search for




 

Development of a marker system to discern the flowering type in Brassica rapa crops
J Plant Biotechnol 2017;44:438-447
Published online December 31, 2017
© 2017 The Korean Society for Plant Biotechnology.

Jin A Kim*, Jung Sun Kim, Joon Ki Hong, Yeon-Hee Lee, Soo In Lee, and Mi-Jeong Jeong

National Academy of Agricultural Science, Rural Development Administration, 370, Nongsaengmyeong-ro, Wansan-gu, Jeonju-si, Jeollabuk-do, Korea, 560-500
Correspondence to: e-mail: jakim72@korea.kr
Received September 18, 2017; Revised October 25, 2017; Accepted October 26, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Flowering is one of the most important development traits related to the production of Brassica rapa crops. After planting, a sudden low temperature triggers premature flowering, which leads to a reduction in the yield and quality of harvested production. Therefore, understanding the mechanism of flowering control is important in the agricultural productivity for preventing Brassica rapa crops. Vernalization is generally known as the main factor of flowering in the Brassica plant. However, in the subspecies of Brassica rapa, some accession such as Yellow sarson and Komatsuna display the flowering phenotype without vernalization. Circadian genes, which diurnally regulate plant physiology, have a role for photoperiodic flowering but are related to the regulation of the vernalizarion mechanism. In this report, the 22 B. rapa accession were divided into two groups, vernalization and non-vernalization, and the sequenced circadian gene, BrPRR1s. Among them, the BrPRR1b gene was found to have deletion regions, which could classify the two groups. The PCR primer was designed to amplify a short band of 422bp in the vernalization type and a long band of 451bp in the non-vernalization type. This primer set was applied to distinguish the flowering types in the 43 B. rapa accession and 4 Brassica genus crop, Broccoli, cabbage, mustard, and rape. The PCR analysis results and flowering time information of each crop demonstrated that the primer set can be used as marker to discern the flowering type in Brassica crops. This marker system can be applied to the B. rapa breeding when selecting the flowering character of new progenies or introducing varieties at an early stage. In addition, these results displayed that the circadian clock genes can be a good strategy for the flowering control of B. rapa crops.

Keywords : Brassica rapa accession, BrPRR1, Circardian clock genes, Molecular marker, Vernalization
서언

개화는 식물에게 있어서 가장 중요한 발달 특성 중 하나이다. 개화시기는 내생요인과 환경 자극 등에 의해 조절되는데, 개화 조절 기작에 관여하는 많은 유전자들이 모델식물인 애기장대를 중심으로 밝혀져 왔으며 광주기(photoperiod), 춘화(vernalization), 내생(endogenous) 그리고 지베렐린(GA)에 의해 유도되는 기작에 관련된 유전자들에 대한 많은 연구가 있어왔다(Simpson et al. 1999; Mouradov et al. 2002; Jack 2004; Alexandre and Hennig 2008; Boss et al. 2004).

작물의 개화 조절 기작은 생산성과 연관되어 중요하게 여겨진다. 애기장대를 중심으로 밝혀진 다양한 개화조절 기작 연구를 작물로 확대하여 연구하는 시도가 이루어져 왔으며, 애기장대와 같은 십자화과(Brassicaceae)에 속하는 배추(B. rapa), 양배추(B. oleracea), 유채(B. napus) 등 배추속 작물들은 FLC 유전자가 관여하는 춘화를 통해 개화가 유도되는 작물로 잘 알려져 왔다(Osborn et al. 1997).

한국과 중국에서 소비량이 많은 배추 (Chinese cabbage)는 배추종(Brassica rapa)에 속하는 작물로, 배추(Chinese cabbage;

ssp. pekinensis), 박초이(Pak choi; ssp. chinensis), 우타카이(Wutacai; ssp. narinosa), 순무(Turnip; ssp. rapa), 카이신(Caixin; ssp. parachinensis), 미즈나(Mizuna; ssp. nipposinica), 브로콜리토(Broccoletto; ssp. broccoletto)를 비롯하여 순무평지(Turnip rape; ssp. oleifera)나 옐로우사순(Yellow sarson; ssp. tricolaris)과 같은 유지종자 작물 등이 이에 속한다. 이들 자연 발생 배추 종들(natural accessions)의 개화 기작은 춘화와 연관이 있는 것으로 알려져 있으나, 유채종의 하나로 알려진 Yellow sarson 이나 일본 겨자 시금치로 알려져 있는 Komatsuna 등은 저온처리 없이도 파종 후 40일 전후가 지나면 추대한다(Gómez-Campo 1999). 또한 노지에서 미성숙 시기에 저온을 만나 수량과 수확물의 질이 떨어지는 경우도 종종 발생하는 등 배추종 작물의 개화 조건과 그 기작은 작물의 작기와 수확량 확보에 중요한 요인이다(Yuan et al. 2009).

생체 시계는 지구의 자전에 의해 발생하는 일일주기에 맞춰 생물의 생리 및 행동에 생체리듬을 부여하며 이를 조절하는데 관여한다(Millar 2004; Eriksson and Millar 2003). 생체리듬은 식물의 생장과 발달에 직,간접적으로 관여하며 궁극적으로 진화과정상의 적응과 농작물의 생산량에 영향을 미친다(Dodd et al. 2005). 애기장대에서 PRR1(Pseudo-Response Regulators1)과 LHY/CCA1(Late Elongated Hypocotyl/Circadian Clock Associated 1)는 생체시계 조절 기작의 중심 유전자이다(Harmer 2009; Takata et al. 2010). TOC1 (TIMING OF CAB EXPRESSION 1)로도 알려진 PRR1 유전자는 특이한 구조(pseudo-receiver domain과 CONSTANS motif)를 가진 애기장대 PRR(pseudo-response regulator)군 중 하나이다(Makino et al., 2000; Matsushika et al., 2000; Murakami et al., 2003; 2005). 5개로 되어 있어 “PRR quintet”로도 불리는 이 유전자의 mRNA는 해가 뜨고 난 후 순차적으로 발현이 축적이 되어 2~3시간 간격을 두고 PRR9_PRR7_PRR5_PRR3_PRR1 순으로 발현량이 최대로 되는 생체시계 유전자이다(Matsushika et al., 2000; Mizuno and Nakamichi, 2005). 피자 식물 진화계통에 보존되어 있으며, 벼(Oryza sativa)와 같은 외떡잎 식물과 포플라(Populus trichocarpa)와 같은 목본류의 식물 등에 잘 보존되어 있는 유전자로 진화과정을 거치면서 작물별로 보존된 유사유전자(paralogous genes)의 개수에 차이가 있다(Murakami et al. 2003; Ming et al. 2008; Ramírez-Carvajal et al. 2008; Takata et al. 2010). 배추 게놈에서 발견된 PRR군 유전자는 11개이며, 그 중 PRR1은 2개(BrPRR1aBrPRR1b)로 일일 주기로 발현하는 생체시계 유전자임이 확인되었다(Lou et al. 2012; Kim et al. 2012).

본 논문에서는 배추 제놈에 보존되어 있는 생체시계 유전자의 서열변이를 이용하여 배추속 식물의 개화형을 춘화형과 비춘화형으로 구분하여 주는 마커를 개발하였다. 이러한 연구결과는 배추속 식물의 생육 초기에 개화형을 판별하여 재배 작형 예측에 활용되어, 배추속 식물의 교배 육종 및 채종 재배 시 선발에 유용하게 이용될 수 있을 것이다. 또한 일장형 개화 식물과 달리 생체시계 유전자와 춘화형 개화조절과의 관계는 많이 알려져 있지 않다. 본 연구의 결과는 작물의 개화조절과 생체시계 유전자와의 연관성을 밝히고 이를 이용하여 작물의 개화를 조절하려는 최근의 연구들에 기여할 수 있을 것이다.

재료 및 방법

공시재료

배추 아종 43종(Table 1)과 배추 속 식물 브로콜리(Brassica oleracea var. italica), 양배추(B. oleracea var. capitate), 갓(Brassica juncea (L.) Czern.), 영산유채(Brassica napus L.) 및 애기장대(Arabidopsis thaliana, col-0)를 실험에 사용하였다. 배추 아종 30종의 종자는 네덜란드 유전자원 센터(Centre for Genetic Resources, the Netherlands, http://www.cgn.wur.nl/UK)에서 분양 받았으며(Table 1, No.1-30), 지부(Chiifu), 장원 모, 부(Jangwon female/male)본은 농촌진흥청이 보유한 종자(Table 1, No.31-33), 권심(KenshinA, B), Chil, Hiro, 청경채(PakChoi), 백경채(White PakChoi), 순무(TurnipA, B)와 배추종이 아닌 타작물로 배추속에 속하는 브로콜리(Broccoli)와 양배추(Cabbage), 갓(Leaf mustard), 유채(Rape) (Table 1, No. 34-45번)는 동부한농종묘에서 분양받았다. 네덜란드 유전자원 센터 자료를 참고하여 자원들의 개화형을 Table 1에 함께 표시하였다.

List of accessions

No Lab code CGNa code TAG2005b code Flowering types No Lab code CGN code TAG2005 codeFlowering types
1WB04L58NV25LP08CGN06835YS-033NV
2WB05CGN07211cPC-078-26LP09CGN06836SO-034NV
3WB06OCRI1757OR-210-27LP10CGN06840SO-038NV
4WB09CGN17280TG-129V28LP21CGN13924PC-099-
5WB11CGN06818WO-024NV29LP23CGN15184PC-107-
6WB12CGN07222WO-085-30LP30R-O-18NV
7WB13CGN15202KOM-118V31Chiifu-CC-01V
8WB14FIL500YS-143NV32Jangwon♀-CC-02V
9WB15CGN06841SO-039NV33Jangwon♂-CC-03V
10WB16CGN06842SO-040NV34Kenshin A-L58-01V
11WB17CGN06790MIZ-019V35Kenshin B-L58-02NV
12WB18CGN17279MIZ-128V36Chil1-Chil-01-
13WB20-1CGN15171PC-105-37Chil2-Chil-02-
14WB20-2CGN15171PC-105-38Chil3-Chil-03-
15WB21CGN06828BRO-029-39Hiro1-Hiro-01-
16WB22CGN06829BRO-030-40PakChoi-PC-01V
17WB23CGN17278BRO-127-41White PakChoi-PC-02-
18WB24CGN15199VT-115V42TurnipA-VT-01V
19WB25CGN06720VT-012V43TurnipB-VT-02V
20WB26CGN06709VT-006V44Broccoli-out-01V
21WB27CGN06859VT-044V45Cabbage-out-02V
22LP04CGN06718VT-110V46Leaf mustard-out-03V
23LP06CGN06825BRO-027-47Rape-out-04V
24LP07CGN06834SO-032-48Arabidopsis-out-05-

aCGN: Centre for Genetic Resources, The Netherlands. The accessions were obtained from CGN in Wageningen

bTAG2005 code: Genotype names of B. rapa collections in Zhao et al. (2005)

cabbreviation: BRO, Broccoletto; CC, Chinese cabbage; FT, fodder turnip; KOM, Komatsuna; Miz, Mizuna; PC, Pak choi, Caixin and Wutacai; SO, Spring turnip rape; TG, turnip green; VT, Vegetable turnip; WO, Winter turnip rape; YS, Yellow sarson.


배추 아종 내 BrPRR1b 유전자의 변이 탐색

각 배추 아종 작물들의 종자를 파종하여 본엽이 3-5장 정도 되었을 때 잎과 줄기를 채취하였다. 채취한 잎과 줄기를 마쇄한 후 Kim et al. (2006)의 방법으로 게놈 DNA를 추출하고 농도를 50 ng/ml로 희석하였다. Table 2의 프라이머 세트(BrPRR1a_L/R와 BrPRR1b_L/R)를 이용하여 추출한 DNA 내 BrPRR1b(Brassica rapa Pseudo-Response Regulators1b) 유전자(Kim et al. 2007; 2012)의 염기서열분석을 수행하였다. 분리한 DNA 200ng은 95°C에서 5분 변성시킨 후 변성 95°C 45초, 어닐링 58°C 45초 및 신장 75°C 1분 30초의 과정을 35 사이클 반복한 후 다시 10분간 신장시켜 증폭하였다. 이렇게 증폭된 PCR 밴드를 분리하여 핵산서열 분석 후, DNASTAR Lasergene7을 사용하여 multi-alignment를 수행하고 변이 영역을 탐색하였다.

개화 일수 조사

배추 아종 43종 중 네덜란드 유전자원 센터에 개화형이 명시된 22종을 우선 선발하여 춘화형과 비춘화형 두 그룹으로 분류하였다. 춘화형 그룹은 파종 2주 후에 45일간 저온(4°C)에 두어 춘화처리를 하였고, 비춘화형은 25°C 온실에서 생육하여 파종 후부터 개화까지의 소요 일수를 조사하였다.

개화형 판별용 PCR 마커 개발 및 확인

BrPRR1b 유전자의 변이 부분을 증폭할 수 있는 프라이머 세트(Table 2)를 개발하고 배추 아종 22종을 포함한 배추 아종 43종 및 기타 배추 속 식물(브로콜리, 양배추, 갓, 영산유채)에 대해서도 PCR 증폭을 수행하였다 작물의 DNA를 주형으로 하여 PCR 분석을 하였다. PCR 조건은 배추 아종 내 BrPRR1b 유전자의 변이 탐색과 같은 방법으로 수행하였으며, 29bp의 밴드 크기 차이를 보기 위하여 2.5% agarose gel electrophoresis에서 확인하였다.

List of primers for PCR

 Name of primers Sequences (5’-3’)
aBrPRR1a_LTGGTTTGGCCATGGAAGTAT
BrPRR1a_RTGCTAAGCCAACATGAGCAG
bBrPRR1b_LTTTGCCATGAAAGTTGGAAG
BrPRR1b_R TGAGTGAACATGATCAAACACATC 
cvernal_marker_LGAAGAAAGCTGAGGACTCTCCA
vernal _marker_RTCCAAGTGATCCAAACACAAA

aprimer for isolation of BrPRR1a from B. rapa accession

bprimer for isolation of BrPRR1b from B. rapa accession

cprimer for ampification of variation region in BrPRR1b, marker primers


결과 및 고찰

배추 아종 내 생체시계 유전자 BrPRR1군의 서열변이

네덜란드 유전자원 센터(Centre for Genetic Resources, the Netherlands, http://www.cgn.wur.nl/UK)에서 분양 받은 종자 30종과 농촌진흥청이 보유하고 있던 지부, 장원 모, 부본, 그리고 동부한농종묘에서 분양 받은 권심, Chil, Hiro, 청경채, 백경채, 순무에 보존되어 있는 PRR1a1b 두 유전자군의 염기서열 분석을 시도하였다. 염기서열분석이 잘 수행된 아종 내 BrPRR1a1b 유전자의 계통분석을 하였는데 아종별로 두 유전자가 잘 보존되었음을 확인하였다(Fig. 1). 그러나 일부 아종에 대하여는 염기서열분석이 잘 되지 못하였으며, BrPRR1b의 경우 각 아종별로 SNP(Single nucleotide polymorphism)와 삽입/결손 등 다양한 서열변이 영역이 발견되었다(Fig. 2).

Fig. 1.

Non-rooted neighborjoining phylogenetic tree of BrPRR1a,1b in B. rapa accession Sequencing analysis were carried using BrPRR1a_L/R and BrPRR1b_L/R primer in Table 2. Using DNASTAR Lasergene7, sequenced data were used for multi-alignment and analysis


Fig. 2.

Sequence variations of each BrPRR1b in B. rapa accession Primers to amplify the region of variation were designed (red characters). Alignment of sequences were carried by Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/)


개화형이 다른 아종 내 BrPRR1b 유전자의 변이 탐색

배추 아종들 대부분은 잎을 식용하므로 재배기 동안 화아 분화가 되지 않고 일반적으로 4°C 저온에 일정기간 춘화처리 후에 추대하는 것으로 알려져 있다(Osborn et al. 1997). 종자 수확을 위해 관행으로 춘화처리를 해오던 지부, 장원, 권심 등과 분양받은 종자의 개화형을 참고하여(Table 1), 개화를 위해 일정기간(약 45일)의 저온처리가 필요한 춘화형과 발아 후 약 40일 전후 장일 조건에서 개화하는 비춘화형 배추 아종 22개를 선발하여 개화조사를 실시하였다. 조숙종인 LP30(R-O-18)을 비롯하여 비춘화형으로 분류된 아종은 파종 후 38일부터 48일 사이에 추대하여 개화하였으나 춘화형으로 분류된 아종은 추대하지 않았으며, 45일 춘화처리 후에 37일부터 65일 사이에 개화하였다(Table 3, Fig. 3A).

Flowering time in 22 B. rapa accession

Non-vernalization typeVernalization type

 Lab code  English name aDays for flowering Lab code  English name bDays for flowering
WB04Rapid cycling38WB13KomatsunaNS
WB11Winter turnip rape37WB17Mizuna90
WB14Yellow sarson48WB18MizunaNS
WB15Spring turnip rape37WB24Vegetable turnip105
WB16Spring turnip rapeNSWB25Vegetable turnip90
LP07Spring turnip rape48WB09turnip green99
LP08Yellow sarson38WB26Vegetable turnip105
LP09Spring turnip rape37WB27Vegetable turnip110
LP3041LP04Vegetable turnip105
KwenshinBChinese cabbage41KwenshinAChinese cabbage82
Jangwon♀Chinese cabbage95
ChiifuChinese cabbage95

aDays for flowering: Screening for flowering time in B. rapa accession. Seeds were imbibed in water for 1day and planted in soil. The time point checked when the first premature flower buds were come out without vernalization treatment. Flowering time was calculated number from planting to premature buds.

bDays for flowering: Screening for flowering time in B. rapa accession. Seeds were imbibed in water for 1day and planted in soil. The time point checked when the first premature flower buds were come out with 45 days vernalization treatment. Flowering time was calculated number from planting to premature buds


Fig. 3.

Development of marker system to discern the flowering type Some B. rapa accessions were divided into two groups according to the flowering type, vernalization (Left) which need long term cold treatment for flowering and non-vrtnalization (Right) which can bolt without cold treatment. Picture showed the morphologies after 40th days plant from planting (A). PCR banding patterns generated with the primer combination vernal_marker_L/R. Red and black arrows indicate the 451 bp fragment linked to non-vernalization BrPRR1b locus and 422 bp fragment linked to vernalization BrPRR1b locus, respectively.


또한 춘화형 배추 아종의 BrPRR1b 유전자의 핵산서열 내에 총 46bp의 결손(deletion) 영역이 확인되었다(Fig. 2). 이 결손 영역을 증폭하여 비춘화형 아종의 경우 451bp의 긴 PCR 밴드만, 춘화형 아종은 422 bp의 짧은 PCR 밴드만 확인되도록 프라이머 세트(Table 2)를 디자인하였으며, 22 아종을 대상으로 PCR 분석을 수행하였다(Fig. 3B). 개화 일수가 100일 이상의 극만추대형(WB24, WB27 및 LP04)(Table1, 3)의 경우에는 두 밴드가 모두 관찰되었는데 이는 자연상태에서 두 타입의 BrPRR1b 유전자를 모두 가지고 있는 hetero allele로 추정된다. 이들 아종의 경우 염기서열분석에 실패하였는데 이는 사용했던 프라이머로는 각각의 유전자를 따로 분리할 수 없었던 것으로 사료된다.

43개 배추 아종을 대상으로 PCR 분석을 수행한 결과 모든 배추 아종에서 밴드를 확인하였으며 451 bp 밴드가 나온 아종은 비춘화형, 422 bp 밴드 단독 또는 451 bp와 422 bp 두 밴드가 함께 나온 아종은 춘화형으로 확인되었다(Table 1, Fig. 4). 종이 다른 배추속 작물인 브로콜리, 양배추, 갓, 유채에 대해서도 PCR 분석을 수행한 결과 관행으로 춘화처리를 해왔던 배추속 작물은 춘화형으로 확인되었으며, 여름에 불시추대를 한다고 알려진 갓은 451 bp 밴드를 가지는 비춘화형임을 확인할 수 있었다.

Fig. 4.

Distributions of PCR banding patterns in Brassica rapa varieties and several Brassica crops Red and white arrows indicate the 451 bp fragment linked to non-vernalization BrPRR1b locus and 422 bp fragment linked to vernalization BrPRR1b locus, respectively


춘화형과 비춘화형의 교배 후대 분석

춘화형 배추와 비춘화형 배추를 교배하여 후대 분석을 시도하였다. 지부를 모본으로 하고, LP08 (YS-033)을 부본으로 하여 교배하였고, 모본과 부본을 바꾸어 교배한 F1의 개화형과 마커 PCR 결과를 비교하였다. 그 결과, 지부를 모본으로 하고 LP08을 부본으로 하여 교배한 경우는 춘화형이며 422 bp과 451 bp 두 밴드를 모두 가지고 있었고(Fig. 5A), 모본과 부본을 바꿔 교배한 경우는 451bp 밴드만을 보였으며 비춘화형이었다(Fig. 5B). LP08 아종이나 PRR1b 유전자가 모계 유전의 특징을 가진 것인지, 아니면 화분의 퇴화나 활력 또는 수정 능력의 차이에 기인한 의한 것인지(Kim et al., 2010)의 여부는 PRR1b 유전자의 기능과 연관하여 차후의 연구가 더 필요할 것이다.

Fig. 5.

Screening for flowering types in the F1 progeny populations F1 progeny were generated from a cross between Chiifu and LP08 (A) and between LP08 and Chiifu (B) using PCR marker. Red and black arrows indicate the 451 bp fragment linked to non-vernalization BrPRR1b locus and 422 bp fragment linked to vernalization BrPRR1b locus, respectively.


422 bp과 451 bp 두 밴드를 모두 보인 F1을 자가수분하여 F2를 육성하였으며, PCR 증폭을 시도하였다. Fig. 6A의 결과에서 91개 F2 중 68개체는 422 bp 밴드를 보이거나(15개) 422와 451 bp (53개) 밴드를 모두 보였고, 23개체는 451 bp밴드를 보여 춘화형과 비춘화형의 분리비가 3:1이 됨을 확인하였다. 또 다른 시도에서는 90개체 중 21개체는 451 bp밴드를 23개체는 422 bp 밴드만을 보였으며, 두 밴드를 모두 보인 개체수는 46으로 역시 PCR 결과상으로의 춘화형과 비춘화형은 3:1의 분리비를 보였다. 두 세트의 실험결과에서 422 bp 밴드를 단독으로 가진 개체수는 15개와 23개체로 상이하였다. 식물체의 모양은 대부분 PCR 분석의 결과에 상응하여 춘화형으로 판별된 경우는 지부배추의 모양과 비슷하고 같은 기간 경과 후 추대하지 않았으나, 비춘화형으로 판별된 경우는 유묘 때 하배축이 긴 LP08의 특징을 보였으며, 일정 기간 경과 후 특별한 처리 없이 개화하였다(Fig. 6B). 422 bp만 가진 개체 23개, 두 밴드를 모두 가진 개체 46개, 451 bp만 가진 개체 21개로 1:2:1의 분리비를 보인 F2 집단의 개화일수를 조사하였다. 젖은 3M 페이퍼에서 2일간 발아시킨 후 토양에 이식한 날로부터 춘화처리 없이 꽃봉오리가 생기는 날까지의 일수를 조사하였으며 130일까지 관찰하고 이후는 개화하지 않는 것으로 분류하였다. 마커 PCR결과 451 bp 밴드를 보여 비춘화형으로 분류된 21개의 F2 식물체들 중 12개는 120일 이전에 개화하였고 9개 식물체는 개화하지 않았으며, 개화한 식물체의 대부분이 85일 이전에 개화하였다. 단독으로 422 bp 밴드만을 보인 23개 식물체중 14개가 그리고 422 bp와 451 bp 두 PCR 밴드를 모두 가지는 46개 식물체중 19개가 개화를 하지 않았고 개화한 경우도 대부분 이식 후 100일이 지난 이후에 개화하였다(Fig. 6C).

Fig. 6.

Flowering types in the F2 progeny populations of a cross between Chiifu and LP08 Screening for flowering types in the F2 progeny population using PCR marker (A) Typical flowering phenotypes of F2 progeny. After 85 days from planting in soil, plants containing 422 bp band only or 422 bp and 451 bp together didn’t bolt (Left) but plants containing 451 bp band only had flower (Right) (B) Screening for flowering time in the F2 progeny populations without vernalization treatment. Seeds were imbibed in water for 1day and planted in soil. The time point checked when the first premature flower buds were came out. Flowering time was calculated number of the days from planting to first premature flower buds. Gray region shows the total flowered plants. Square, triangle and x show the plants containing PCR marker band 451 bp, 422 bp, and 422 + 451 bp, respectively


애기장대 생체시계 유전자 PRR군은 생체리듬을 조절하는 기능 외에도 다양한 기능을 가지고 있음이 보고되고 있다. 사탕무(Beta vulgaris L.)의 춘화반응에 대한 자연변이는 BOLTING TIME CONTROL1 (BTC1) 유전자좌와 연관되어 있으며 이는 애기장대의 PRR3PRR7 유전자와 상동성을 보이는 PRR군 유전자임이 확인되었다(Ream et al. 2016; Omolade et al. 2016). 또한 BvPRR7은 일일주기로 발현되며 저온에 반응할 뿐만 아니라 개화시기 조절에 직접적으로 관여한고 알려져 있다(Omolade et al. 2016). 벼(Oryza sativa)의 PRR37유전자 역시 Early heading7-2(EH7-2)/Heading date2(Hd2) QTL과 연관되어 이들 유전자들의 기능을 잃은 경우 극단적으로 이른 개화를 보였다(Koo et al. 2013).

조숙형 배추IMB211 (rapid cycling Chinese cabbage (ssp. pekinensis))와 유지종자형 배추R500 (Yellow Sarson oilseed (ssp. trilocularis))의 재조합육성계통 집단의 QTL 분석을 시도한 이전의 연구에서 PRR7FLC 가 염색체 A02와 A10에 매우 가까이 있음이 보고되었다. 또한 지부 배추에서도 BrPRR7aBrPRR7b가 염색체 A02와 A10에 각각BrFLC2BrFLC1 유전자와 매우 가깝게 위치해 있는 것이 확인되었다(Kim et al. 2012). PRR7PRR9은 고온에서의 생체리듬 주기 조절과 관련이 있는 것으로도 알려져 있다(Salomé et al. 2010).

생체시계 유전자와 배추 아종의 개화 생리

배추는 약 17-20MY 전에 애기장대에서 분리된 이후 진화과정 동안 세 번의 WGD(Whole genome duplicate)를 겪었으며(Lysak et al. 2005;Town 2006; Yang 2006) 이배체화(diploidization)되어 배추 게놈 내 애기장대 유전자의 상동유전자 수는 평균 2배로 보존되어 있다(Mun et al. 2009). 보존되어 있는 유전자들이 서로 중복된 기능을 가지고 유전자량 효과(dosage effect)를 보이는 경우가 매우 많으나(Edger and Pires, 2009), 진화 과정 동안 전혀 다른 새로운 기능(neo-functional)을 가지는 경우도 발견되고 있다(McClung 2010).

본 논문의 BrPRR1b 유전자는 애기장대 TOC1의 배추 게놈 내 상동 유전자 중 하나로 일일주기로 발현하며 계속 광에서도 주기를 유지하는 생체시계 유전자이다(Kim et al. 2007; Kim et al. 2012). 배추 염색체 A09에 위치하며 BrFLC와 가깝게 있지는 않으나 PRR7, PRR9과 함께 개화 조절을 하는 것으로 알려진 PRR5의 상동 유전자인 BrPRR5a와 바로 인접해 있다(Nakamichi et al. 2007; Kim et al, 2012). 또한 애기장대의 TOC1은 식물체가 저온에 노출되었을 때 발현이 변화하는 것으로도 알려져 있다(Michael et al. 2003; Bieniawska et al. 2008).

본 논문은 생체시계 유전자 BrPRR1b가 배추 아종과 배추속 식물에서 춘화와 관련된 개화 기작과 연관되어 있을 수 있음을 제시하였다. 또한 이를 이용하여 배추 속 식물의 개화형을 춘화형과 비춘화형으로 구분하여 주는 마커를 개발하였다. 이 마커는 개화 생리를 생육 초기에 예측하게 하여 배추속 식물의 교배 육종 및 채종 재배 시 유용하게 이용될 수 있을 것이다. 그러나 BrPRR1b가 개화관련 유전자와 단순히 가깝게 연관되어 있는 유전자인지 아니면 배추 속 식물의 개화 기작에 직접적으로 관여하는지 여부는 분명하지 않다. 배추속 식물의 개화 조건과 기작은 작기와 수확량 확보에 중요한 요인으로 현재까지는 FLC가 관여하는 기작(Kim et al. 2007)이 잘 알려져 있고 이 유전자의 발현을 조절하여 개화시기를 조절하려는 시도들이 있었다. 본 논문은 배추종 작물의 개화와 생체시계와의 연관 가능성을 제시하였다. 앞으로 BrPRR1b 유전자를 비롯한 생체시계 유전자의 기능연구가 좀더 필요하며, 이러한 연구들은 개화조절을 작물의 생산성을 증대 시키는 전략에 새로운 가능성을 줄 수 있을 것이다.

적요

개화는 배추종 작물의 생산성과 연관된 중요 발달 특성 중 하나이다. 이식 후, 갑작스러운 저온에 노출되어 때이른 개화를 하게 되면 수확되는 생산물의 양과 질이 떨어지게 된다. 따라서, 개화조절 메커니즘을 이해하는 것은 배추 종 작물의 농업적 생산성을 향상시키는데 도움을 줄 것이다. 춘화는 배추과 작물에서 일반적으로 알려져 있는 개화를 유도하는 중요한 요소이다. 그러나 옐로우 사순이나 코마수나와 같은 배추 아종은 춘화처리 없이도 개화한다. 1일을 주기로 하여 생물의 생리기작을 조절하는 생체시계 유전자는 일장감응형의 개화 조절에 중요한 역할을 하지만 춘화처리를 통해 개화를 유도하는 기작과도 연관되어 있다. 본 논문에서는 22개의 배추 아종을 개화에 춘화처리가 필요한 춘화형과 춘화처리 없이도 개화하는 비춘화형으로 나누어 보존된 생체시계 유전자, BrPRR1 군의 염기서열 분석을 수행하였다. 그 중 BrPRR1b 유전자의 결손 영역으로 춘화형과 비춘화형 두 그룹을 구분할 수 있었다. 이 서열변이를 증폭할 수 있는 PCR 프라이머를 디자인하여 비춘화형 배추 아종에서는 451 bp의 긴 밴드를, 춘화형 배추에서는 422 bp의 작은 크기의 밴드를 증폭할 수 있었다. 이 프라이머 세트는 43개 배추 아종과 4개의 배추속 작물, 브로콜리, 양배추, 갓, 그리고 유채의 개화형을 구분하는데 적용되었다. 각 작물의 PCR 결과와 개화시기에 대한 정보를 통하여 프라이머 세트가 개화형을 판별할 수 있는 마커로 이용될 수 있음이 확인되었다. 이 마커 시스템은 배추 종 작물 육종에 유묘 단계에서 개화형을 판단하는데 이용할 수 을 것이다. 또한 이 결과들은 생체시계 유전자가 배추 종 작물의 개화를 조절하는 좋은 전략이 될 수 있음을 보여주었다.

사사

본 연구는 농촌진흥청 국립농업과학원 연구과제(과제번호: PJ01247203)와 차세대바이오그린 21사업(PJ01106902)의 지원에 의해 수행되었음.

References
  1. Alexandre CM, and Hennig L. (2008) FLC or not FLC:the other side of vernalization. J Exp Bot 59, 1127-1135.
    Pubmed CrossRef
  2. Bieniawska Z, Espinoza C, Schlereth A, Sulpice R, Hincha DK, and Hannah MA. (2008) Disruption of the Arabidopsis circadian clock is responsible for extensive variation in the cold-responsive transcriptome. Plant Physiol 147, 263-279.
    Pubmed KoreaMed CrossRef
  3. Boss PK, Bastow RM, Mylne JS, and Dean C. (2004) Multiple pathways in the decision to flower:enabling, promoting, and resetting. Plant Cell 16, S18-S31.
    Pubmed KoreaMed CrossRef
  4. Dodd AN, Salathia N, Hall A, Kévei E, Tóth R, Nagy F, Hibberd JM, Millar AJ, and Webb AA. (2005) Plant circadian clocks increase photosynthesis, growth, survival, and competitive advantage. Science 309, 630-633.
    Pubmed CrossRef
  5. Edger PP, and Pires JC. (2009) Gene and genome duplications:the impact of dosage-sensitivity on the fate of nuclear genes. Chromosome Res 17, 699-717.
    Pubmed CrossRef
  6. Eriksson ME, and Millar AJ. (2003) The circadian clock:a plant's best friend in a spinning world. Plant Physiol 132, 732-738.
    Pubmed KoreaMed CrossRef
  7. Gómez-Campo C. (1999) Developments in plant genetics and breeding. Biology of Brassica coenospecies 4. Elsevier, Amsterdam Lausanne New York Oxford Shannon Singapore.
  8. Harmer SL. (2009) The circadian system in higher plants. Annu Rev Plant Biol 60, 357-377.
    Pubmed CrossRef
  9. Jack T. (2004) Molecular and genetic mechanisms of floral control. Plant Cell 16, S1-S17.
    Pubmed KoreaMed CrossRef
  10. Kim JA, Kim JS, Hong JK, Lee YH, Choi BS, Seol YJ, and Jeon CH. (2012) Comparative mapping, genomic structure, and expression analysis of eight pseudo-response regulator genes inBrassica rapa. Mol Genet Genomics 287, 373-388.
    Pubmed CrossRef
  11. Kim JA, Yang TJ, Kim JS, Park JY, Kwon SJ, Lim MH, Jin M, Lee SC, Lee SI, Choi BS, Um SH, Kim HI, Chun C, and Park BS. (2007) Isolation of circadian-associated genes inBrassica rapaby comparative genomics withArabidopsis thaliana. Mol Cells 23, 145-153.
  12. Kim JK, Ahn DC, Oh HJ, Kim KH, Choi YM, Oh SY, Kang NJ, Jeong BR, Kim ZH, and Park YH. (2010) Skewed Inheritance of EST-SSR Alleles in Reciprocal Crosses of Cut Roses. Kor. J. Hort. Sci. Technol 28, 618-626.
  13. Kim JS, Chung TY, King GJ, Jin M, Yang TJ, Jin YM, Kim HI, and Park BS. (2006) A sequence-tagged linkage map ofBrassica rapa. Genetics 174, 29-39.
    Pubmed KoreaMed CrossRef
  14. Kim SY, Park BS, Kwon SJ, Kim J, Lim MH, Park YD, Kim DY, Suh SC, Jin YM, Ahn JH, and Lee YH. (2007) Delayed flowering time in Arabidopsis andBrassica rapaby the overexpression of FLOWERING LOCUS C (FLC) homologs isolated from Chinese cabbage (Brassica rapaL. ssp. pekinensis). Plant Cell Rep 26, 327-336.
    Pubmed CrossRef
  15. Koo BH, Yoo SC, Park JW, Kwon CT, Lee BD, An G, Zhang Z, Li J, Li Z, and Paek NC. (2013) Natural variation in OsPRR37 regulates heading date and contributes to rice cultivation at a wide range of latitudes. Mol Plant 6, 1877-1888.
    Pubmed CrossRef
  16. Lou P, Wu J, Cheng F, Cressman LG, Wang X, and McClung CR. (2012) Preferential retention of circadian clock genes during diploidization following whole genome triplication inBrassica rapa. Plant Cell 24, 2415-2426.
    Pubmed KoreaMed CrossRef
  17. Lou P, Xie Q, Xu X, Edwards CE, Brock MT, Weinig C, and McClung CR. (2011) Genetic architecture of the circadian clock and flowering time inBrassica rapa. Theor Appl Genet 123, 397-409.
    Pubmed CrossRef
  18. Lysak MA, Koch MA, Pecinka A, and Schubert I. (2005) Chromosome triplication found across the tribe Brassicaceae. Genome Res 15, 516-525.
    Pubmed KoreaMed CrossRef
  19. Makino S, Kiba T, Imamura A, Hanaki N, Nakamura A, Hanaki N, Nakamura A, Suzuki T, Taniguchi M, Ueguchi C, Sugiyama T, and Mizuno T. (2000) Genes encoding pseudo-response regulators:insight into His-to-Asp phosphorelay and circadian rhythm inArabidopsis thaliana. Plant Cell Physiol 41, 791-803.
    Pubmed CrossRef
  20. Matsushika A, Makino S, Kojima M, and Mizuno T. (2000) Circadian waves of expression of the APRR1/TOC1 family of pseudo- response regulators in Arabidopsis thaliana:insight into the plant circadian clock. Plant Cell Physiol 41, 1002-1012.
    Pubmed CrossRef
  21. McClung CR. (2010) A modern circadian clock in the common angiosperm ancestor of monocots and eudicots. BMC Biol 8, 55.
    Pubmed KoreaMed CrossRef
  22. Michae TP, and SaloméPA McClung CR. (2003) TwoArabidopsiscircadian oscillators can be distinguished by differential temperature sensitivity. Proc Natl Acad Sci U S A 100, 6878-6883.
    Pubmed KoreaMed CrossRef
  23. Millar AJ. (2004) Input signals to the plant circadian clock. J Exp Bot 55, 277-283.
    Pubmed CrossRef
  24. Ming R, Hou S, Feng Y, Yu Q, Dionne-Laporte A, Saw JH, Senin P, Wang W, Ly BV, Lewis KL, Salzberg SL, Feng L, Jones MR, Skelton RL, Murray JE, Chen C, Qian W, Shen J, Du P, Eustice M, Tong E, Tang H, Lyons E, Paull RE, Michael TP, Wall K, Rice DW, Albert H, Wang ML, Zhu YJ, Schatz M, Nagarajan N, Acob RA, Guan P, Blas A, Wai CM, Ackerman CM, Ren Y, Liu C, Wang J, Wang J, Na JK, Shakirov EV, Haas B, Thimmapuram J, Nelson D, Wang X, Bowers JE, Gschwend AR, Delcher AL, Singh R, Suzuki JY, Tripathi S, Neupane K, Wei H, Irikura B, Paidi M, Jiang N, Zhang W, Presting G, Windsor A, Navajas-Pérez R, Torres MJ, Feltus FA, Porter B, Li Y, Burroughs AM, Luo MC, Liu L, Christopher DA, Mount SM, Moore PH, Sugimura T, Jiang J, Schuler MA, Friedman V, Mitchell-Olds T, Shippen DE, dePamphilis CW, Palmer JD, Freeling M, Paterson AH, Gonsalves D, Wang L, and Alam M. (2008) The draft genome of the transgenic tropical fruit tree papaya (Carica papayaLinnaeus. Nature 452, 991-996.
    Pubmed KoreaMed CrossRef
  25. Mizuno T, and Nakamichi N. (2005) Pseudo-response regulators (PRRs) or true oscillator components (TOCs). Plant Cell Physiol 46, 677-685.
    CrossRef
  26. Mouradov A, Cremer F, and Coupland G. (2002) Control of flowering time:interacting pathways as a basis for diversity. Plant Cell 14, S111-S130.
    Pubmed KoreaMed CrossRef
  27. Murakami M, Ashikari M, Miura K, Yamashino T, and Mizuno T. (2003) The evolutionarily conserved OsPRR quintet:rice pseudoresponse regulators implicated in circadian rhythm. Plant Cell Physiol 44, 1229-1236.
    Pubmed CrossRef
  28. Murakami M, Matsushika A, Ashikari M, Yamashino T, and Mizuno T. (2005) Circadian-associated rice pseudo response regulators (OsPRRs):insight into the control of flowering time. Biosci. Biotechnol. Biochem 69, 410-414.
    CrossRef
  29. Mun JH, Kwon SJ, Yang TJ, Seol YJ, Jin M, Kim JA, Lim MH, Kim JS, Baek S, Choi BS, Yu HJ, Kim DS, Kim N, Lim KB, Lee SI, Hahn JH, Lim YP, Bancroft I, and Park BS. (2009) Genome-wide comparative analysis of theBrassica rapagene space reveals genome shrinkage and differential loss of duplicated genes after whole genome triplication. Genome Biol 10, R111.
    Pubmed KoreaMed CrossRef
  30. Nakamichi N, Kita M, Niinuma K, Ito S, Yamashino T, Mizoguchi T, and Mizuno T. (2007) Arabidopsisclock-associated pseudo- response regulators PRR9, PRR7 and PRR5 coordinately and positively regulate flowering time through the canonical CONSTANS dependent photoperiodic pathway. Plant Cell Physiol 48, 822-832.
    Pubmed CrossRef
  31. Omolade O, Müller AE, Jung C, and Melzer S. (2016) BvPRR7 is a cold responsive gene with a clock function in beet. Biologia Plantarum 60, 95-104.
    CrossRef
  32. Osborn TC, Kole C, Parkin IAP, Sharpe AG, Kuiper M, Lydiate DJ, and Trick M. (1997) Comparison of flowering time genes inBrassica rapaB.napusandArabidopsis thaliana. Genetics 146, 1123-1129.
  33. Ramírez-Carvajal GA, Morse AM, and Davis JM. (2008) Transcript profiles of the cytokinin response regulator gene family inPopulusimply diverse roles in plant development. New Phytol 177, 77-89.
  34. Ream TS, Woods DP, and Amasino RM. (2013) The molecular basis of vernalization in different plant groups. Cold Spring Harb Symp Quant Biol 2012 77, 105-115.
  35. Simpson GG, Gendall AR, and Dean C. (1999) When to switch to flowering. Annu Rev Cell Dev Biol 99, 519-550.
    Pubmed CrossRef
  36. Takata N, Saito S, Saito CT, and Uemura M. (2010) Phylogenetic footprint of the plant clock system in angiosperms:evolutionary processes of pseudo-response regulators. BMC Evol Biol 10, 126.
    Pubmed KoreaMed CrossRef
  37. Town CD, Cheung F, Maiti R, Crabtree J, Haas BJ, Wortman JR, Hine EE, Althoff R, Arbogast TS, Tallon LJ, Vigouroux M, Trick M, and Bancroft I. (2006) Comparative genomics ofBrassica oleraceaandArabidopsis thalianareveal gene loss, fragmentation, and dispersal after polyploidy. Plant Cell 18, 1348-1359.
    Pubmed KoreaMed CrossRef
  38. Yang TJ, Kim JS, Kwon SJ, Lim KB, Choi BS, Kim JA, Jin M, Park JY, Lim MH, Kim HI, Lim YP, Kang JJ, Hong JH, Kim CB, Bhak J, Bancroft I, and Park BS. (2006) Sequence-level analysis of the diploidization process in the triplicated FLOWERING LOCUS C region ofBrassica rapa. Plant Cell 18, 1339-1347.
    Pubmed KoreaMed CrossRef
  39. Yuan YX, Wu J, Sun RF, Zhang XW, Xu DH, Bonnema G, and Wang XW. (2009) A naturally occurring splicing site mutation in theBrassica rapa FLC1gene is associated with variation in flowering time. J Exp Bot 60, 1299-1308.
    Pubmed KoreaMed CrossRef


September 2018, 45 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM