonica 대립유전자형이 Nal-indica 대립유전형보다 수당립수 증진에 유리할 것으로 추측할 수 있었다.

수당립수 증진 유전자 5종의 유전자 집적에 따른 유전자의 수당립수 증진 효과를 분석하고자 하였으나, 보유하고 있는 유전자원의 유전 다양성 크지않아 분석 결과의 신뢰성 확보가 어려웠다. 이들 유전자의 집적에 따른 수당립수 증진 효과를 분석하기 위하여 본 논문에서 개발된 수당립수 증진 유전자의 분자표지를 이용한 MAS를 통하여 동일한 모본에 유전자가 도입된 근동질계통의 육성이 필요하며, 근동질계통을 활용하여 유전자 집적 효과를 규명할 필요가 있다. 앞으로 검정된 수당립수 증진 유전자의 분자표지와 유전자원의 유전형 정보를 바탕으로 벼 수량성 증진 품종 개발의 육성 시간을 단축할 수 있을 것으로 기대된다.

적요

벼 수량성 증진을 위하여 수당립수 증진 유전자로 보고된 5종의 유전자에 대한 분자표지를 검정하고 유전자원 479점에서 이들의 유전자에 대한 유전형을 검정하였다. 판독이 용이한 Gn1aDEP1, Apo1 유전자의 In/del 분자표지를 각각 개발하였고 Ghd7Nal1 유전자에 대하여서는 기존 보고된 SNP 분자표지를 이용하여 편리성을 검정하였다. 이들 분자표지는 아가로즈젤에서 각각의 유전형 판독이 용이하기에 벼 수량성 향상을 위한 분자육종에 적용이 가능할 것으로 기대되었다.

유전자원 479점에서 수당립수 증진 유전자 5종의 유전형을 분석하였을 때 총 13개의 haplogype으로 분류되었다. 대부분의 Indica 품종과 Japonica 품종은 haploptype 1과 haplotype 13에 속하였다. 나머지 haplotype에 속한 55점의 유전자원은 수당립수 증진 유전자에 대한 유전다양성을 보유한 자원으로 유전체 분석 등을 위한 핵심집단으로 활용할 수 있을 것으로 판단되었다.

유전자원 396점의 수량구성요소를 비교하였을 때, Nal1을 제외한 4종의 수당립수 증진 유전자의 수량증진 대립유전자형에서 이삭 수가 0.6~0.8개/주 감소하였으나 수당립수는 이삭당 27~29개 증진되었다. Nal1 유전자는 유전적 배경에 따라 효과가 다르게 나타나며, Nal1-japonica 대립유전자형의 수당립수 증진 효과보다 Nal1-indica 대립유전자형이 감소효과가 큰 것으로 추측되었다.

앞으로 본 논문에서 검정된 수당립수 증진 분자표지 5종과 유전자원의 유전형을 정보를 바탕으로 벼 수량성 증진 육종에 활용하고자 한다.

사사

본 논문은 농촌진흥청 연구사업(세부과제명: 수량구성요소 증진 유전자 도입 통일형 벼 중간모본 개발, 세부과제번호: PJ01099901)의 지원에 의해 이루어진 것임.

References
  1. Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, Kitano H, and Matsuoka M. (2005) Cytokinin oxidase regulates rice grain production. Science 309, 741-745.
    Pubmed CrossRef
  2. Fujita D, Trijatmiko KR, Tagle AG, Sapasap MV, Koide Y, Sasaki K, Tsakirpaloglou N, Gannaban RB, Nishimura T, Yanagihara S, Fukuta Y, Koshiba T, Slamet-Loedin IH, Ishimaru T, and Kobayashi N. (2013) NAL1 allele from a rice landrace greatly increases yield in modern indica cultivars. Proc Natl Acad Sci USA 110, 20431-20436.
    Pubmed KoreaMed CrossRef
  3. Hu J, Xiao C, and He Y. (2016) Recent progress on the genetics and molecular breeding of brown planthopper resistance in rice. Rice (NY) 9, 30.
    Pubmed KoreaMed CrossRef
  4. Huang X, Qian Q, Liu Z, Sun H, He S, Luo D, Xia G, Chu C, Li J, and Fu X. (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet 41, 494-497.
    Pubmed CrossRef
  5. Ikeda-Kawakatsu K, Maekawa M, Izawa T, Itoh J, and Nagato Y. (2012) ABERRANT PANICLE ORGANIZATION 2/RFL, the rice ortholog of Arabidopsis LEAFY, suppresses the transition from inflorescence meristem to floral meristem through interaction with APO1. Plant J 69, 168-180.
    Pubmed CrossRef
  6. Ikeda M, Miura K, Aya K, Kitano H, and Matsuoka M. (2013) Genes offering the potential for designing yield-related traits in rice. Curr Opin Plant Biol 16, 213-220.
    Pubmed CrossRef
  7. Kim SR, Ramos J, Ashikari M, Virk PS, Torres EA, Nissila E, Hechanova SL, Mauleon R, and Jena KK. (2016) Development and validation of allele-specific SNP/indel markers for eight yield-enhancing genes using whole-genome sequencing strategy to increase yield potential of rice, Oryza sativa L. Rice (NY) 9, 12.
    Pubmed KoreaMed CrossRef
  8. Lau WC, Rafii MY, Ismail MR, Puteh A, Latif MA, and Ramli A. (2015) Review of functional markers for improving cooking, eating, and the nutritional qualities of rice. Front Plant Sci 6, 832.
    Pubmed KoreaMed CrossRef
  9. Li M, Li X, Zhou Z, Wu P, Fang M, Pan X, Lin Q, Luo W, Wu G, and Li H. (2016) Reassessment of the Four Yield-related Genes Gn1a, DEP1, GS3, and IPA1 in Rice Using a CRISPR/Cas9 System. Front Plant Sci 7, 377.
    CrossRef
  10. Lu L, Yan W, Xue W, Shao D, and Xing Y. (2012) Evolution and association analysis of Ghd7 in rice. PLoS One 7, e34021.
    CrossRef
  11. Ookawa T, Hobo T, Yano M, Murata K, Ando T, Miura H, Asano K, Ochiai Y, Ikeda M, Nishitani R, Ebitani T, Ozaki H, Angeles ER, Hirasawa T, and Matsuoka M. (2010) New approach for rice improvement using a pleiotropic QTL gene for lodging resistance and yield. Nat Commun 1, 132.
    Pubmed KoreaMed CrossRef
  12. Qi J, Qian Q, Bu Q, Li S, Chen Q, Sun J, Liang W, Zhou Y, Chu C, Li X, Ren F, Palme K, Zhao B, Chen J, Chen M, and Li C. (2008) Mutation of the rice Narrow leaf1 gene, which encodes a novel protein, affects vein patterning and polar auxin transport. Plant Physiol 147, 1947-1959.
    Pubmed KoreaMed CrossRef
  13. Rashid MA, Zhao Y, Zhang H, Li J, and Li Z. (2016) Nucleotide diversity, natural variation, and evolution of Flexible culm-1 and Strong culm-2 lodging resistance genes in rice. Genome 59, 473-483.
    Pubmed CrossRef
  14. Sun H, Qian Q, Wu K, Luo J, Wang S, Zhang C, Ma Y, Liu Q, Huang X, Yuan Q, Han R, Zhao M, Dong G, Guo L, Zhu X, Gou Z, Wang W, Wu Y, Lin H, and Fu X. (2014) Heterotrimeric G proteins regulate nitrogen-use efficiency in rice. Nat Genet 46, 652-656.
    Pubmed CrossRef
  15. Takai T, Adachi S, Taguchi-Shiobara F, Sanoh-Arai Y, Iwasawa N, Yoshinaga S, Hirose S, Taniguchi Y, Yamanouchi U, Wu J, Matsumoto T, Sugimoto K, Kondo K, Ikka T, Ando T, Kono I, Ito S, Shomura A, Ookawa T, Hirasawa T, Yano M, Kondo M, and Yamamoto T. (2013) A natural variant of NAL1, selected in high-yield rice breeding programs, pleiotropically increases photosynthesis rate. Sci Rep 3, 2149.
    Pubmed KoreaMed CrossRef
  16. van Ittersum MK, van Bussel LG, Wolf J, Grassini P, van Wart J, Guilpart N, Claessens L, de Groot H, Wiebe K, Mason-D'Croz D, Yang H, Boogaard H, van Oort PA, van Loon MP, Saito K, Adimo O, Adjei-Nsiah S, Agali A, Bala A, Chikowo R, Kaizzi K, Kouressy M, Makoi JH, Ouattara K, Tesfaye K, and Cassman KG. (2016) Can sub-Saharan Africa feed itself?. Proc Natl Acad Sci USA 113, 14964-14969.
    Pubmed KoreaMed CrossRef
  17. Wang J, Xu H, Li N, Fan F, Wang L, Zhu Y, and Li S. (2015a) Artificial Selection of Gn1a Plays an Important role in Improving Rice Yields Across Different Ecological Regions. Rice (NY) 8, 37.
    Pubmed KoreaMed CrossRef
  18. Wang S, Wu K, Yuan Q, Liu X, Liu Z, Lin X, Zeng R, Zhu H, Dong G, Qian Q, Zhang G, and Fu X. (2012) Control of grain size, shape and quality by OsSPL16 in rice. Nat Genet 44, 950-954.
    Pubmed CrossRef
  19. Wang S, Li S, Liu Q, Wu K, Zhang J, Wang Y, Chen X, Zhang Y, Gao C, Wang F, Huang H, and Fu X. (2015b) The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality. Nat Genet 47, 949-954.
    Pubmed CrossRef
  20. Xu JL, Wang Y, Zhang F, Wu Y, Zheng TQ, Wang YH, Zhao XQ, Cui YR, Chen K, Zhang Q, Lin HX, Li JY, and Li ZK. (2015) SS1 (NAL1)- and SS2-Mediated Genetic Networks Underlying Source-Sink and Yield Traits in Rice (Oryza sativa L.). PLoS One 10, e0132060.
    Pubmed KoreaMed CrossRef
  21. Xue W, Xing Y, Weng X, Zhao Y, Tang W, Wang L, Zhou H, Yu S, Xu C, Li X, and Zhang Q. (2008) Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat Genet 40, 761-767.
    Pubmed CrossRef
  22. Zhang GH, Li SY, Wang L, Ye WJ, Zeng DL, Rao YC, Peng YL, Hu J, Yang YL, Xu J, Ren DY, Gao ZY, Zhu L, Dong GJ, Hu XM, Yan MX, Guo LB, Li CY, and Qian Q. (2014) LSCHL4 from Japonica Cultivar, which is allelic to NAL1, increases yield of indica super rice 93-11. Mol Plant 7, 1350-1364.
    CrossRef
  23. Zhang J, Zhou X, Yan W, Zhang Z, Lu L, Han Z, Zhao H, Liu H, Song P, Hu Y, Shen G, He Q, Guo S, Gao G, Wang G, and Xing Y. (2015) Combinations of the Ghd7, Ghd8 and Hd1 genes largely define the ecogeographical adaptation and yield potential of cultivated rice. New Phytol 208, 1056-1066.
    CrossRef
  24. Zhao M, Sun J, Xiao Z, Cheng F, Xu H, Tang L, Chen W, Xu Z, and Xu Q. (2016) Variations in DENSE AND ERECT PANICLE 1 (DEP1) contribute to the diversity of the panicle trait in high-yielding japonica rice varieties in northern China. Breed Sci 66, 599-605.
    Pubmed KoreaMed CrossRef


June 2018, 45 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM