search for




 

Detection and environmental unintentional release monitoring of living modified maize (Zea mays L.) in Gyeonggi-do of South Korea in 2014
J Plant Biotechnol 2018;45:77-82
Published online March 31, 2018
© 2018 The Korean Society for Plant Biotechnology.

Su Young Shin, Jeong Chan Moon, Wonkyun Choi, Il Ryong Kim, Beom-Ho Jo, and Jung Ro Lee

Division of Ecological Conservation, National Institute of Ecology (NIE), Seocheon 33657, Korea,
Bioresources Industrialization Support Division, Freshwater Bioresources Utilization Division, Nakdonggang National Institute of Biological Resources (NNIBR), Sangju 37242, Korea,
Bio-industrial Team, Bio Center, Chungnam Techno Park, Yesan, 32415, Korea
Correspondence to: e-mail: leejr73@nie.re.kr
Received December 4, 2017; Revised December 8, 2017; Accepted December 15, 2017.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

In South Korea, LM crops are not allowed to grow locally, but have been allowed to be imported as food and feed purposes. Currently, the typical LMO imports are continuously increasing in the region of South Korea. In 2014, we carried out a review of the environmental release monitoring of LM maize (Zea mays L.) in Gyeonggi-do of South Korea, and analyzed volunteer samples using strip test kits and polymerase chain reaction (PCR) methods. We thereby collected 44 volunteers of released LM maize in 169 locations around ports, from roadsides, feed factories and stockbreeding farmhouses. We found 4 positive samples at 3 sites using strip test kits. Based on the PCR analysis, the LM maize plants were found using event-specific primers. These results suggested that our monitoring is necessary to detect the presence of released LM maize in the natural environment of South Korea.

Keywords : Living modified organisms (LMO), Event, strip test kit, maize
서언

옥수수(Zea mays L.)는 벼과(Gramineae)에 속하는 한해살이 식물로 남아메리카가 원산지로 알려져 있다. 옥수수는 밀, 벼와 함께 세계 3대 작물 중 하나로서 가장 일반적으로 알려진 재배종으로 맛이 좋고 소화가 잘되며 열량가가 높아 식품용, 사료용으로 이용될 뿐만 아니라 오일, 에탄올 생산원료 등 공업용으로도 이용되고 있다(KBCH 2015). 국내 옥수수 소비량은 수입현황으로 확인 할 수 있는데 이는 국내 옥수수 생산량 즉, 국내 옥수수 자급률이 1% 정도로 매우 낮아 수입 의존도가 매우 높기 때문이다. 2014년 기준으로 국내 옥수수 수입량은 천만 톤을 넘어 1,024만 톤 가량을 수입하였고 이 중 80%는 사료용으로 나머지는 가공용으로 이용되고 있다(KBCH 2015). 국내 옥수수 수입량의 대부분은 LM작물에 의존하고 있다. LM 옥수수는 2014년 기준으로 전체 LM작물 재배면적의 약 30%에 해당하는 5,520만 ha, 총 17개국에서 재배되었다(ISAAA 2015). 국내 수입되고 있는 옥수수는 LMO 작물 주요 재배국가인 미국, 브라질, 우크라이나 등에서 수입되고 있으며 2014년 기준 국내 옥수수 수입량에서 일반 옥수수 대비 LM 옥수수 비율이 93.9%를 차지하는 것으로 확인 되었다. 국내에 수입 승인된 LM 옥수수는 2015년 12월 기준으로 총 70개이며 단일이벤트 21개와 후대교배종 49개로 나타났다. 그리고 용도별로는 사료용 66개, 식품용 69개가 수입 승인되었다. 수입되고 있는 LM 옥수수 작물 대부분은 제초제 내성과 조명충 나방으로부터 보호 할 수 있는 Bt 단백질을 도입한 해충 저항성, 웅성불임성 및 내재해성 등 1세대의 특성을 가지고 있다(Kim et al. 2015).

국립생태원은 국내 수입 및 유통되는 LM 옥수수의 자연생태계로의 유출현황을 파악하고자 2014년 6월부터 9월까지 경기지역을 대상으로 자연환경 모니터링을 실시하고 유전자 분석을 실시하였다. 본 연구를 통해 LM 옥수수의 발견 현황을 분석하여 기초 데이터로 제공하고 자연생태계 내 LM 옥수수의 유출을 사전에 예방하고자 하였다.

재료 및 방법

유전자변형 옥수수 의심시료 채집

유전자변형 옥수수 의심시료를 채집하기 위해 수도권을 제외한 경기지역 21개 시・군(동/리 기준)을 대상으로 자연환경 모니터링을 수행하였다. 모니터링 조사 지점을 중심으로 반경 100 m 거리 이내를 관찰하면서 의심시료 발견 시에는 GPS좌표와 조사기록지를 작성하고 조사지점의 특징을 나타낼 수 있도록 현장 사진을 확보하였다. 발견한 의심시료는 소독된 가위로 어린 잎 2 ~ 3장을 채취하여 지퍼백에 담아 시료번호를 부여하고 냉장보관 하였다.

단백질 검정 분석법

유전자변형생물체 내에 도입된 유전자가 생산하는 재조합 단백질에 항원 항체 반응 원리를 도입하여 LMO 여부를 단시간에 확인 할 수 있는 분석법으로 전 세계적으로 널리 사용되고 있다(Shin et al. 2016). 시료 채집 후 모니터링 현장 또는 실험실에서 QuickComb™ Kit (Envirologix, USA) 매뉴얼에 따라 시료를 준비하여 시료 컵에 담고 Cry1Ab/Bt11, Cry9C, Roundup Ready, Cry3Bb, Cry1F, T25, Cry34, mCry3A 및 LL/pat 단백질을 검출할 수 있는 Combo strip과 실온에서 5분에서 10분정도 반응시켰다. 9개 combo strip의 Control line에 밴드가 모두 검출되고 test line에 1개 이상의 밴드가 검출 되는 경우 양성반응으로 판명 하였으며 Control line에 밴드가 모두 검출되고 test line에 밴드가 모두 검출되지 않는 경우 음성반응으로 판명하였다.

Genomic DNA 추출 및 중합효소 연쇄반응

채집 시료의 유전자 분석을 위해 DNeasy Plant Mini Kit (QIAGEN, German) 의 프로토콜에 따라 genomic DNA를 추출하였다. 중합효소 연쇄반응을 위한 primer는 유럽위원회 공동연구센터(Joint Research Centre-European Commission, JRC-EC)와 NCBI GenBank 유전자 정보에서 확인한 염기서열을 바탕으로 디자인 하였다. 옥수수 작물 여부를 확인하기 위해 SSIIb 유전자의 특이적 프라이머 SSIIb-F; CCAATCCTTTGACATCTGCTCC와 SSIIb-R; CCAATCCTTTGACATCTGCTCC를 사용하여 94°C

에서 5분간 변성 후, 94°C 15초, 61°C 20초, 72°C 30초를 35회 반복하여 114 base pair (bp)의 유전자 증폭산물을 확인하였다. 다음으로, 유전자변형생물체 여부를 확인하기 위해 35S promoter의 특이적 프라이머 P-35S-F; AAGATGCCTCTGCC GACAGT와 P-35S-R; GATTGTGCGTCATCCCTTAC, nos terminator의 특이적 프라이머 T-nos-F; GAATCCTGTTGCCGG TCTTG와 T-nos-R; CCGCGCGCGATAATTTATCCTAGT로 95°C에서 5분간 변성 후, 95°C 15초, 60°C 20초, 72°C 30초를 40회 반복하여 각 142 bp와 194 bp의 유전자 증폭산물을 확인하였다(Table 1). 이벤트 분석을 위해 Table 2와 같은 이벤트 특이적 프라이머를 사용하여 95°C에서 5분간 변성 후, 95°C 15초, 60°C 20초, 72°C 30초를 40회 반복하여 유전자 증폭산물을 확인하였다. 중합효소 연쇄반응은 ProFlexTM Base (Applied biosystems, USA) PCR 기기를 사용하였으며 유전자 증폭산물은 2.5% agarose gel에 전기영동하고 Chemi-DocTM XRS+ (Bio-Rad, USA) 이미지 분석장치를 이용하여 확인하였다.

Result of promoter screening of volunteers of LM Maize in South Korea in 2014

 Screening elements  Monitoring Site

 Pyeongtaek 1   Pyeongtaek 2   Pyeongtaek 3 
35S promoter + + +
nos terminator + + +

Primer sequence of events of LM Maize

Events  Orientation  Sequence  Product size  Reference
Bt11 Forward GCGGAACCCCTATTTGTTTA 127bp Mazzara et al., 2005
Reverse TCCAAGAATCCCTCCATGAG
MON89034 Forward CGTACGTCAGGGTGCTGCTG 112bp Savini et al., 2008
Reverse CGACGGATCGTAATTTGTCG
NK603 Forward ATGAATGACCTCGAGTAAGCTTGTTAA 143bp Mazzara et al., 2005
Reverse AAGAGATAACAGGATCCACTCAAACACT 
MON810 Forward TCGAAGGACGAAGGACTCTAACGT 113bp Mazzara et al., 2009
Reverse GCCACCTTCCTTTTCCACTATCTT

결과 및 고찰

경기지역의 모니터링 및 샘플링

국내 자연생태계 내 LM 옥수수의 비의도적 유출을 예방하고 사후관리를 위해 경기지역을 대상으로 자연환경 모니터링을 수행하였다. 옥수수 모니터링 기간은 옥수수의 생활주기에 따라 2014년 6월 초부터 9월 말까지 4개월 동안 수행하였고 모니터링 장소는 주로 LM 옥수수가 수입되는 항만 주변에서부터 운송차량이 이동하는 동선에 따른 운송로 주변, 사료공장과 축산농가가 위치한 주변 및 축제지 주변까지 다양하게 선정하였다. 2014년 옥수수 모니터링 수행 결과 모니터링 지점 수는 화성시가 25개로 가장 많았으며 김포시 15개 및 안성시 14개 등 동・리 기준으로 총 169개 지점으로 확인되었다(Fig. 1A). 조사장소에 따른 모니터링 지점 수는 축산농가 139개(82%), 운송로 21개(12%), 사료공장 8개(5%), 축제지 1개(1%)의 순으로 확인되었다(Fig. 1B). 축산농가 조사 지점수가 139개(82%)로 가장 많았는데 이는 모니터링 조사 지역을 다양하게 선정 하였음에도 불구하고 경기지역의 축산농가가 높은 비율로 밀집되어 있다는 것을 의미한다. 전체적으로 조사 지점 수는 화성시가 가장 많았으나 의심시료 채집 수는 평택시가 가장 많았다. 평택시의 조사 지점 수는 9개로 확인 되었으며 의심시료 채집 수는 20개로 확인되었다. 이는 평택시가 LM 옥수수가 수입되는 항만시설을 갖추고 있어 타 지역에 비해 상대적으로 의심시료 채집 비율이 높게 나타난 것으로 사료된다. 결과적으로 경기지역 LM 옥수수 모니터링을 통해 총 169개의 조사지점에서 LM 옥수수로 의심되는 시료는 총 44개를 채집하였다.

Fig. 1.

The number of monitoring sites and rates of monitoring places in Gyeonggi-do province. The number of monitoring sites (A) and rates of monitoring places (B) by environmental monitoring from June to September 2014



단백질 검정 분석 및 유전자 분석

LM 옥수수 의심시료 총 44개 중에서 의심시료 1개는 종자로 발견하였고 의심시료 43개는 자생개체로 발견하여 잎을 채취하였다. 자생개체로 발견된 LM 옥수수 의심시료 43개 중에서 단백질 검정 분석법(Lateral flow strip test)을 통해 양성반응을 나타낸 시료는 4개로 평택시에서 채집되었다. 양성반응을 나타낸 의심시료 4개 중 2개는 동일한 지점에서 채집된 것으로 확인되어 시료를 혼합 한 후 총 3개 지점의 시료에 대하여 유전자변형 옥수수 여부를 판단하고자 하였다(Fig. 2). 먼저, 총 3개 지점의 시료에 대하여 genomic DNA를 추출한 후 채집한 시료의 옥수수 작물 여부를 확인 하기 위해 SSIIB 유전자 프라이머를 이용하여 중합효소 연쇄반응을 통해 증폭된 유전자 산물을 확인 하였다(Fig. 2A). 다음으로 유전자변형 옥수수 작물 여부를 확인하기 위해 35S promoter와 nos terminator 의 특이적 프라이머를 사용하여 중합효소 연쇄반응을 실시하였다. 그 결과 3개 지점의 시료에서 35S promoter와 nos terminator 가 모두 검출 되어 평택시에 발견한 의심시료 모두 유전자변형 옥수수로 확인되었다(Table 1). 유전자변형 옥수수 작물의 이벤트 분석을 위해 검출기법이 확립된 15개 단일이벤트의 유전자 특이적 프라이머를 사용하여 중합효소 연쇄반응을 실시하였다. 그 결과 평택 1 (Pt1) 지점에서 Bt11 이벤트가 검출되었고 평택 2 (Pt2) 지점에서는 Bt11, MON89034 및 NK603 이벤트가 검출되었으며 평택 3 (Pt3) 지점에서는 NK603, MON810 이벤트가 검출되었다(Table 2, Fig. 2B-E). Bt11 옥수수는 cry1A(b) 유전자와 pat 유전자를 삽입하여 옥수수 뿌리벌레(Corn Rootworm) 와 글루포시네이트(glufosinate-ammonium) 제초제에 내성을 가지도록 형질을 변형한 이벤트이며 MON89034 옥수수는 cry1A.105cry2Ab2를 삽입하여 유럽조명나방(Ostrinia nubilalis) 과 왕담배나방(Helicoverpa zea) 에 저항성을 갖도록 변형된 이벤트이다. NK603 옥수수는 CP4EPSPS (CP4-5-enolpyruvylshikimate- 3-phosphate synthase) 단백질을 발현하여 제초제 글라이포세이트(glyphosate) 에 내성을 갖도록 변형된 이벤트이고 마지막으로 MON810 옥수수는 cry1A(b) 유전자를 삽입하여 유럽조명나방(Ostrinia nubilalis) 에 저항성을 갖도록 변형된 이벤트이다(NIE 2015). 평택2 지점의 경우는 발견한 LM옥수수 의심시료 2개를 혼합하여 분석한 결과로 유전자변형옥수수 여부만을 확인하고자 하였다. 모니터링 시 발견된 시료의 정확한 이벤트 분석과 수입승인 여부를 확인하고자 할 때는 각 개별시료로 분석하는 것이 필요하다. 또한, 단백질 검정 분석에서 음성반응으로 확인 된 경우도 각 시료의 genomic DNA를 추출하여 양성반응 시료와 동일한 조건의 중합효소 연쇄반응을 실시하였으며 Non-LM 옥수수임을 재 검증 하였다. 본 연구에서 단백질 검정 분석과 유전자 분석 결과로 확인된 유전자변형 옥수수는 1차 모니터링 시 현장에서 제거하거나 2차 모니터링을 통해서 뿌리 채 제거하여 멸균처리 하였다.

Fig. 2.

Agarose gel electrophoresis of PCR products from collected maize DNA samples. (A-E) PCR results of SSIIB gene (A), Bt11 event (B), MON89034 event (C), NK603 event (D) and MON810 event (E) from maize volunteer samples, SM: 100bp DNA ladder; P: positive control; N: negative control; Pt1: Pyeongtaek site 1; Pt2: Pyeongtaek site 2; Pt3: Pyeongtaek site 3



LM 발견 장소의 특징

경기지역은 다른 권역에 비해 축산농가가 밀집되어 있고 인천광역시와 평택시에 항만이 위치하고 있다. 모니터링 시 축산농가와 항만 주변에서 의심시료 채집 확률이 높을 것으로 예상하였으나 채집된 시료 총 44개 중에서 축산농가 주변에서 시료 16개(36.3%)와 사료공장 주변에서 시료 2개(4.6%)를 발견하였고 항만 주변에서는 발견되지 않았으며 가장 많은 시료를 발견한 곳은 운송로 주변으로 26개(59.1%)가 발견되었다. 단백질 검정분석과 유전자 분석을 통해 유전자 변형 옥수수로 확인 된 3개 지점의 채집 장소를 확인해 본 결과, 경기지역 총 169개 조사 지점 중 평택시 운송로 주변에서만 발견되었다. 발견된 2곳의 지점은 평택 항만에서 각 7 km 와 8 km 이내의 아주 가까운 거리에 있는 운송로 주변으로 확인 되었고 다른 1곳의 지점은 축산농가가 밀집되어 있는 운송로 주변으로 확인 되었다(Fig. 3). 이는 곧 항만으로 수입되는 유전자변형 옥수수가 사료공장이나 가공공장으로 운송되는 과정과 축산농가 등의 최종소비지로 운송되는 과정에서 운송차량으로부터 비의도적으로 유출이 되었음을 시사한다. Han et al. (2015) 에 따르면 2009년 국내 주요항만과 사료공장 주변의 모니터링 결과 인천항만 주변에서 25개의 유전자변형 옥수수를 발견하였다고 보고한 바 있다. 그보다 앞서 2005년에 국내 처음으로 발견된 유전자변형 옥수수와 2006년과 2008년에 발견된 유전자변형 옥수수는 모두 인천항만 주변에서 발견된 바 있다(Kim et al. 2006; Lee et al. 2009; Han et al. 2014). 2006년에 발견된 유전자변형 옥수수는 인천항만 외에도 논산, 아산, 정읍, 군산 및 목포에서 식물체 또는 종자로 발견 된 바 있다(Han et al. 2014). 2005년 이후 국내에서 지속적으로 발견되고 있는 유전자 변형 옥수수는 국내 자연환경 내 유전자 이동성이 우려되는 바 모니터링이 필수적으로 시행되어야 한다. 국립생태원은 자연환경 모니터링 및 사후관리 연구를 통해 자연환경 위해성을 최소화 하기 위한 목적으로 유전자변형 옥수수에 대한 모니터링을 매해 실시하고 있다. 사전예방의 원칙으로 지속적인 관리가 이루어지고 있지만 LM 옥수수는 매년 수입이 되고 있는 상황이다. 따라서, LMO 운송차량의 비의도적 유출사고를 예방하기 위해 항만에서 최종소비지에 이르기까지 관련된 모든 관계자들의 LMO 인식제고 및 사전예방을 위한 교육을 통해 안전관리를 하는 방안도 필요한 것으로 사료된다.

Fig. 3.

Detection of the genetically modified maize samples at monitoring sites by the environmental monitoring in the Gyeonggi-Do Province. NO.1: Pyeongtaek site 1 (Pt1); NO. 2-1 and NO. 2-2: Pyeongtaek site 2 (Pt2:); NO.3: Pyeongtaek site 3 (Pt3)


적요

국내에서 LM 작물의 재배는 승인 된 바 없으나 식품용 및 사료용으로 LM 작물이 수입되고 있으며 LM 작물의 국내 수입량은 꾸준히 증가하고 있는 추세이다. 본 연구는 2014년 경기 지역의 LM 옥수수 유출여부를 모니터링 하기 위해 수행 되었으며 채집된 의심시료는 단백질 검정 분석법과 중합효소 연쇄반응을 통해 분석하였다. 경기 지역의 항만, 운송로, 사료공장 및 축산농가 등 총 169개 지점을 조사하였고 총 44개의 LM 옥수수 의심시료를 채집하였다. 단백질 검정 분석법으로 4개의 양성반응 시료를 확인하였고 동일지점의 시료는 혼합하여 총 3개의 시료에 대해 프로모터 스크리닝과 이벤트 특이적 프라이머를 이용한 중합효소 연쇄반응을 실시하여 의심시료 모두 LM 옥수수로 확인하였다. 본 연구의 결과는 국내 자연환경에서 LM 옥수수의 유출 현황 파악과 자연 생태계로 LM 옥수수의 유출을 예방하기 위해 자연생태계 모니터링이 매우 중요하다는 것을 뒷받침한다.

사사

본 연구는 국립생태원 LMO 자연환경 모니터링 및 사후관리 연구과제로 수행되었다.

References
  1. European Commission, Joint Research Centre. (JRC)  .
  2. Han SM, Kim DY, Uddin MR, Hwang KS, Lee BK, Kim CG, and Park KW. (2014) Appearance/Instance of genetically modified maize at grain receiving harbors and along transportation routes in Korea. Weed Turf Sci 3, 221-224.
    CrossRef
  3. International Service for the Acquisition of Agri-biotech Applications. (ISAAA) (2015) GM Approval Database .
  4. Kim CG, Yi HB, Park SK, Yeon JE, Kim DY, Kim DI, Lee KH, Lee TC, Paek IS, Yoon WK, Jeong SC, and Kim HM. (2006) Monitoring the occurrence of genetically modified soybean and maize around cultivated fields and at a grain receiving port in Korea. J. Plant Biol 49, 218-223.
    CrossRef
  5. KBCH:Korea Biosafety Clearing House. [Internet] (2015) Status of risk assessment of GMO in Korea .
  6. Kim YK. (2015) Development status and prospects of GM crops. Korean J. Int. Agric 27, 448-454.
    CrossRef
  7. Lee BK, Kim CG, Park JY, Park KW, Kim HJ, Yi HB, Jeong SC, Yoon WK, and Kim HM. (2009) Monitoring the occurrence of genetically modified soybean and maize in cultivated fields and along the transportation routes of the Incheon port in South Korea. Food Control 20, 250-254.
    CrossRef
  8. Mazzara M, Puumalaainen J, and Van Den Eede G. (2005) Validation of the GMO specific detection method developed by NVI/INRA for Bt11 in sweet corn Maize - validation report and protocol. .
  9. Mazzara M, Paoletti C, Puumalaainen J, Rasulo D, and Van Den Eede G. (2005) Event-specific method for the quantitation of Maize line NK603 using real-time PCR - validation report and protocol. .
  10. Mazzara M, Grazioli E, Savini C, and Van Den Eede G. (2009) Report on the verification of the performance of a MON810 event-specific method on Maize line MON810 using real-time PCR - validation report and protocol. .
  11. National Institute of Ecology. (NIE) (2014) Study on environmental monitoring and post-management of LMO. (VI). NIE-2014-0039. .
  12. National Institute of Ecology(NIE) (2015) Detection methods of living modified organisms. ISBN 979-11-86197-24-0. .
  13. Han SM, Lee JJ, Won OJ, Eom MY, and Park KW. (2015) Occurrence and distribution of genetically modified Maize. (Zea mays L.) at a grain receiving port and along transportation routes in Korea. Korean J. Int. Agric 27, 321-325.
    CrossRef
  14. Savini C, Bogni A, Grazioli E, Munaro B, Mazzara M, and Van Den Eede G. (2008) Event-specific method for the quantification of Maize line MON89034 using real-time PCR - validation report and protocol. .
  15. Shin SY, Jo BH, Moon JC, Jung Ro Lee, Choi WK, Seol MA, Kim MJ, and Song HR. (2016) Detection of LM canola with tolerance to glyphosate and glufosinate ammonium via the environmental monitoring in South Korea. J Plant Biotechnol 43, 479-485.
    CrossRef


June 2018, 45 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)
  • CrossMark
  • Crossref TDM