search for




 

Development of specific SNP molecular marker from Thistle using DNA sequences of ITS region
J Plant Biotechnol 2018;45:102-109
Published online June 30, 2018
© 2018 The Korean Society for Plant Biotechnology.

Shin-Woo Lee, Soo Jin Lee, and Yun-Hee Kim

Department of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Korea,
Department of Biology Education, College of Education, IALS, Gyeongsang National University, Jinju, Korea
Correspondence to: e-mail: cefle@gnu.ac.kr
Received March 27, 2018; Revised April 18, 2018; Accepted April 18, 2018.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Thistle is a perennial plant that is widely used for medicinal purposes. Information on the genetic diversity of thistle populations are great important for their conservation and germ plasmic utilization. Although thistle is an important medicinal plant species registered in South Korea, no molecular markers are currently available to distinguish them from other similar species from different countries. In this study, we developed single nucleotide polymorphism (SNP) markers derived from the nuclear ribosomal DNA internal transcribed spacer (ITS) regions of genomic sequences to identify distinct Korean-specific thistle species via an amplification refractory mutation system (ARMS)-PCR and high resolution melting (HRM) curve analyses. We performed molecular authentication of four different kinds of thistle species from different regions using DNA sequences in the ITS intergenic region. We also developed a quantitative PCR assay using species-specific ITS primers, which allowed us to estimate the ratio of Korean-specific thistle species using varying ratios of mixed genomic DNA templates from the two species. The SNP markers developed in this study are useful for rapidly identifying specific thistle species from different countries.

Keywords : ARMS-PCR, HRM curve analysis, Nuclear ribosomal DNA internal transcribed spacer regions, Single nucleotide polymorphisms, Thistle
서언

약용식물인 엉겅퀴는 국화과(Asteraseae 또는 Compositae) 식물들 중 날카로운 가시를 가진 식물들을 일반적으로 지칭하며(Haffner et al. 1999; Yoo et al. 2012), 일반적으로 종(species)을 표기할 때에는 Cirsium japonicum 종에 속하는 식물을 엉겅퀴라고 정의한다 (Yoo et al. 2012). 국내에 자생하는 엉겅퀴 종들은 Cirsium 속에 속하는 엉겅퀴(Cirsium japonicum)를 비롯하여 큰엉겅퀴(C. pendulum), 고려엉겅퀴(C. setidens), 바늘엉겅퀴(C. rhinoceros), 도깨비엉겅퀴(C. schantarense), 버들잎엉겅퀴(C. lineare), 흰잎엉겅퀴(C. vlassovianum), 물엉겅퀴(C. nipponicum)등 8종이 보고되어 있다 (Song et al. 2007; Yoo et al. 2012). 이들 중 엉겅퀴(C. japonicum)를 말린 것은 대계라고 명명하며, 고려 엉겅퀴는 곤드레 나물로 알려져 있다. 또한, 물엉겅퀴는 섬엉겅퀴로도 불리고 있는 등 국내에서도 지역마다 이름이 서로 다르고, 국가마다 그 종의 기원이 서로 달라 혼용 및 오용의 가능성이 매우 높은 편이다.

최근 국내 자생 엉겅퀴(C. japonicum)의 종자껍질 추출물에서 관절염의 염증을 가라앉히고 통증 유발물질인 prostaglandin E2의 형성을 억제하여 통증을 덜어준다는 결과를 확인한 바 있으며, 이는 종자껍질에 가장 많이 함유되어 있는 항염증물질인 apigenin의 역할로 추정되고 있다. 유럽에서는 국내의 자생 엉겅퀴와는 속이 다른 Silybum marianum이 있으며 이 식물이 생산하는 sylimarin이라는 물질이 간질환치료에 효과가 있음이 증명된 바 있다 (Thao et al. 2011). 현재 국내에서 자생하는 Cirsium 속에 속하는 식물들만 보아도 8종 이상으로 추정되고 있으며, 전 세계적으로는 약 200~300 여종이 있다고 보고되고 있어 이들 식물들을 가공한 식품 및 약품의 개발 및 사용시 혼용 및 오용을 방지할 수 있도록 각각의 종의 기원을 판별 할 수 있는 과학적인 기술의 개발이 시급하다 할 수 있다(Haffner et al. 1999; Yoo et al. 2012). 그러나 이들은 매우 유사한 종으로 서로 간의 종간 교잡종도 상당할 것으로 추측되기 때문에, 이들을 형태학적 또는 생화학적 지표성분 등으로 분류하기는 거의 불가능한 것으로 알려져 있다.

최근 분자생물학적기술을 이용하여 이들의 상호 유전적 근연성을 분석하거나 종의 기원을 조사하는 연구결과가 일부 보고 되고 있다. 예를 들면 국내에 자생하는 것으로 알려진 8종 중 엉겅퀴, 물엉겅퀴, 큰엉겅퀴, 고려엉겅퀴, 도깨비엉겅퀴 등 5종에 대하여 ITS 영역의 염기서열을 분석을 통한 유전적 연관성이 확인된 바 있으며(Bae 2010), 큰엉겅퀴와 고려엉겅퀴의 유전적 연관성을 분석하여 보고된 바 있다 (Yoo et al. 2012). Bae (2015)는 유사 종인 정영엉겅퀴(C. chanroenicum)를 대상으로 큰엉겅퀴와 도깨비엉겅퀴와의 유전적 연관성을 분석하여 보고한 바 있으며, Moon et al. (2013)은 조뱅이(C. segetum Bunge), 큰조뱅이(C. setosum (Wild.) M.Bieb.), 엉겅퀴, 고려엉겅퀴, 정영엉겅퀴 및 지느러미엉겅퀴(C. crispus) 6종을 대상으로 rDNA-ITS, matK, rbcL 유전자 염기서열을 DNA barcode 종류별로 비교분석하여 한약재인 소계와 대계의 기원 정립을 위한 연구결과를 보고한 바 있다. 또한 지역별로 수집한 Cirsium 속에 속하는 캐나다 thistle (C. arvense (L.) Scop.)을 대상으로 microsatellite를 이용한 유연관계를 분석하거나(Slotta et al. 2010), ITS 유전자단편의 염기서열을 이용한 유연관계 분석에 대한 연구결과들이 보고 된바 있다(Slotta et al. 2006; 2012).

최근 NGS (Next generation sequencing) 기술 등의 발달로 특정 생물종이 갖는 단일염기다형성(single nucleotide polymorphism, SNP)의 차이에 근거한 특정 종을 판별하는 barcoding 기술 등이 빠르게 발전 되고 있다. 그러나 아직까지도 비용과 노력 면에서 실용화하기가 어려운 실정이며, 현장에서 채취한 수많은 시료를 신속하고 정확하게 판별할 수 있는 기술의 개발이 시급한 실정이다. SNP를 확인한 후 그 SNP에 이웃하고 있는 2번째 또는 3번째의 염기를 변경하여 mismatch primer를 제작하여 PCR 반응과정에서 특이성을 증대시킨 amplification refractory mutation system (ARMS)-PCR 기술은 정확한 판별 결과를 얻기 위한 매우 중요한 분석 기술이라 할 수 있다(Han et al. 2016). 또한, HRM (high resolution melting) 곡선 분석 방법 역시 단 하나의 SNP를 중앙에 위치하도록 디자인한 프라이머를 이용하여 목표로 하는 유전자 단편을 증폭시킨 후 이중 나선이 완전히 단일 가닥으로 변하는 과정을 정량적으로 측정하여 melting curve 의 차이로 계통 또는 품종을 판별하는 우수한 분석기술이다(Han et al. 2016).

그러므로, 본 연구에서는 한국산 국내 토종 및 해외 계통의 엉겅퀴의 기원을 판별하기 위해 핵에 존재하는 ITS 유전자단편에서 SNP를 이용한 판별 프라이머를 확보하였으며 이를 보완하여 보다 신속하게 판별하기 위하여 ARMS-PCR 및 HRM 기술을 이용한 판별마커와 그 조건을 확립하였다.

재료 및 방법

실험재료

실험에서 사용한 엉겅퀴 계통은 국내 자생하는 엉겅퀴(Cirsium japonicum), 국내 자생 물엉겅퀴(C. nipponicum), 유럽엉겅퀴(Silybum marianum) 및 캐나다엉겅퀴(C. arvense)를 대상으로 조사하였다(Table 1).

List of plant materials used in this study

Identification codeScientific nameOriginSpecimen material
2014-28Cirsium japonicumSouth KoreaRoot
2014-29Silybum marianumEuropeLeaf
2016-37Cirsium arvenseCanadaLeaf
2016-38Cirsium arvenseCanadaLeaf
2016-43Cirsium japonicumSouth KoreaLeaf
2016-44Cirsium nipponicumSouth KoreaLeaf
2016-45Cirsium japonicumSouth KoreaLeaf
2016-46Silybum marianumEuropeLeaf

DNA 분리

수집된 계통별로 일정량의 뿌리, 종자, 잎 등을 액체질소에 급속 냉동시킨 후 곱게 갈아서 얻은 분말을 이용하여 GeneAll사의 ExgeneTM Plant SV 키트를 이용하여 회사에서 제공한 실험방법에 따라 염색체 DNA를 분리하였다. 정제된 DNA는 1% agarose gel에서 전기영동을 실시하여 DNA의 분리과정에서의 분해정도를 확인한 후 Micro-spectrometer (BioPrince, SD-2000, Gangwon, South Korea)를 이용하여 234 nm, 260 nm, 280 nm에서 각각 흡광도를 측정하여 A260/A280 값이 1.8~2.2 범위 그리고 A234/A260 값이 0.5~0.8 범위 내 포함 여부를 조사하여 RNA 및 단백질 등의 오염 정도를 확인하여 순수한 DNA를 확인하였다.

ITS의 증폭 및 염기서열 분석

ITS 유전자 내의 SNP를 확인하고자 유전자 단편의 증폭을 위하여 Table 2에 표시된 유전자의 염기서열정보를 사용하여 각각의 프라이머를 제작하였다. 유전자의 증폭은 iNtRON 회사(Gyeonggi Province, South Korea)에서 제공하는 PCR 반응용 완충용액 및 i-pfu DNA polymerase를 사용하여 중합반응과정에서 야기 될 수 있는 돌연변이를 최소화 하였다. 제조사에서 제공하는 실험방법에 따라 순수 분리한 DNA 50 ng과 프라이머를 각각 10 pmole을 혼합 한 후 94°C에서 5분간 DNA를 변성 시킨 후 94°C에서 30초, 60°C에서 10초, 72°C에서 30초를 1 cycle로 하여 35 cycle 반복 후 72°C에서 5분간 연장반응을 시킨 후 4°C에서 반응을 종료하고 증폭된 DNA밴드는 2.0% agarose gel을 이용하여 전기영동 하여 그 결과를 확인하였다. 증폭 되어진 각 유전자 단편의 클로닝 과정에서 돌연변이가 일어날 수도 있으므로 클로닝을 하지 않고 증폭된 DNA단편을 ExpinTM PCR SV (GeneAll, Seoul, South Korea) Kit를 사용하여 순수 정제한 후 직접 염기서열분석을 의뢰하였다. 또한 최종적으로 확인된 SNP는 최소 5반복 이상 수행하여 검정하였다.

Primer sequences used in this study

A. SNP analysis

 Target species Primers Sequences (5’–3’)Tm (°C)Size (bp)
C. japonicumITS forwardCATGTGCCAAGGAAAAGAAAACATAA55.4291

ITS reverseATCCCCATTGGGGAGGCA61.2

C. nipponicumITS forwardGGCGTCGTGGATGTTGCGTT63.2376

ITS reverseCCGACGGCACGGGAGACCAA67.5

C. arvenseITS forwardCTGCGATGCCTCGTCGAT59.6545

ITS reverseCGACACATTGGGGTCTTTAAAGAGT58.4

S. marianumITS forwardCACAGCAGAACGACCCGCGA65456

ITS reverseACGAACGCATCCCCGTAGGGA65

B. ARMS-PCR analysis

Target speciesPrimersSequences (5’–3’)Tm (°C)Size (bp)

C. japonicumITS forward-ARMS-ACATGTGCCAAGGAAAAGAAAACAAAA56.2291

ITS forward-ARMS-GCATGTGCCAAGGAAAAGAAAACAGAA57.6
ITS forward-ARMS-CCATGTGCCAAGGAAAAGAAAACACAA57.9
ITS reverse-ARMS-AATCCCCATTGGGGAGACA57.3
ITS reverse-ARMS-TATCCCCATTGGGGAGTCA57.3
ITS reverse-ARMS-CATCCCCATTGGGGAGCCA61.2

C. nipponicumITS forward-ARMS-AGGCGTCGTGGATGTTGCATT60.5376
ITS forward-ARMS-TGGCGTCGTGGATGTTGCTTT60.6
ITS forward-ARMS-CGGCGTCGTGGATGTTGCCTT63.0
ITS reverse-ARMS-ACCGACGGCACGGGAGACAAA65.0
ITS reverse-ARMS-TCCGACGGCACGGGAGACTAA59.1
ITS reverse-ARMS-GCCGACGGCACGGGAGACGAA67.3

C. arvenseITS forward-ARMS-ACTGCGATGCCTCGTCAAT57.0545
ITS forward-ARMS-TCTGCGATGCCTCGTCTAT55.9
ITS forward-ARMS-CCTGCGATGCCTCGTCCAT59.6
ITS reverse-ARMS-TCGACACATTGGGGTCTTTAAAGTGT58.7
ITS reverse-ARMS-GCGACACATTGGGGTCTTTAAAGGGT60.9
ITS reverse-ARMS-CCGACACATTGGGGTCTTTAAAGCGT61.3

C. HRM analysis

GenePrimersSequences (5’–3’)Tm (°C)Size (bp)

ITSITS forwardGCAGAATCCCGTGAACCATCGA61.0238
ITS reverseGCTCGATACGAAGGCCTTAACAAC60.0

유연관계 분석

확인된 ITS 유전자의 유연관계 분석은 Mega 6.0 프로그램을 이용해 진행하였다. 비교 군들간의 유전적 거리의 계산은 Tamura-Nei distance 방법을 이용하였으며, neighbor-joining 방법을 이용해 유연관계를 분석하였다(Tamura et al. 2013).

ARMS-PCR

일반적으로 SNP를 이용하여 제작한 mismatch primer를 사용하여 특정 계통을 판별하기 위해 많이 이용하기 때문에, 본 연구에서는 ITS 유전자의 SNP를 나타내는 염기를 3′-말단에 위치하게 하고, 5′-말단 쪽으로 첫 번째 또는 세 번째의 염기를 인위적으로 변형시킨 primer를 사용하여 특이성을 향상 시킬 수 있는 ARMS-PCR기술을 도입 하였다(Table 2).

HRM 분석

Table 2에서 제시된 프라이머를 이용하여 HRM (High Resolution Melting) curve 패턴을 분석하기 이전에 이들 프라이머가 목표 유전자단편을 정확하게 증폭 하는지의 여부를 조사하기 위하여 각각의 프라이머 조합을 이용하여 각 엉겅퀴 시료들에서 분리한 DNA를 주형으로 PCR로 증폭시켜 전기영동을 통해 확인하였다. 또한 확인된 밴드들을 순수 정제하여 염기서열분석을 한 결과 각각의 종에서 확인된 ITS 유전자와 100% 일치하는 것을 확인한 후 HRM curve 패턴 분석을 실시하였다. 각 엉겅퀴 시료에서 분리한 DNA를 각각 10 ng씩 넣고, 프라이머를 각각 5 pmol 넣고 10 μl의 SsoFast™ EvaGreen Supermix BIO-RAD, 172-5200 premixture를 넣고 전체 반응액을 20 μl로 맞춘 후 Mx3005P QPCR Systems (Agilent Technologies, Santa Clara, USA)을 사용하여 HRM curve 분석을 수행하였다.

결과 및 고찰

ITS 유전자단편을 이용한 유연관계 분석

국내 토종 엉겅퀴 [엉겅퀴(C. japonicum), 물엉겅퀴(C. nipponicum)]와 해외 엉겅퀴 [유럽엉겅퀴(S. marianum), 캐나다엉겅퀴(C. arvense)] 시료들의 ITS 유전자 단편을 염기서열 분석을 한 결과, 같은 출처의 계통(엉겅퀴: 2014-28, 2016-43, 2016-45; 유럽엉겅퀴: 2014-29, 2016-46; 캐나다엉겅퀴: 2016-37, 2016-38)들은 모두 같은 염기서열을 보였다 (Table 1, Fig. 2A). 유전적 유연관계 분석을 통해 국내 토종 엉겅퀴들(엉겅퀴, 물엉겅퀴)은 유럽엉겅퀴와 유연관계가 높음을 확인할 수 있었다 (Fig. 1).

Fig. 1.

Phylogenetic tree showing the genetic diversity of 8 plants of 4 kinds of thistle species using the ITS nuclear intergenic regions. The tree was produced using the neighbor-joining method based on intergenic sequences of the ITS


Fig. 2.

Sequence alignment and products of ARMS-PCR using the ITS nuclear intergenic regions in 4 kinds of thistle species. (A) Sequence alignment of the ITS nuclear intergenic region in each species. The gray box indicates the same sequences in two or three species, while the black box indicates the same sequence in all species. Arrows indicate the positions of the ITS primers developed in this study. (B) PCR results using Korean species (C. japonicum and C. nipponicum)-specific primers. Sample numbers 1, 2, 3 and 4 are Korean species (1, 2, 3: C. japonicum; 4: C. nipponicum) and sample numbers 5, 6, 7 and 8 are species originating from other countries (5, 6: S. marianum; 7, 8: C. arvense). (C) PCR results using Canadian species C. arvense and European species S. marianum-specific primers. Sample numbers 1, 2, 3 and 4 are species originating from other countries (1, 2: S. marianum; 3, 4: C. arvense) and sample numbers 5, 6, 7 and 8 are Korean species (5, 6, 7: C. japonicum; 8: C. nipponicum)


ITS 유전자 단편에 대한 ARMS-PCR용 primer를 이용한 계통 판별용 마커 개발

각 계통 특이적 SNP 판별 마커를 개발하여 계통 별 구분을 위해, 각 계통 특이적 프라이머를 제작 하였다(Table 2, Fig. 2A).

국내에서 자생하는 대표적인 엉겅퀴 종(C. japonicum)의 판별을 위해, 정방향 프라이머는 본 연구에서 확인된 다른 5종의 엉겅퀴종과 차이가 나는 염기 T가 3′-말단에 위치하도록 하였으며, 역방향 프라이머는 유럽(S. marianum) 및 캐나다엉겅퀴(C. arvense)와는 차이를 보이는 부위를 이용하였다 (Fig. 2B). 3′-말단에 각각 SNP를 포함하는 프라이머를 사용하여 PCR을 수행한 결과 유럽엉겅퀴를 제외한 다른 3종의 엉겅퀴에서 모두 동일한 크기의 DNA 밴드를 생산한 것으로 조사되어 C. japonicum에 내재하는 SNP만으로 제작된 프라이머를 이용해 다른 엉겅퀴 종으로부터 구분할 수 있는 판별마커로 사용하기에 부적합한 것으로 확인 되었기 때문에 ARMS-PCR을 수행하였다. SNP 프라이머의 3′-말단에서 5′-말단 쪽으로 세 번째 염기를 각각 다른 3종류의 염기로 변경한 프라이머를 제작하여 정방향 및 역방향 프라이머 모두 동일한 염기로 치환된 프라이머 조합을 사용하여 PCR반응을 수행하여 본 결과 3′말단과 인접한 세 번째 염기를 각각 T로 변경시킨 프라이머 조합에서 가장 선명한 밴드를 생산하여 ARMS기술의 도입으로 판별 효과를 높일 수 있는 것으로 확인 되었다. 그러나 G로 치환한 경우에는 섬엉겅퀴에도 약한 밴드를 생산하였으며, A 또는 C로 치환한 경우에는 모든 시료에서 밴드가 사라지거나 아주 희미하게 되는 결과를 얻어 판별 마커로는 부적합한 것으로 확인 되었다. 물엉겅퀴(C. nipponicum)를 판별하기 위한 프라이머도 다른 종의 엉겅퀴와 차이가 SNP 부위를 근거로 하여 제작하였다(Fig. 2B). 실제로 SNP 부위를 PCR을 통해 증폭한 결과, 다른 종의 엉겅퀴에서도 밴드가 확인되었다. 그러므로, 정방향 및 역방향 프라이머의 3′-말단에 이웃한 세 번째 염기를 각각 다른 3가지의 염기로 변경하여 제작 한 후, PCR실험을 수행하여 본 결과 세 번째 염기를 T로 변경한 정방향 및 역방향 프라이머 조합에서 섬엄겅퀴에만 예상한 크기(376 bp)의 단일 밴드를 확인하였다. A, G 또는 C로 변경한 조합에서는 다른 종의 시료에도 밴드를 생성하거나, 크기가 다른 DNA 밴드가 보여 판별마커로는 부적합한 것으로 확인 되었다. 그러므로, 국내에서 자생하는 것으로 알려진 엉겅퀴 중 본 연구에서 수집하여 확인한 국내 자생 엉겅퀴종 들의 특이적 판별마커로서 사용이 가능할 것으로 생각된다.

다음으로 캐나다엉겅퀴와 유럽엉겅퀴의 판별 마커를 확인하였다(Fig. 2C). 먼저 캐나다엉겅퀴의 판별마커는 캐나다엉겅퀴에서만 유일하게 SNP를 나타내는 염기들을 이용하여 PCR 반응을 수행한 결과, 예상한 크기(545 bp)의 강한 DNA밴드를 확인하였으나, 유럽엉겅퀴에서도 약한 밴드를 확인하였다. 따라서 ARMS기술을 도입하여 판별효과를 보다 높일 수 있는지의 여부를 확인하기 위하여 3′-말단에 인접한 세 번째 염기를 각각 다른 3가지의 염기로 변경한 프라이머를 제작하였다(Table 2). 이들 프라이머를 대상으로 정방향과 역방향 프라이머의 세 번째 염기를 동일한 염기 즉 A, T, G 및 C로 조합하여 PCR을 다시 수행하여 본 결과 모든 조합에서 캐나다엉겅퀴 특이적 밴드를 생산하는 것을 확인하였다. 그러므로, 캐나다엉겅퀴 특이적 판별용 프라이머로 사용할 수 있음을 확인하였다. 유럽엉겅퀴의 경우, 특이적으로 단일염기다형성을 보이는 염기를 정방향 또는 역방향 프라이머의 3′-말단에 위치하도록 하여 프라이머를 제작하여 PCR 실험을 수행한 결과, 유럽엉겅퀴 시료에서만 예상한 크기(456 bp)의 DNA 밴드를 형성하여 상기한 SNP 프라이머를 그대로 유럽엉겅퀴의 판별마커로 사용하기에 적합하다는 결론을 얻었다. 그러므로, 본 연구에서 사용된 ARMS-PCR 프라이머들은 국내에서 자생하는 것으로 알려진 엉겅퀴 종 특이적 판별마커 및 유럽, 캐나다엉겅퀴 종 중 본 연구에서 수집하여 확인한 종 특이적 판별마커로서 사용이 가능할 것으로 생각된다.

ITS 유전자 단편에 대한 HRM 분석을 통한 시료의 혼용 확인

보다 정확한 판별마커들의 확인을 위해, 각 계통들의 ITS 영역의 염기서열을 비교하여 SNP 패턴을 근거로 하여 HRM (High Resolution Melting) curve 분석용 프라이머를 제작 하였다(Fig. 3A). 각 엉겅퀴 계통들의 HRM curve 패턴을 분석한 결과, ITS 유전자 단편이 4가지 종 모두에 대해 서로 다른 HRM curve 패턴을 보여 종의 판별이 가능한 것으로 확인 되었다 (Fig. 3B).

Fig. 3.

Primer sets and HRM curve analysis using the ITS nuclear intergenic region in the 4 kinds of thistle species. (A) Primer positions for HRM curve analysis. (B) ITS melting curves of samples from 4 kinds of thistle species. (C) Quantification of intentionally mixed genomic DNA samples from C. japonicum and C. nipponicum by HRM using ITS primers


다음으로 실제 유통되거나 이용되고 있는 시료들의 혼재의 여부를 판별하기 위한 정량적 분석을 위해, HRM 프라이머를 이용하여 시료 내의 DNA양에 따른 HRM curve 패턴을 분석 하였다(Fig. 3C). 우선 엉겅퀴(C. japonicum)의 genomic DNA에 물엉겅퀴(C. nipponicum)의 genomic DNA를 일정 비율로 혼합하여 분석하였으며, 다음으로 물엉겅퀴(C. nipponicum)의 genomic DNA에 엉겅퀴(C. japonicum) genomic DNA를 일정 비율로 혼합하여 분석 하였다. 임의로 혼합한 시료를 대상으로 HRM curve 패턴에 의한 혼합 비율 분석결과, 각각의 genomic DNA를 x축에 기술한 혼합 비율로 혼합한 후 각각의 특이적 프라이머로 DNA단편을 증폭시켜 상대적인 증폭 값을 y축에 표시하였다. ITS 유전자를 이용한 HRM curve 분석의 결과, 실제로 두 종류의 엉겅퀴를 혼합하는 비율이 높아질수록 차이 나는 곡선을 보임을 확인할 수 있다. 그러므로, 본 연구의 결과로서 실제적으로 두 가지 시료가 혼재되어 있을 경우, 정량적 PCR 증폭을 통해 시료의 순도 여부 및 혼합 비율을 확인 할 수 있음을 알 수 있다.

본 연구의 결과들을 종합하여 보면, 국내 및 해외에서 그 기원을 달리하는 다양한 엉겅귀 및 엉겅퀴 유사 종들의 정확한 기원판별을 위하여서는 생육 조건이나, 형태적 변이 등에 따라 크게 영향을 받지 않는 DNA단편을 이용한 분자생물학적 판별마커의 개발이 매우 필요한 실정이다. 그러나 현재까지 국내를 중심으로 한 ITS 영역 등에 대한 특정 유전자 단편 내에 존재하는 SNP의 확인 등에 관한 연구에 한정되어 있어, 실제적인 실용화를 위해서는 많은 연구들이 추가로 필요한 것으로 생각된다. 특히 최근에 개발된 SNP를 이용한 특이적 프라이머의 제작 및 실용화를 위한 ARMS-PCR 및 HRM curve 분석을 적용한 연구가 매우 필요한 실정이었다. 본 연구의 결과에서처럼, 최근 SNP를 보이는 부분을 이용하는 DNA barcodes의 개발 및 이를 이용한 약용작물의 기원 분석에 관한 연구가 활발하게 진행되고 있다. DNA barcodes를 밝혀내는 가장 첫 단계는 각 종에 해당하는 특정 DNA단편의 염기서열을 비교하여 먼저 SNP부위를 찾는 것이라 할 수 있다. 본 연구의 결과를 통해 향후, 인접국가인 중국과 일본의 지역별로 수집된 엉겅퀴 및 엉겅퀴 유사 종들에 대한 엽록체 단편의 유전자 서열의 계통간 차이가 나는 SNP를 근거로 하여 염기서열분석을 통한 SNP의 확인으로 국가별 그 기원을 달리하는 엉겅퀴를 정확하게 판별할 수 있을 것으로 기대되는 바이다.

적요

엉겅퀴는 일반적으로 이용되는 대표적인 다년생의 약용식물이다. 최근 국제적 추세에 따라 자국의 유전자원의 발굴, 보존 등이 강화됨에 따라 인접국가와 국내 자생 엉겅퀴 계통을 판별 할 수 있는 기준 설정에 관한 연구의 필요성이 대두되고 있지만, 분자생물학적 판별 기술의 개발은 아직 미흡한 실정이다. 본 연구에서는 국내 토종과 해외 유래 엉겅퀴 종의 기원을 판별하기 위해 핵의 리보솜에 존재하는 ITS 유전자단편에서 SNP를 이용한 판별 프라이머를 확보하였으며, 이를 보완하여 보다 신속하게 판별하기 위하여 ARMS- PCR 및 HRM 기술을 이용한 판별 마커와 그 조건을 확립하였다. 또한, 국내 종 특이적 프라이머들을 이용한 정량적 PCR 분석방법을 이용해 두 가지 종의 genomic DNA의 혼합 여부를 판별하였다. 그러므로, 본 연구에서 개발된 SNP 마커는 다양한 지역 또는 국가에서 서식하는 엉겅퀴 종들의 신속한 확인을 위해 매우 유용하게 이용될 것으로 생각된다.

사사

본 연구는 농림축산식품부 농생명산업기술개발사업(과제번호: 314021-3-1-SB050) 지원에 의하여 연구되었음.

References
  1. Bae YM. (2010) Identification of aCarduusspp showing anti- mycobacterial activity by DNA sequence analysis of its ITS1, 5.8S rRNA and ITS2. J Life Sci 20, 578-583.
    CrossRef
  2. Bae YM. (2015) Genetic relationship of someCirsiumplants of Korea. J Life Sci 25, 243-248.
    CrossRef
  3. Haffner E, and Hellwig FH. (1999) Phylogeny of the tribeCardueae(Compositae) with emphasis on the subtribeCarduinae:an analysis based on ITS sequence data Willdenowia. 29, 27-39.
    CrossRef
  4. Han EH, Cho KM, Goo YM, Kim MB, Shin YW, Kim YH, and Lee SW. (2016) Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant speciesCynanchum wilfordii, Cynanchum auriculatumandPolygonum multiflorum. Mol Biol Rep 43, 323-332.
    Pubmed CrossRef
  5. Moon BC, Lee YM, Ji Y, Choi G, Chun JM, and Kim HK. (2013) Molecular authentication and phylogenetic analysis of plant species forBreeaeandCirsiiherba based on DNA barcodes. Kor J Herbol 28, 75-84.
    CrossRef
  6. Slotta TAB, Foley ME, Chao S, Hufbauer RA, and Horvath DP. (2010) Assessing genetic diversity of Canada thistle (Cirsium arvense) in North America with microsatellites. Weed Sci 58, 387-394.
    CrossRef
  7. Slotta TAB, Horvath DP, and Foley ME. (2012) Phylogeny ofCirsiumspp in North America:host specificity does not follow phylogeny. Plants 1, 61-73.
    Pubmed KoreaMed CrossRef
  8. Slotta TAB, Rothhouse JM, Horvath DP, and Foley ME. (2006) Genetic diversity of Canada thistle (Cirsium arvense) in North Dakota Weed Sci. 54, 1080-1085.
  9. Song MJ, and Kim H. (2007) Taxonomic study onCirsium Miller(Asteraceae) in Korea based on external morphology. Korean J Plant Taxon 37, 17-40.
    CrossRef
  10. Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S. (2013) MEGA6:molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30, 2725-2729.
    CrossRef
  11. Thao NTP, Cuong TD, Hung TM, Lee JH, Na MK, Son JK, Jung HJ, Fang Z, Woo MH, Choi JS, and Min BS. (2011) Simultaneous determination of bioactive flavonoids in some selected Korean thistles by high-performance liquid chromatography. Arch Pharm Res 34, 455-461.
    Pubmed CrossRef
  12. Yoo SK, and Bae YM. (2012) Phylogenetic and chemical analyses ofCirsiumpendulum andCirsium setidensinhabiting. J Life Sci 22, 1120-1125.
    CrossRef


June 2018, 45 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM