search for




 

Elimination of Grapevine fleck virus from infected grapevines ‘Kyoho’ through meristem-tip culture of dormant buds
J Plant Biotechnol 2017;44:401-408
Published online December 31, 2017
© 2017 The Korean Society for Plant Biotechnology.

Mi Young Kim, Kang Hee Cho, Jae An Chun, Seo Jun Park, Se Hee Kim, and Han Chan Lee*

Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wanju 55365, Korea
Correspondence to: e-mail: l0hc0811@korea.kr
Received October 6, 2017; Revised November 7, 2017; Accepted November 7, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Herein, we report the meristem-tip culture from dormant buds of grape ‘Kyoho’ single-infected with Grapevine fleck virus (GFkV), which is phloem-limited and transmitted by graft inoculation. We produced GFkV-free shoots without thermo- or chemotherapy using meristem-tip explants approximately 0.3 mm (73 explants) and 0.8 mm long (five explants) including shoot apical meristem, 2–5 leaf primordia, and 1–4 uncommitted primordia from dormant buds of the infected woody cuttings (stored at 4°C). Explants were cultured on Murashige and Skoog (MS) medium supplemented with 3% sucrose, 3.0 mg/L benzyladenine (BA) and 0.1 mg/L indole- 3-butyric acid (IBA). After 16 weeks of culture, shoot (10-mm long) regeneration frequency achieved from 0.3-mm explants was 4.1% and that obtained from 0.8-mm explants was 40.0%. Virus-free efficiency (expressed as the percentage of RT-PCR negative shoots regenerated) from 0.3- and 0.8-mm explants was 100% and 50%, respectively. Following in vitro multiplication, RT-PCR assays revealed identical results to assays of the first regenerated shoots. Our new methodological approach could be applied for eliminating other viruses in grapevines, as well as for producing virus-free plants in many other deciduous tree species, including fruit trees.

Keywords : Tissue culture, Meristem excision, Grapevine, Virus detection, RT-PCR
서언

포도는 주로 와인산업 때문에 지구상에서 경제적으로 가장 중요한 과수작물의 하나로 꼽히는데(Vivier and Pretorius 2002), 우리나라에서는 대개 생식용으로 생산된다(Yun & Park 2007). 포도작물은 많은 종류의 바이러스 병에 감염되는 것으로 보고되고 있어(Gambino and Gribaudo 2010) 효과적인 바이러스 제거 연구가 시급한 실정이다. 바이러스 감염주가 일단 포장에 재식되면 그 바이러스 병을 치료할 수 있는 방제법이 없기 때문에, 무병주 생산이 강력하게 요구되고 있다.

포도의 Grapvine fleck virus (GFkV)는 GLRaV-1, GLRaV-3 바이러스들과 더불어 포도 식물체의 체관에만 한정적으로 존재하는(phloem-limited) 바이러스로 접목감염을 통해서만 전염되며 종자로는 전염되지 않는다(Hewitt et al. 1972; Martelli 1993; Martelli et al. 2002). GFkV는 지표식물인Vitis rupestris에서 잎에 얼룩을 나타내는 것을 제외하곤 대부분의 Vitis 종(species)에서 증상을 드러내지 않는 잠복 감염형태로 존재하나(Martelli et al. 2002), 식물 생리학적 측면에서(Bota et al. 2014), 그리고, 대개 다른 포도 바이러스와 복합감염 되어 있을 경우에 생산량과 과실품질 측면에 부정적인 영향을 끼친다고 하였다(Cretazzo et al. 2010a; Komar et al. 2007; Kovacs et al. 2001). GFkV는 세계적으로 감염분포가 매우 넓으며, 그 감염이 지속적으로 보고되고 있는 가운데(Cretazzo et al. 2010b; Fiore et al. 2008; Kumar et al. 2013; Poojari et al. 2016), 우리나라에서도 재배되고 있는 몇몇 품종에서 감염보고가 있었다 (Kim et al. 2011; Jo et al. 2017).

포도작물에서의 바이러스 제거기술은 감염된 기내외 식물을 열처리(thermotherapy)한 후 경정배양(shoot or meristem tip culture)을 하거나(Maliogka et al. 2009; Valero et al. 2003; Skiada et al. 2009), 또는 열처리 없이 경정배양만을 이용하는(Duran-Vila 1988; Yossef et al. 2009) 전통적인 방법 이외에, 체세포 배양(somatic embryogenesis) (Gribaudo et al. 2006; Gambino et al. 2009; Borroto-Fernandez et al. 2009), 항 바이러스제(antiviral drugs)를 이용한 화학처리법(chemotherapy) (Panattoni et al. 2007; Skiada et al. 2013), 초저온 동결법(cryopreservation)(Wang et al. 2003), 경정조직 파편 배양(in vitro fragmented shoot apex culture) (Barlass 1987)법 등이 이용되었다.

GFkV 제거 기술에 관한 보고는 상당히 적은데, 지금까지 알려진 보고로는 열처리 후 경정배양법(Bota et al. 2014), 화학처리법(Guta et al. 2014)이 있었고, 경정조직 파편배양(Barlass et al. 1982; Habili et al. 1992)만이 보고되었을 뿐이다. 경정조직 파편배양은 경정 분열조직(apical meristem)이 생장하여 신초로 자란다기보다는 보다는 엽원기(leaf primordia) 절편에서 신초 재분화를 유도하는 방법으로(Barlass et al. 1982) 경정배양법과는 차이가 있다. 경정배양만으로 GFkV 제거하였다는 연구는 아직 보고되지 않았다.

본 연구에서는 포도 ‘Kyoho’ 품종에서 휴면아로부터 경정을 채취하여 배양함으로써 GFkV가 제거된 무독화 식물체를 재생하고자 하였다. 기존의 경정배양법은 왕성하게 생장하고 있는 식물체에서 경정을 절취하는 방법이지만, 본 연구에서는 포도식물체의 동절기 휴면아로부터 직접 경정을 절취하는 것으로서 휴면아에도 경정 분열조직이 존재하고, GFkV는 도관에만 존재하는 바이러스로 경정 분열조직에는 존재하지 않으며(Gosalvez-Bernal et al. 2008), 저온을 받은 휴면아는 비광합성 상태로서 도관분화가 활발하지 않아 휴면아의 경정조직은 생장 중인 식물체보다 비감염 부위가 클 것이라 예상하고 실험을 수행하였다. 이번에 개발한 바이러스 제거 방법은 경정배양에 대하여 새로운 시각으로 접근한 것으로서 향후 온대 과수작물의 무병묘 생산에 유용하게 활용될 수 있을 것이다.

재료 및 방법

식물 재료

본 연구에서는 농촌진흥청 국립원예특작과학원 온실의 포트에 생장 중인 ‘거봉’을 RT-PCR 검정을 통해 GFkV 단독감염을 확인한 2개체(#20과 #22)의 동절기 휴면아를 식물재료로 사용하였다(Fig. 1). 12월 초에 각 식물체의 경화된 줄기를 약 20~30 cm 길이로 잘라 채취한 후 4°C 저온저장고에 7주간 저장하였다가 마디에 붙어있는 휴면아를 조직배양용 메스로 도려내었다(Fig. 1A). 한 개의 휴면아는 3개의 눈으로 구성된 복합 눈으로서(three-member compound bud), 독립적으로 각각 분리되었고, 분리된 각각의 눈들은 바깥부분 큰 엽원조직(leaf primordia)들을 제거하고, 약 3~4 mm의 길이로 남긴 후(Fig. 1C), 70% 에탄올에 침지하여 약 40초간 표면살균 한 다음 멸균수로 1회 세척하였다. 이후, 클린벤치 안에서 1% 차아염소산나트륨(sodium hypochlorite)에 2~3분간 침지하여 2차 표면살균 후, 멸균수로 3회 세척하였다. 실체 현미경 하에서 조직배양용 핀셋과 메스, 그리고 일회용 주사기(5 ml)를 이용하여 표면 살균한 엽원조직 안에 위치한 경정조직(meristem-tip) (Fig. 1D)을 절취하였다.

Fig. 1.

Meristem-tip excision from dormant canes of ‘Kyoho’ grapevines. (A) Woody cuttings stored at 4°C for 7 weeks (left) and latent buds detached (right). (B) Latent bud was separated into three-member compound buds. (C) Inner leaf primordia left after removing outer ones for surface-sterilization. (D) Shoot apical meristem (indicated by an arrow) in the inner leaf primordia. (E) A freshly excised meristem-tip explant (0.3 mm) including apical dome, 2-3 leaf primordia and small portions of uncommitted primordia. (F) A freshly excised meristem-tip explant (0.8 mm) including apical dome, 3-5 leaf primordia and 2-3 uncommitted primordia. Scale bars in (A)-(B) = 1 cm, (C)-(D) = 1 mm, (E)-(F) = 0.1 mm


분열조직 절취와 신초 유도

경정조직은 길이 0.3 mm와 0.8 mm 두 가지 종류로 절취하였는데, 0.3 mm 경정조직(meristem-tip)은 생장점과(apical meristem) 2~3개의 엽원기(leaf primordia), 그리고 그 아래쪽에 있는 미분화 원기(uncommitted primordia) 일부를 포함하였고) (Fig. 1E), 0.8 mm 경정조직은 생장점, 3~5개의 엽원기, 2~3개의 미분화 원기를 포함하였다(Fig. 1F). 경정조직 절편체로부터 신초를 유도하기 위하여 절편체를 신초 유도 배지에 5~25개 씩 치상하여 배양하였다. 신초 유도 배지는 MS 배지(Murashige and Skoog 1962) 4.4 g/L, sucrose 30 g/L, benzyladenine (BA) 3.0 mg/L, 3-indolebutyric acid (IBA) 0.1 mg/L을 첨가하여 pH를 5.8로 조정한 후, plant agar 7 g/L를 첨가하여 autoclave에서 121°C로 20분간 고압 증기 살균하여 제조하였으며, 배양용기(model 310100, SPL Life Sciences, Korea) (100 mm × 40 mm)안에 50 ml씩 분주하였다. 배양환경은 낮 16/ 밤 8시간의 광주기 조건에 온도 25±2°C, 광도 10~20 μmol・m-2・s-1 하에서 16주 동안 배양하였으며, 신초(10 mm)가 재생될 때까지 계대배양하지 않았다.

신초 신장 및 증식

재생된 신초는 신장 및 증식 배지에 옮겨 약 8주간 배양하였는데, 증식배지는 MS 배지 2.2 g/L, sucrose 15 g/L, BA 3.0 mg/L, IBA 0.1 mg/L을 첨가하여 pH를 5.8로 조정한 후, plant agar 7 g/L를 첨가하여 autoclave에서 121°C로 20분간 고압 증기살균하여 제조하였다. 배양환경은 낮 16/밤 8시간 광주기 조건에서 온도 25±2°C, 광도 80 μmol・m-2・s-1을 유지하였다. 신초가 2 cm 이상 신장하면 배양용기 Incu Tissue Culture (model 310071, SPL Life Sciences, Korea) (72 mm × 72 mm × 100 mm)에 70 mL씩 분주된 배지에 치상하여 발근을 유도하는데, 발근배지는 증식배지에서 sucrose를 첨가하지 않은 것이다. 발근된 소식물체는 줄기가 7 cm이상 생장할 때까지 계대배양하지 않는다. 소식물체는 용기에서 꺼내어 뿌리부분을 물로 세척한 후 인공토양이 담긴 화분에 옮겨 심고, 식물체 위로 뚜껑을 덮어 습도를 기내 습도와 비슷하게 유지하다가 7일 동안 뚜껑을 조금씩 열어 기외에서 점차 순화시킨다.

RNA 추출 및 RT-PCR을 이용한 바이러스 진단

분석에 사용할 식물 시료 100mg을 CTAB 방법(Gambino et al. 2008)을 변형하여 total RNA를 추출하였으며, 추출된 RNA는 M-MLV reverse transcriptase (Invitrogen, USA)를 이용하여 cDNA 합성에 사용하였다. 경정조직 배양을 하기 이전에 휴면아를 채취할 포도 식물체는 cDNA를 주형으로 각 3 sets의 바이러스 특이 primer sets (Table 1)를 PCR 반응에 사용하여 어떤 바이러스에 감염되어 있는지를 확인하였으며, 감염된 휴면아의 경정조직배양을 통해 재생된 신초는 원래 감염되었던 바이러스를 다시 진단하였다. PCR에 사용한 총 20 μL의 반응액은 0.2 μM primer 1 μL, 2.5 mM dNTPs l.6 μL, 5 U TaKaRa Ex Taq polymerase (Takara Bio Inc., Japan) 0.1 μL, 10X Taq Buffer 2 μL, cDNA 1 μL, RNAase-free water 13.3 μL을 혼합하여 사용하였다. PCR 조건은 초기변성을 위해 94°C에서 2분간 반응시킨 뒤, DNA 증폭을 위한 반응(95°C에서 40초간 DNA 변성, 60°C에서 30초간 primer 접합, 72°C에서 30초간 DNA 신장)을 35회 반복하였다. 최종 신장을 위해 72°C에서 5분간 반응시킨 후 종료하였으며, 18S rRNA를 내부 대조구(internal control) 사용하여 합성된 cDNA가 RT-PCR 반응에 제대로 사용되었는지를 확인하였다. 반응이 증폭된 DNA는 1.3% agarose gel 상에서 100 V에서 30분간 전기영동 한 후, ethidium bromide로 염색하여 UV 상에서 관찰하였다.

Primer pairs used in RT-PCR assays for grapevine virus detection

Virusz  Primer sequences (5’ → 3’) Size (bp) Original accession No.
GFkVForward : TGACCAGCCTGCTGTCTCTA)179NC_003347
Reverse : TGGACAGGGAGGTGTAGGAG
GLRaV-1Forward : TCTTTACCAACCCCGAGATGA225AF195822
Reverse : GTGACGTGCTAAACGTCAACA
 GLRaV-3 Forward : TTACGGCACAAACGCTACCAG368NC_004667
Reverse : GTAGAGTAGTTCCGGTAACCTGG 
18S rRNAyForward : CGCATCATTCAAATATCTGC843DQ341382
Reverse : TTCAGCCTTGCGACCATACT

zGFkV, Grapevine fleck virus; GLRaV-1, Grapevine leafroll associated virus-1; GLRaV-3, Grapevine leafroll associated virus-3

y18S rRNA, internal control; rRNA, ribosomal RNA


바이러스 제거 효율

RT-PCR 검정으로 GFkV 단독 감염이 확인된 포도 ‘거봉’ #20, #22, 식물체의 동절기 휴면아로부터 절취한 경정조직 절편체들은 배양 8주차부터 절편체의 생존율, 버드 형성률(2 mm 이상), 신초 재생률(10 mm 이상), 바이러스 제거효율을 조사하였다. 바이러스 제거효율은 재생된 신초수에 대한 바이러스 RT-PCR negative 신초수의 백분율로 표시하였다.

결과 및 고찰

휴면아의 경정배양을 통한 신초 재생

신초 유도배지에 치상된 경정조직 절편체들은(Fig. 2A) 배양 1주일이 경과하자 부피가 팽창하면서 2주차 때부터 조직들이 갈변되기 시작하였으나, 3~16주 차에는 갈변된 조직들로부터 캘러스 유사조직이 약간 형성되다가 생장점(apical meristem)으로 추정되는 곳에서 엽원기(shoot primordia)가 생성되어 나왔다(Fig. 2B). 엽원기는 하나의 경정조직에서 1~5개가 생성되었고, 생성된 엽원기는 4주~12주 동안 생장을 지속 하다가(Fig. 2C-D), 16주 차에 10 mm 이상의 신초로 발달하였다(Fig. 2E). 16주 동안 용기 안에 배양된 절편체의 발달단계는 다양하였으며(Fig. 2F), 재생된 신초는 신장 및 증식 배지에서 왕성하게 생장하였다(Fig. 2G).

Fig. 2.

GFkV-free shoot regeneration by meristem-tip culture directly from dormant ‘Kyoho’ buds. (A) Meristem-tip explants cultured. (B) Shoot primordia emerging from greenish tissues produced by the explants. (C) Shoot primordia, from which shoot buds developed (one to several). (D) Buds continued to grow resulting in (E) shoot formation. (F) Vigorous shoots and buds growing in culture plates. (G) Shoots proliferated and elongated. Scale bars in (A)-(D) = 1 mm, (E)-(G) = 1 cm


경정배양 0.3 mm (Table 2)의 경우에는 8주 및 12주 차에 각각의 생존율이 34.2%, 39.7%이며, 12주 차에 bud 생성률이 1.4%이었다. 16주 차에는 생존율 43.8%, 버드 생성률 12.3%, 신초 재생률 4.1% 이었다. 경정배양 0.8 mm (Table 3)의 경우에는 8주 및 12주차에 각각의 생존율이 100%이며, 12주차 이후 bud 생성률이 60.0%이었다. 16주 차에는 생존율 100%, 버드 생성률 60.0%, 신초 재생률 40.0% 이었다. 두 종류의 경정조직으로부터 재생된 신초는 증식 및 신장배지에서 약 8주간 배양하여 신장된 신초들은 현재 발근 배지에서 배양 중에 있다.

Virus elimination efficiency of GFkV in in vitro shoot derived from meristem tip culture (0.3 mm) directly from dormant buds in grapevine ‘Kyoho’

Name of culture plateNo. of explants culturedSurvival rate (%)Bud formationz (%)Shoot regenerationy (%) No. of shoot regenerated (A)PCR- negative shoot (B)Virus elimination efficiency (B/A%)
After 8 weeks
A1118.20.00.0---
B1010.00.00.0---
C1136.40.00.0---
D2564.00.00.0---
E1612.50.00.0---

Total7334.2±22.5x0.0±0.00.0±0.0  ---

After 12 weeks
A1118.10.00.0---
B1020.00.00.0---
C1136.40.00.0---
D2580.00.00.0---
E166.36.30.0---

Total7339.7±28.81.4±2.80.0±0.0  ---

After 16 weeks
A1118.29.118.211100
B1030.010.00.0---
C1154.50.00.0---
D2580.024.08.022100
E166.36.30.0---

Total7343.8±29.612.3±8.84.1±8.0  33100±0.0

zbud longer than 2 mm yshoot longer than 10 mm

xMean±SE


Virus elimination efficiency of GFkV in in vitro shoot derived from meristem tip culture (0.8 mm) directly from dormant buds in grapevine ‘Kyoho’

Name of culture plateNo. of explants culturedSurvival rate (%)Bud formationz (%)Shoot regenerationy (%)No. of shoot regenerated (A)PCR- negative shoot (B)Virus elimination efficiency (B/A%)
GAfter 8 weeks
5100.00.00.0---

After 12 weeks
5100.060.00.0---

After 16 weeks
5100.060.040.02150.0

Total5100.060.040.02150.0

zbud longer than 2 mm

yshoot longer than 10 mm


휴면아로부터 경정조직을 신초 재생이나 신초 증식에 사용한 예는 아직 세계적으로 보고가 없는 것으로 본 연구가 최초이다. 포도 속(vitis) 식물들의 잠아(휴면아)는 3개의 눈으로 구성된 복합 눈으로(three-member compound bud) 각 눈은 생장점(apical meristem)으로부터 1~2개의 화서 축(inflorescence axis)이 될 수 있는 원기(anlage)가 분화되었을 때 겨울 동안 휴면상태로 있게 되며(Morrison 1991; Vasconcelos et al. 2009), 이때 생장점은 3~4개의 정도의 엽원기(leaf primordia)와 아직 분화조직이 정해지지 않은 2~3개의 미분화 원기(uncommitted primordia)를 갖는 것으로 보인다. 본 실험에서 사용한 휴면아가 바로 앞서 기술한 상태의 것을 사용한 것으로 여겨지며, 0.3 mm는 생장점을 포함하여2~3개의 엽원기와 미분화 원기의 조직 일부를, 0.8 mm는 생장점을 포함하여 3~5개의 정도 엽원기와 2~3개의 미분화 원기를 포함하였다.

휴면아의 경정조직으로부터 재생된 신초에서의 바이러스 제거효율

휴면아로부터 0.3 mm 길이의 경정조직으로부터 재생된 신초 3계통을 RT-PCR을 수행하여 바이러스를 진단한 결과, 감염주에서 진단되었던 GFkV 바이러스가 계통 모두에서 진단되지 않아(RT-PCR negative) (Fig. 3) 경정조직 배양으로 인한 바이러스 제거율은 100%로 나타났다(Table 2). 한편, 경정조직의 길이가 0.8 mm인 절편체로부터 재생된 신초 2계통을 진단한 결과, 감염주에서 진단되었던 GFkV 바이러스가 신초 1계통에서 진단되어(Fig. 4) 바이러스 제거율은 50.0%로 나타났다(Table 3). 두 가지 길이의 경정조직으로부터 재생된 신초 계통들을 약 8주간 배양하여 증식한 후, 다시 진단하여도 동일한 결과를 얻었다.

Fig. 3.

Virus detection of GFkV by RT-PCR in infected plants and regenerated shoots after meristem-tip culture (0.3 mm) from the infected plants. M, molecular DNA marker (100bp); P, positive control; N, negative control; #20 and #22, infected plants; MR1-MR3, regenerated shoots derived from meristem-tip culture (0.3 mm) directly of the dormant buds of the infected plants. No amplified bands of the virus were present in all regenerated shoots


Fig. 4.

Virus detection of GFkV by RT-PCR in infected plants and regenerated shoots after meristem-tip culture (0.8 mm) from the infected plants. M, molecular DNA marker (100 bp); P, positive control; N, negative control; #20 and #22, infected plants; MR4-MR5, regenerated shoots derived from meristem-tip culture (0.8 mm) directly from the dormant buds of the infected plants. MR4, one of the regenerated shoots was weakly positive for the virus (outlined by the red square)


일반적으로 생장점에는 도관이 분화하지 않으므로, 생장점 또는 경정배양이 체관에만 존재하는 바이러스를 제거하는데 효과적이지만(Panattoni and Triolo 2010), GFkV가 체관에 한정적으로 존재하는 바이러스임에도 불구하고, 경정배양만으로 GFkV를 제거하였다는 것은 아직 보고되지 않았다. 지금까지 경정배양이라 함은 왕성하게 생장하고 있는 식물체에서 경정을 절취하여 배양하는 것으로, 본 연구진이 휴면아로부터 직접 경정을 바로 절취하여 배양한 방법은 경정배양법에 대한 새로운 접근법이며, 경정의 사용을 식물이 생장 중일 때에만 국한하지 않고, 휴면아 내부에 있는 경정까지 포함시켜 그 사용 범위를 확대한 것이다. 일반적으로, 경화된 휴면가지를 이용하여 경정을 절취할 때는 휴면 타파를 위해 저온에 일정기간 저장하고 난 후, 휴면아로부터 신초를 생장시켜 기내・외로 도입하는 과정을 진행하고 경정을 절취하는데, 본 연구는 이러한 과정 없이 바로 휴면아로부터 경정을 절취하였다. 또한, 절취한 경정을 그대로 배양하여 별도의 열처리나 화학처리 등의 무병화 처리과정을 생략하고 바이러스가 제거된 신초를 획득하였는데, 이러한 방법은 시간, 노력, 비용을 절감할 수 있는 매우 경제적인 방법이라고 사료되었다.

식물 RNA 바이러스는 식물체 내에서 광합성 산물이 이동하는 경로를 따라 즉, 공급원(source)에서 수용부(sink)로 체관을 통하여 식물체 전역으로 이동하는데(Carrington et al. 1996; Citovsky and Zambryski 2000), 저온을 받은 휴면아는 광합성을 하지 않는 상태로 내부조직이 한랭처리를 받은 것과 유사하므로, 휴면내의 경정조직은 동화산물의 통로가 되는 조직이 분화하지 않았을 것이고, 그 만큼 바이러스 이동이 제한되어 비감염 부위가 식물이 생장 중일 때보다 넓을 것이라고 추측하였다. 본 연구진이 촬영한 포도의 생장점은(Fig. 1E) 마치 진주를 박아 넣은 듯한, 확실한 돔(dome) 형태를 이루었는데, 이러한 생장점의 모습은 식물이 생장 중일 때는 관찰하기 어려웠다. 본 연구실험에서 0.3 mm와 0.8 mm 길이의 경정조직에서 재생한 신초에서 바이러스 제거효율이 상이하였는데, 이 두 가지 길이의 중간쯤인 0.5 mm 에서 실험을 추가하여 거봉에서 바이러스 제거에 효율적인 경정의 길이를 좀더 구체적으로 파악할 필요가 있고, 다른 품종을 대상으로 실험을 수행하여 품종마다 적합한 경정의 절취와 신초 재생률을 높일 수 있는 배양조건을 구명해야 할 것으로 판단된다.

본 연구에서 개발한 경정배양 방법은 GFkV뿐만 아니라, GLRaV와 같이 식물체의 생장점에는 존재하지 않는 다른 도관 바이러스(Gosalvez-Bernal et al. 2008)의 제거에도 매우 효과적일 것으로 판단되며, 향후 포도뿐만 아니라 온대 과수작물의 무병묘 생산에 유용하게 활용될 수 있을 것으로 전망된다.

적요

본 연구진은 세계 최초로 GFkV에 단독 감염된 포도 품종 거봉의 휴면아로부터 직접 경정 분열조직을 절취하여 배양함으로써 별도의 열처리나 화학처리 없이 GFkV가 제거된 신초 재생에 성공하였다. GFkV는 포도 식물체의 체관에만 한정적으로 존재하고 접목으로 감염되는 포도 바이러스이다. 경정조직은 4°C에서 일정기간 저장된 1년생 경화가지의 휴면아로부터 0.3 mm (73 절편체)와 0.8 mm (5절편체)를 절취하였는데, 절취 부위는 생장점(apical meristem)을 포함하여 2~5개의 엽원기(leaf primordia)와 미분화 원기(uncommitted primordia) 1~4개를 포함하였다. 절취된 경정조직을 BA 3.0 mg/L와 IBA 0.1 mg/L가 혼합된 배지에 16주간 배양한 결과, 0.3 mm와 0.8 mm의 경정조직에서 각각 4.1%와 40.0%의 신초 재생률이 관찰되었고, 재생된 신초에서의 바이러스 제거율(재생된 신초수에 대한 RT-PCR negative 신초수의 백분율)은 0.3 mm의 경정조직에서는 100%를, 0.8 mm에서는 50%를 나타내었다. 신초를 증식시킨 후 감염바이러스를 다시 진단한 결과, 신초가 처음 재생되었을 때의 진단결과와 동일하였다. 휴면아로부터 분열조직을 배양하여 바이러스가 제거된 신초를 확보한 예는 세계적으로 보고된 바가 없는 것으로서, 본 연구진의 새로운 바이러스 제거방법은 향후 포도 뿐만 아니라 과수를 포함한 낙엽성 수목의 무병묘 생산에 매우 유용하게 활용될 수 있을 것이다.

사사

본 연구는 농촌진흥청 연구과제(세부과제번호:PJ010228062017)의 지원에 의해 이루어진 것임.

References
  1. Barlass M. (1987) Elimination of stem pitting and corky bark diseases from grapevine by fragmented shoot apex culture. Ann Appl Biol 110, 653-656.
    CrossRef
  2. Barlass M, Skene KGM, Woodham RC, and Krake LR. (1982) Regeneration of virus-free grapevines usingin vitroapical culture. Ann Appl Biol 101, 291-295.
    CrossRef
  3. Borroto-Fernandez EG, Sommerbauer T, Popowich E, Schartl A, and Laimer M. (2009) Somatic embryogenesis from anthers of the autochthonousVitis viniferacv. Domina leads toArabis mosaic virus-free plants. Eur J Plant Pathol 124, 171-174.
    CrossRef
  4. Bota J, Cretazzo E, Montero R, Rossello J, and Cifre J. (2014) Grapevine fleck virus(GFkV) elimination in a selected clone ofVitis viniferaL. cv. Manto Negro and its effects on photosynthesis. J Int Sci Vigne Vin 48, 11-19.
  5. Carrington JC, Kasschau KD, Mahajan SK, and Schaad MC. (1996) Cell-to-cell and long-distance transport of viruses in plant. Plant Cell 8, 1669-1681.
    Pubmed KoreaMed CrossRef
  6. Citovsky V, and Zambryski P. (2000) Systemic transport of RNA in plants. Trends Plant Sci 5, 52-54.
    CrossRef
  7. Cretazzo E, Padilla C, Carambula C, Hita I, Salmeron E, and Cifre J. (2010a) Comparison of the effects of different virus infections on performance of three Majorcan grapevine cultivars in field conditions. Ann Appl Biol 156, 1-12.
    CrossRef
  8. Cretazzo E, Tomas M, Padilla C, Rossello J, Medrano H, Padilla V, and Cifre J. (2010b) Incidence of virus infection in old vineyards of local grapevine varieties from Majorca:implications for clonal selection strategies. Span J Agric Res 8, 409-418.
    CrossRef
  9. Duran-Vila N, Juarez J, and Arregui JM. (1988) Production of viroid-free grapevines by shoot tip culture. Am J Enol Vitic 39, 217-220.
  10. Fiore N, Prodan S, Montealegre J, Aballay E, Pino AM, and Zamorano A. (2008) Survey of Grapevine viruses in chile. J plant pathol 90, 125-130.
  11. Gambino G, and Gribaudo I. (2010) Simultaneous detection of nine grapevine viruses by reverse transcription-polymerase chain reaction with co-amplification of a plant RNA as internal control. Virol 96, 1223-1229.
  12. Gambino G, Matteo DD, and Gribaudo. (2009) Elimination ofGrapevine fanleaf virusfrom threeVitis viniferacultivars by somatic embryogenesis. Eur J Plant Pathol 123, 57-60.
    CrossRef
  13. Gambino G, Perrone I, and Gribaudo I. (2008) A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem Anal 19, 520-525.
    Pubmed CrossRef
  14. Gosalvez-Bernal B, Genoves A, Navarro JA, Pallas V, and Sanchez-Pina MA. (2008) Distribution and pathway for phloem-dependent movement ofMelon necrotic spot virusin melon plants. Mol Plant Pathol 9, 447-461.
    Pubmed CrossRef
  15. Gribaudo I, Gambino G, Cuozzo D, and Mannini F. (2006) Attempts to eliminationGrapevine rupestris stem pitting-associated virusfrom grapevine clones. J Plant Pathol 88, 293-298.
  16. Guta IC, Buciumeanu EC, and Visoiu E. (2014) Elimination ofGrapevine fleck virusby in vitro Chemotherapy. Notulae Botanicae Horti Agrobotanici Cluj-Napoca 42, 115-118.
    CrossRef
  17. Habili N, Krake LR, Barlass M, and Rezaian MA. (1992) Evaluation of biological indexing and dsRNA analysis in grapevine virus elimination. Ann Appl Biol 121, 277-283.
    CrossRef
  18. Hewitt WB, Goheen AC, Cory L, and Luhn C. (1972) Grapevine fleck disease, latent in many varieties, is transmitted by graft inoculation. Ann Phytopathol , 43-47.
  19. Jo Y, Song MK, Choi H, Park JS, Lee JW, and Cho WK. (2017) First Report ofGrapevine fleck virusandGrapevine virus Ein Grapevine in Korea. Plant Dis 101, 1069.
  20. Kim JS, Lee SH, Choi HS, Kim MK, Kwak HR, Nam M, and Chung BN. (2011) Occurrence of virus diseases on major crops in 2010. Res Plant Dis 17, 334-341.
    CrossRef
  21. Komar V, Vigne E, Demangeat G, and Fuch M. (2007) Beneficial effect of selective virus elimination on the performance ofVitis viniferacv. Chardonnay. Am J Enol Vitic 58, 202-210.
  22. Kovacs LG, Hanami H, Fortenberry M, and Kaps ML. (2001) Latent infection by leafroll agent GLRaV-3 is linked to lower fruit quality in French-American hybrid grapevines Vidal blanc and St. Vincent. Am J Enol Vitic 52, 254-259.
  23. Kumar S, Singh L, Ferretti L, Barba M, A.Zaidi A, and Hallan V. (2013) Evidence ofGrapevine leafroll associated virus-1–3Grapevine fleck virusandGrapevine virus BOccurring in Himachal Pradesh, India. Indian J Virol 24, 66-69.
    Pubmed KoreaMed CrossRef
  24. Maliogka VI, Skiada FG, Eleftherou EP, and Katis NI. (2009) Elimination of a new ampelovirus (GLRaV-Pr)and Grapevine rupestris stem pitting associated virus(GRSPaV) from twoVitis viniferacultivars combining in vitro thermotherapy with shoot tip culture. Sci Hortic 123, 280-282.
    CrossRef
  25. Martelli GP. (1993) Graft-transmissible Diseases of Grapevines. Handbook for Detection and Diagnosis . FAO Publication Division, Rome.
  26. Martelli GP, Sabanadzovic S, Sabanadzovic NA, Edwards MC, and Dreher T. (2002) The family Tymoviridae. Arch Virol 147, 1837-1846.
    Pubmed CrossRef
  27. Morrison JC. (1991) Bud development inVitis viniferaL. Botanical gazette 152, 304-315.
    CrossRef
  28. Murashige T, and Skoog F. (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Phyiol Plant 15, 473-497.
    CrossRef
  29. Panattoni A, and Triolo E. (2010) Susceptibility of grapevine viruses to thermotherapy on in vitro collection of Kober 5BB. Sci Hortic 125, 63-67.
    CrossRef
  30. Panattoni A, Anna FD, and Triolo E. (2007) Antiviral activity of tiazofurin and mycophenolic acid againstGrapevine leafroll-associated virus3 inVitis viniferaexplants. Antiviral Res 73, 206-211.
    Pubmed CrossRef
  31. Poojari S, and Lowery T. (2016) First report and prevalence ofGrapevine fleck virusin Grapevines (Vitis vinifera) in Canada. Plant dis 100, 1028-1032.
    CrossRef
  32. Skiada FG, Grigoriadou K, Maliogka VI, Katis NI, and Eleftheriou EP. (2009) Elimination ofGrapevine leafroll-associated virus 1andGrapevine rupestris stem pitting-associated virusfrom grapevine cv. Agiorgitiko, and a micropropagation protocol for mass production of virus-free plantlets. J Plant Pathol 91, 177-184.
  33. Skiada FG, Maliogka VI, Katis NI, and Elefthriou EP. (2013) Elimination ofGrapevine rupestris stem pitting-associated virus(GRSPaV) from twoVitis niviferacultivars by in vitro chemotherapy. Eur J Plant Pathol 135, 407-414.
    CrossRef
  34. Valero M, Ibanez A, and Morte A. (2003) Effects of high vineyard temperatures on theGrapevine leafroll associated viruselimination fromVitis viniferaL. cv. Napoleon tissue cultures. Sci Hortic 97, 289-296.
    CrossRef
  35. Vasconcelos MC, Greven M, Winefield CS, Trought MC, and Raw V. (2009) The flowering process of Vitis vinifera:A Review. Am J Enol Vitic 60, 411-434.
  36. Vivier MA, and Pretorius IS. (2002) Genetically tailored grapevines for the wine industry. Trends Biotechnol 20, 472-478.
    CrossRef
  37. Wang Q, Mawassi M, Li P, Gafny R, Sela I, and Tamme E. (2003) Elimination of grapevine virus A (GVA) by cryopreservation of in vitro-grown shoot tips ofVitis viniferaL. Plant Sci 165, 321-327.
    CrossRef
  38. Youssef SA, Al-Dhaher MMA, and Shalaby AA. (2009) Elimination ofGrapevine fanleaf virus(GFLV) andGrapevine leaf roll- associated virus-1(GLRaV-1) from infected grapevine plants using meristem tip culture. Int J Virol 5, 89-99.
    CrossRef
  39. Yun HK, and Park KS. (2007) Grape and grapevine rootstock breeding program in Korea. Int J Plant Breeding 1, 22-26.


September 2018, 45 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM