search for




 

Arabidopsis SHL1 protein binds to a specific sequence of the TCH4 promoter in vitro
J Plant Biotechnol 2018;45:71-76
Published online March 31, 2018
© 2018 The Korean Society for Plant Biotechnology.

Ji Hyea Lee, and Man-Ho Oh

Department of Biological Sciences, Chungnam National University, Daejeon 34134, Korea,
Department of Biological Sciences, Chungnam National University, Daejeon 34134, Korea
Correspondence to: e-mail: manhooh@cnu.ac.kr
Received February 2, 2018; Revised February 13, 2018; Accepted February 13, 2018.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

The ArabidopsisSHL1 (Short Life 1) gene encodes a small nuclear protein that is critical for the proper expression of the developmental programs that are responsible for controlling plant stature, senescence, flowering and seed formation. The SHL1 contains a single PHD finger domain that works in conjunction with a bromo-adjacent homology (BAH) motif that is thought to function significantly in protein-protein interactions. The TCH4 gene of the Arabidopsis encodes a xylogluclan endotransglucosylase/hydrolase that is transcriptionally regulated by a variety of hormonal and environmental stimuli. We report here in this study that the SHL1 exhibits sequence specific DNA binding properties, recognizing a 14 bp region of the TCH4 promoter in vitro, spanning nucleotides –262 to –275 (GGAAAAAACTCCCA). Chiefly, the nuclear extracts of Arabidopsis contain a protein with similar binding properties as recombinant SHL1, which is absent in identified transgenic plants that are noted as expressing antisense SHL1 RNA. Interestingly, the SHL1 gene expression with a BL treatment in characteristically wild types of seedlings showed that the transcript level of SHL1 is significantly down regulated by the BL treatment. The SHL1 may play a subtle role in regulating the kinetics of induction of the TCH4 in response to several stimuli in vivo.

Keywords : Arabidopsis, DNA binding protein, transcriptional regulation, TCH4 promoter
서론

애기장대 SHL1(Short Life 1) 유전자는 BAH 도메인과 C-말단에 PHD finger 영역(PHD finger domain)을 가진 작은 핵단백질을 암호화한다. SHL1 유전자를 과발현시켰을 때, 생장이 억제되고 개화 및 노화가 촉진되며, 종자 및 꽃 형성에 장애가 생긴다. 반면에, 안티센스 억제의 경우, 왜소성(dwarfism)을 유발하고, 생장이 지연되며(Muessig et al. 2000), SHL1 유전자 발현의 변화에 의한 이러한 식물의 발달 측면에서의 결함을 유도하는 분자 메커니즘에 대해서는 아직까지 밝혀진 바가 없다. 애기장대 TCH4 (TOUCH4) 유전자는 XTH (Xyloglucan Endotransglucosylase/Hydrolase)를 암호화하며, 이는 발달 과정에서 세포벽 형성에 관여하는 것으로 보고되었다(Xu et al. 1995). TCH4 유전자는 Brassinosteroids (BRs) 호르몬과 옥신 (Auxin), 암처리(Darkness), 접촉자극(Touch), 온도와 같은 일부 자극에 의해 전사 수준에서 조절된다(Iliev et al. 2002). BR 호르몬은 식물 스테로이드 호르몬으로, 식물의 생장과 발달, 생물적・비생물적 스트레스에 대한 반응 등 식물의 생장에 있어 많은 측면에 관여한다. BR 신호전달체계에서의 분자적 요인들은 광범위하게 연구되어 왔으며, 세포막 수용체인 BRI1 (Brassinosteroid Insensitive 1)과 보조 수용체(co- receptor)인 BAK1 (BRI1-Associated Receptor Kinase 1)으로부터 시작하여, 결과적으로 BES1/BZR1 전사인자군(BR 호르몬에 의한 식물의 생장 및 스트레스 체계를 강화시키는 수천 개의 유전자들의 발현을 조절하는 전사 네트워크에 직접적으로 작용)의 활성으로 BR 신호전달체계는 종결된다(Nolan et al. 2017).

서브마이크로몰 농도의 BL (brassinolide)과 24-epiBL (epibrassinolide), 두 BR 호르몬은 애기장대의 꽃자루(peduncle) 신장을 자극하며, 상대적으로 뿌리 신장을 억제한다. 또한, BL 호르몬은 애기장대의 꽂자루와 식물 전체로부터 in vitro에서 번역 가능한 특이적 mRNA의 발현양에 영향을 미친다. 애기장대 axr1(옥신 불감성 돌연변이) 식물체에서의 뿌리 신장은 2,4-D가 아닌 24-epiBL에 의해 억제되는데, 이와 같은 생리적 반응에서 생장 조절자로서 작용하는 독립적 경로를 보여주었다(Clouse et al. 1993).

SHL1 단백질은 전사 조절자의 특성을 보이며, SHL1 유전자의 안티센스 전사체를 발현시킨 형질전환 식물체의 왜소성과 발달 지연을 보이는데, 이는 BR 호르몬 생합성 혹은 BR 신호전달을 포함한 다양한 발달 체계에서의 애기장대 돌연변이체의 표현형과 다소 유사하다(Muessig et al. 2000). SHL1과 TCH4가 같은 발달 체계에 관여할 가능성을 확인하기 위해 두 유전자 사이의 직접적인 상호작용을 확인하였다. 본 연구는 SHL1이 in vitro에서 TCH4 유전자 프로모터의 14bp 염기서열을 인식하는 서열 특이적 DNA 결합 단백질이며, SHL1 유전자가 전사 수준에서 BL 호르몬 처리에 의해 크게 억제되고 있음을 본 연구 결과를 통하여 보고하고자 한다.

재료 및 실험 방법

재조합 단백질 클로닝과 단백질 정제

애기장대 하배축(Col-0; 3-day-old)으로부터 유래한 cDNA 라이브러리(Arabidopsis Biological Resource Center stock number CD4-14)에서 크기 선별을 통해 SHL1 cDNA (full-length)를 분리하였다. Standard Plaque Lift Procesure (Ausubel et al., 1994)로 3번 반복하여 선별하였으며, 탐침(probe)으로 애기장대 EST 181F3T7을 이용하였다. 12개의 positive clone을 얻었고, in vivo 절제(excision) 후, 아가로스 겔 전기영동으로 크기를 측정하였으며, 가장 큰 플라스미드를 dye-terminator DNA sequencing 하였다.

Insert로는 SHL1 cDNA (full-length)의 PCR 증폭 샘플을 대장균(E. coli) 발현벡터 pCAL-n-EK (Stratagene La Jolla, CA, USA)를 이용하여 LIC (Ligation independent cloning) 하였고, 그 결과 CBP (calmodulin binding peptide)를 SHL1 N-말단에 융합하였다. 이러한 40개 아미노산의 N-말단 첨가를 통해 칼슘 존재 하에 칼모듈린(calmodulin) 친화성 수지에서 재조합 단백질을 정제하였다. LIC 프라이머를 이용한 insert DNA 증폭 과정과 pCAL-n-EK 벡터로의 융합, 이를 E. coli BL21 (DE3)pLysS cell에 형질전환하여 재조합 단백질을 과발현시켜 칼모듈린 친화성 크로마토그래피로 CBP-SHL1 재조합 단백질을 정제하는 모든 과정은 Affinity LIC Cloning & Protein Purification Kit Manual (http://www.stratagene.com/manuals/204300.pdf)에 명시된 방법으로 진행하였으며, 그 결과 완성된 재조합 단백질은 SHL1 단백질의 전체 228개 아미노산 프레임에 CBP 친화성 표지(MKRRWKKNFIAVSAANRFKKISS SGALLVPRGSGSGDDDDK)가 융합되어 있다.

2차 E. coli expression construct는 pCAL-n-EK vector를 이용하여 만들었으며, SHL1 단백질의 PHD finger domian을 제거하였다. PHD1 프라이머(5’ – CTCGAATTCCT TGAACACG GTGACTCTGTCAGG – 3’)는 SHL1 단백질의 1 ~ 141 아미노산을 암호화하는 DNA fragment를 합성하기 위해 사용한 LIC 5’ 프라이머와 결합하며, 뒷부분에 EcoR1 site를 조작한 후, EcoR1 site PHD2 프라이머(5’ – AAGGAATTCGA GTCCCCA CAACAGCAGAATTTG – 3’)는 SHL1 단백질의 188~228 아미노산을 암호화하는 DNA fragment를 합성하기 위해 사용한 LIC 3’ 프라이머와 결합하며, 앞부분에 EcoR1 site를 삽입하였다. 두 fragment의 EcoR1 절단 후, 이를 ligation한 결과, PHD 집게 영역의 전체 46개 아미노산이 4개의 아미노산(Lys-Glu-Phe-Glu)으로 대체된 SHL1 단백질을 암호화하는 선형 DNA fragment를 만든 후, 높은 정확성을 위해 모든 증폭과정에서 pfu DNA polymerase (Stratagene)를 사용하였으며, DNA 서열 분석을 통해 재조합 벡터을 완성하였다.

Gel Mobility Shift Assay

PCR 증폭을 통해 TCH4 유전자 프로모터의 각각 다른 부분의 DNA 탐침을 합성하였다. tch41f (5’ – AACCGCGTGATT TCCAAATCC – 3’)와 tch41r (5’ – GGTTCGTATAGAGGAAG GTTCG – 3’) 프라이머를 이용하여 TCH4 유전자 프로모터의 -186 to -61에 해당하는 PCR 산물, tch42f (5’ – GTGGTAAAGA ATCCAACTCTC – 3’)와 tch42r (5’ – TTGGCTTTGGAAATCA CGCGG – 3’) 프라이머를 이용하여 -314 to -163에 해당하는 PCR 산물, tch43f (5’ – GAGACCACAAAAATTACTCAAA GTTC – 3’)와 tch43r (5’ – GAGAGTTGGATTCTTTACCAC – 3’) 프라이머를 이용하여 -588 to -294에 해당하는 PCR 산물을 합성하였다. 각각의 PCR 과정에서, 100 µl PCR 반응물에는 buffer (10 mM Tris-HCl pH 9.0, 50 mM KCl, 0.1% Triton X-100, 0.8 mg/ml bovine serum albumin, 1.8 mM MgCl2)와 200 µM dNTPs, TCH4 유전자 프로모터 (-958 to -1)가 삽입되어 있는 Bluescript KS-plasmid (Stratagene) 5 ng, 각각의 프라이머 1 µM, TAQ DNA polymerase (Promega, Madison, WI, USA) 10 units, TAQ- Start Antibody (Clontech, Palo Alto, CA, USA)가 포함되게 하였다. 2분 동안 94℃에서 denaturation하였고, 30초 동안 94°C; 30초 동안 58°C; 1분간 72°C 조건으로 PCR을 수행하여 DNA를 증폭하였으며, 5분간 72°C에서 extension하였다. 이후 QIAquick Gel Extraction Kit (Qiagen, Calencia, CA, USA)를 이용하여 정제하였으며, TCH4 유전자 프로모터의 -285 to -256에 상응하는 30-mer oligonucleotide를 합성하였다.

CIAP (calf intestinal alkaline phosphatase)로 PCR fragment를 탈인산화한 후, phenol/chloroform extraction과 에탄올 침전(ethanol precipitation)을 수행한 후, 탈인산화된 DNA (1ng/µl)를 T4 polynucleotide kinase (Promega)와 1 µCi/μl [γ-32P]ATP (3,000 Ci/mmol, New England Nuclear, Boston, MA, USA)을 이용하여 5’-말단에 표지하였다. NucTrap column (Stratagene)을 통해 결합되지 않은 뉴클레오티드를 DNA로부터 분리하였다. 애기장대 핵단백질 추출 및 단백질-DNA 결합 반응에 대한 세부사항은 Mikami et al. (1995)에 명시되어 있다. poly dI-dC로 비특이적 결합을 억제하였고, 최종 결합 반응은 non-denaturing 5% PAGE (in 1X TBE)로 확인하였으며, 이후 방사선자동사진법(autoradiography)으로 결과를 확인하였다.

Linker Scanning Mutagenesis

TCH4 유전자 프로모터의 -399 to -180에 해당하는 영역에서 각각 10 bp씩 피리미딘-퓨린 치환을 통해 총 12개의 linker scanning 돌연변이를 3-step PCR mutagenesis (Li and Shapiro, 1993) 방법으로 준비하였다. TCH4 유전자 프로모터의 -958 to -1에 해당하는 영역(nucleotides 40,185 to 39,227 of Genbank accession number AB011482)을 포함하고 있는 pBITG를 주형으로 하였다. 1-step PCR에서 3’-프라이머로 lsp3 (5’ – CTCAG GATCCTCTAGATGCATGCTCGAT – 3’)를 사용하였으며, 5’-프라이머로는 각각 30-mer sequence (wild-type TCH4 유전자 프로모터의 10 bp; 피리미딘-퓨린 간 치환된 10 bp; wild-type TCH4 유전자 프로모터의 10 bp)를 사용하였다. 5’-프라이머로 사용된 30-mer sequence는 다음과 같다 (밑줄 친 부분 : 돌연변이서열).

1-step PCR에서 얻은 이중가닥 산물을 lsp3 프라이머와 함께 2-step 단일가닥 PCR에서 사용하였으며, 이로 얻은 단일가닥 산물을 5’-프라이머로 lsp5 (5’ – CTCAAAGCTTGCATG CCTGCAG GTCGAC – 3’)와 함께 3-step PCR에서 사용하였다.

RNA 추출 및 RT-PCR

Total RNA를 추출하기 위해, 조직 100 mg 당 500 µL TRIzol reagent (RNAiso plus, Takara Bio Inc., Japan)를 넣어 plastic- Teflon homogenizer로 균질화하였다. 추출된 RNA에 RNase-free DNase 1 (Ambion)을 처리하여 genomic DNA를 제거하였고, NonoDrop (Thermo)으로 RNA 농도를 측정하였으며, 아가로스 겔 전기영동으로 순도를 평가하였다. 이후 ReverTra Ace-α-First-strand cDNA Synthesis kit (Toyobo Co., Ltd. Japan)를 이용하여 cDNA를 합성하였다.

Genomic DNA의 증폭을 최소화하고, 유전자 특이성을 위해 엑손 부위의 cDNA sequence에서 프라이머를 디자인하였고, cDNA를 주형으로 한 standard PCR을 통해 각각의 프라이머의 특이성을 검사하였으며, 아가로스 겔 전기영동으로 band의 순도를 평가하였다. 3번 반복하여 RT-PCR을 수행하였으며, 이 전체 과정 또한 독립적으로 3번 반복하여 수행하였다.

결과

SHL1과 TCH4 사이의 직접적인 상호작용을 확인하고자 본 연구에서는 in vitro에서 SHL1 재조합 단백질이 TCH4 유전자 프로모터에 결합하는지 확인하기 위해 EMSA (Gel Mobility Shift Assays)를 수행하였다. Figure 1A에서 보는 것처럼, CBP- SHL1 재조합 단백질이 TCH4 유전자 프로모터의 -314 to -163에 해당하는 PCR fragment의 이동을 지연시키고 있으며, -588 to -294 영역과 -186 to -61 영역에서는 결합하지 않았다. 각각의 PCR fragment가 겹치는 부분을 고려하였을 때, CBP-SHL1 재조합 단백질이 TCH4 유전자 프로모터의 -293 to -187 영역에서 결합하는 것으로 사료된다. CBP-SHL1 재조합 단백질의 결합 서열을 보다 구체적으로 확인하기 위해, -300 to -180 영역에서 연속적으로 10 bp씩 돌연변이화한 12개의 연결 주사 (linker scanning) 돌연변이를 만들었고, Figure 1B에서 보다시피 -260 to -270 영역과 -270 to -280 영역 돌연변이의 경우에 CBP-SHL1 재조합 단백질과의 결합이 현저히 감소하였다. 따라서, in vitro에서의 결합에 있어, -260 to -280 영역에 CBP-SHL1 재조합 단백질이 인식하는 서열이 존재할 것으로 사료되며, 이를 입증하기 위해 -256 to -285에 상응하는 상보적 염기서열을 합성하였다. Figure 2에서 보는 것처럼, 표지한 30-mer sequence에서 CBP-SHL1 재조합 단백질이 충분히 결합하고 있으며, 표지하지 않은(cold probe) 30-mer sequence의 각각의 농도에서는 표지한 30-mer sequence와 경쟁하고 있음을 보여준다. 이는 30-mer sequence의 결합 특이성을 보여주고 있다.

Fig. 1.

The Recombinant SHL1 binds to a specific sequence of the TCH4 promoter in vitro. (A) The gel mobility shift assays in the presence of poly dI-dC show that the recombinant SHL1 (CBP-SHL1) binds to a sequence within a PCR fragment representing -163 to -314 of the TCH4 promoter. (B) The linker scanning mutagenesis was performed on successive 10 bp fragments from -180 to -300 of the -163 to -314 PCR fragment, which resulted in an exchange of pyrimidines and purines within the 10 bp region


Fig. 2.

The recombinant SHL1 binds a synthetic 30-mer. Gel mobility shift assays in the presence of the poly dI-dC to indicate that the CBP-SHL1 binds a double-stranded oligonucleotide representing -256 to -285 of the TCH4 promoter. The arrow shows a band corresponding to the labeled oligonucleotide complexed with CBP-SHL1, which disappears when incubated with the unlabeled competitor


30 bp 영역 내에서 CBP-SHL1 재조합 단백질이 결합하는 특정 염기 서열을 밝히기 위해, 6개의 상보적 올리고뉴클레오티드를 합성하였으며, 각각은 연속적으로 5 bp씩 피리미딘-퓨린 간 치환되어 있다. Figure 3에서 보는 것처럼, -285 to -276과 -260 to -256 사이의 돌연변이는 CBP-SHL1 재조합 단백질이 결합하는데 영향을 거의 주지 않았으나, -275 to -261 사이의 돌연변이에서는 전혀 결합하지 않았다. 따라서, CBP- SHL1 재조합 단백질이 인식하는 부분이 이 15 bp 염기서열 내에 있을 것으로 사료된다. 인식 서열을 보다 구체적으로 알아내기 위해 -275 to -260 서열 내에서 연속적으로 2 bp씩 피리미딘-퓨린 간 치환하여 실험하였으며, Figure 3에서 보는 것처럼, -275 to -262 서열 내의 모든 돌연변이에서 CBP-SHL1 재조합 단백질의 결합이 급격히 감소하였다. 이는 in vitro에서 14 bp sequence (GGAAAAAACTCCCA)에 CBP-SHL1 재조합 단백질이 인식하는 영역이 존재함을 보여준다.

Fig. 3.

The refinement of the recombinant SHL1 binding site. The gel mobility shift assays were performed as described in Fig. 2 using the wild-type -256 to -285 TCH4 promoter sequence, or a similar double-stranded oligonucleotide containing the indicated mutations. The panel on the left shows that the noted sequences between -261 and -275 are essential for CBP-SHL1 binding, while the panel on the right further refines the binding sequence to -262 to -275 (GGAAAAAACTCCCA)


Figures 1-3의 결과는 in vitro에서 SHL1 재조합 단백질이 TCH4 유전자 프로모터의 -275 to -262에 해당하는 특정 서열에 결합하고 있음을 명백하게 보여주고 있으며, 생체 내에서 또한 SHL1 단백질이 이와 유사한 결합 성질을 보일 가능성을 확인하기 위해, 본 연구진은 애기장대 야생형(C24 ecotype)과 SHL1 유전자가 발현하지 않는 2개의 독립적인 antisense SHL1 line(α-SHL-33, α-SHL-39)으로부터 핵단백질을 추출하였다. Figure 4에서 보는 것처럼, C24 핵단백질 추출물과 표지한 TCH4 -285 to -246 영역에서 모두 3개의 밴드를 볼 수 있으며, 3개 중 2개의 단백질이 SHL1 재조합 단백질처럼 TCH4-M4 (-270 to -265 돌연변이)와 TCH4-M5 (-265 to -260 돌연변이)에 대해 같은 결합 특이성을 가지고 있으나, 가장 위에 나타난 밴드의 단백질만이 antisense SHL1 line의 핵 추출물에 존재하지 않은 것으로 보았을 때 이 단백질이 생체 내 SHL1 단백질일 가능성이 높다.

Fig. 4.

The CBP-SHL1 binding to the TCH4 promoter is PHD finger-dependent. The gel mobility shift assays were performed as described in Fig. 2 using the wild-type 0256 to -285 TCH4 promoter sequence. The CBP-SHL1w/oPHD, which lacks the PHD finger, failed to bind the TCH4 promoter sequence


TCH4 유전자 프로모터-GUS (β-glucuronidase)를 이용한 앞선 연구들은 -958 to -1 사이 염기서열이 열처리 (heat), 암처리 (darkness), 접촉자극 (touch), BR 호르몬, 옥신(auxin)에 대한 GUS reporter gene의 발현 유도를 설명하기에 충분하며 (Iliev et al., 2002; Xu et al., 1995), -260 to -280 영역이 이러한 자극에 대한 TCH4 유전자 프로모터의 반응에 필수적일 것으로 예상할 수 있다. 또 다른 흥미로운 연구 결과로서, SHL1 유전자 발현에 있어 BL 호르몬의 영향을 확인하기 위해, 본 연구진은 애기장대 야생형으로부터 total RNA를 추출하였고, RT-PCR을 통해 SHL1, TCH4 유전자의 발현량을 측정하였다. Figure 5에서 보는 것처럼, SHL1, TCH4 유전자의 발현량이 BL 호르몬 처리에 의해 상대적으로 급격히 감소 및 증가하였다. 따라서 SHL1 단백질이 TCH4 유전자 발현에 있어 음성 조절자(negative regulator)로서 기능할 가능성이 있는 것으로 사료된다.

Fig. 5.

The expression of SHL1 and TCH4 in wild type seedlings. The total RNA was isolated from wily-type Arabidopsis seedlings. The plants were treated with 0.001% ethanol or 10-7M brassinolide for 90 minutes prior to the harvest


논의

EMSA 기법 (gel mobility shift assays)과 재조합 단백질을 이용하여, 본 연구에서는 SHL1 단백질이 in vitro에서 GGAAAAA ACTCCCA 서열을 인식하는 서열 특이적 DNA 결합 단백질 임을 제시한다. 이 서열은 애기장대 TCH4 유전자 프로모터의 -262 to -275 영역에 존재하며, 돌연변이 분석 결과 이 염기서열 내에 2 bp씩 치환으로 SHL1 재조합 단백질의 결합이 급격히 감소하였기 때문에 이 염기서열의 최소 7개의 염기는 결합에 필수적임을 알 수 있다. 그러나 이 서열은 6개의 연속적인 아데닌 (A)를 가지고 있는데, SHL1 재조합 단백질이 polyA-rich 영역에서는 특이적 결합을 보이지는 않았다. 본 연구진은 14bp 서열 중 SHL1 단백질의 인식에 영향을 주지 않으면서 치환될 수 있는지를 확인하기 위해 각각 1 bp씩 치환한 실험에 대해 아직까지는 수행하지는 않았다. 이러한 각각의 염기에 대한 정보 없이는 SHL1 단백질의 인식 모티프의 발달과 애기장대 게놈(genome)에 존재하는 그러한 서열 패턴의 양을 확인하는 것이 불가능하다. 예를 들어, 14bp 서열은 애기장대 게놈(AT5g57560, TCH4)에 정확히 딱 하나 존재하지만, 끝이 잘린 불완전한 경우(GAAAAAACTCCCA)는 매우 많이 존재한다.

in vitro에서는 SHL1 단백질이 명백한 서열 특이적 DNA 결합 단백질이지만, TCH4 유전자 발현을 조절하는 데에 있어 직접적인 역할에 대해서는 식물체 핵 내에서 SHL1 단백질과 TCH4 유전자 프로모터의 -262 to -275 영역과의 상호작용을 입증할 필요가 있다. 핵 추출물에는 SHL1 재조합 단백질과 똑같이 in vitro에서의 결합성을 갖는 단백질이 포함되어 있으며, 이 단백질이 생체 내 SHL1 단백질이거나, 활성화하기 위해 SHL1을 필요로 하는 또다른 서열 특이적 DNA 결합 단백질일 것으로 사료된다. 그러나 in vivo footprinting (Paul and Feri, 1998)과 같은 기술을 이용한 TCH4 유전자 프로모터와 SHL1 단백질의 결합에 대한 직접적 증거는 식물계에서 SHL1의 전사 조절 역할에 대한 확인이 필요하다.

TCH4 유전자 조절에 있어 SHL1의 기능적 중요성을 이해하는 또 다른 접근은 in vivo에서 SHL1 단백질의 결합 영역의 중요성을 연구하는 것이다. TCH4 유전자의 발현은 접촉자극, 암처리, 온도와 같은 환경자극과 더불어 BR 호르몬과 옥신에 의해 조절되며, 조직 확장 과정, 특히 암조건의 하배축과 세포벽 형성 중에 있는 기관에서 TCH4 유전자가 크게 발현한다(Xu et al., 1995). 5’ 말단의 비번역(5’-UTR) 서열이 결핍된 애기장대 TCH4 유전자의 프로모터:GUS 융합 결과, 비형질전환 식물체에서 보여지는 TCH4 유도발현에서와 같이, GUS 유도 발현과 유사한 패턴을 보였는데, TCH4 유전자가 다양한 자극에 의해 조절되고 있음을 보여준다. 보고된 바에 따르면, TCH4 유전자 프로모터의 -45 to -147에 해당하는 102 bp fragment는 암처리, 접촉 자극, 열처리, BR 호르몬 자극에 대한 발현을 유도하는 데에 충분하다(Iliev et al., 2002). 따라서, in vivo에서의 SHL1 단백질과 TCH4 유전자 프로모터 간의 결합이 우리가 in vitro에서 확인한 것과 같은 특이성을 갖는다면, TCH4 유전자 발현 유도에 있어 -260 to -280 영역에서의 SHL1 단백질 결합이 필요하지는 않겠지만, 대신 이 서열에 돌연변이가 생겼을 때, 접촉 자극에 대한 유도 역학이 이에 대한 대안이 되는 것으로 보인다. 본 연구진이 이 서열에 대한 in vivo에서의 SHL1 단백질의 결합에 대한 데이터를 축적할 때 까지는 이러한 반응에 SHL1 단백질이 관여하는지에 대해 추측하기에는 아직 이르다.

BR 호르몬 처리에 따른 seedling 단계의 SHL1, TCH4 유전자 발현에 대한 RT-PCR 자료를 바탕으로, SHL1 단백질이 TCH4 유전자의 음성 조절자(negative regulator)로서 작용하는 것이 가능하며, 다양한 유도 자극이 없는 경우 유전자 발현을 제한한다. 이러한 TCH4 유전자 발현의 억제가 TCH4 유전자 프로모터의 -262 to -275 영역에서의 결합에 대한 직접적인 결과인지, 아니면 다른 단백질을 통해 간접적으로 일어나는지에 대해서는 아직까지 밝혀지지 않았다.

결론적으로, SHL1 단백질이 in vivo에서 TCH4 유전자 조절 과정에 있어 중요한 구성요소인지 아직 판명되지 않았지만, 본 연구진이 확인한 in vitro에서의 결합 체계는 분명히 분자 메커니즘에서의 보다 심도 있는 연구에 유용한 정보로 활용 가능 할 것이다.

사사

This work was supported by a research grant from Chungnam National University (CNU) and by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through the Golden Seed Project, Ministry of Agriculture, Food and Rural Affairs (MAFRA) (213006-05- 1-SBC30).

References
  1. Ausubel FM, Brent R, Kingston RE, Moore DD, Siedman JG, Smith JA, and Struhl K. (1994). Current Protocols in Molecular Biology .
  2. Beato M, Herrlich P, and Schutz G. (1995) Steroid hormone receptors:many actors in search of a plot. Cell 83, 851-857.
    CrossRef
  3. Bent A.F, Kunkel B.N, Dahlbeck D, Brown K.L, Schmidt R, Giraudat J, Leung J, and Staskawicz B.J. (1994) RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes. Science 265, 1856-60.
    Pubmed CrossRef
  4. Clouse S.D, Hall A.F, Langford M, McMorris T.C, and Baker M.E. (1993) Physiological and molecular effects of brassinosteroids on Arabidopsis thaliana. J Plant Growth Regul 12, 61-66.
    CrossRef
  5. Iliev E.A, Xu W, Polisensky D.H, Oh M.H, Torisky R.S, Clouse S.D, and Braam J. (2002) Transcriptional and posttranscriptional regulation of Arabidopsis TCH4 expression by diverse stimuli. Roles of cis regions and brassinosteroids. Plant Physiol 130, 770-83.
    Pubmed KoreaMed CrossRef
  6. Li XM, and Shapiro LJ. (1993) Three-step PCR mutagenesis for ‘linker scanning’. Nucleic Acids Res 21, 3745-8.
    CrossRef
  7. . (1995) Gel mobility shift assay. “Plant Molecular Biology Mannual.” 1, 1-14.
  8. Muessig C, Kauschmann A, Clouse SD, and Altmann T. (2000) The Arabidopsis PHD-finger protein SHL is required for proper development and fertility. Molecular and General Genetics 264, 363-370.
    CrossRef
  9. Nolan T, Chen J, and Yin Y. (2017) Cross-talk of Brassinosteroid signaling in controlling growth and stress responses. Biochem J 474, 2641-2661.
    Pubmed CrossRef
  10. . (1998) In vivo footprinting in Arabidopsis. Arabidopsis Protocols.” , 417-429.
    CrossRef
  11. Xu W, Purugganan MM, Polisenksy DH, Antosiewicz DM, Fry SC, and Braam J. (1995) Arabidopsis TCH4 regulated by hormones and the environment, encodes a xyloglucan endotransglycosylase. Plant Cell 7, 1555-1567.
    Pubmed KoreaMed CrossRef


September 2018, 45 (3)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM