search for




 

In vitro micropropagation of M.26 (Malus pumila Mill) apple rootstock and assessment of the genetic diversity of proliferated plantlets using simple sequence repeat markers
J Plant Biotechnol 2018;45:382-391
Published online December 31, 2018
© 2018 The Korean Society for Plant Biotechnology.

Kang Hee Cho, Bong Hee Han, Jeom Hwa Han, Seo Jun Park, Se Hee Kim, Han Chan Lee, Mi Young Kim, and Myung-Su Kim

Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wan-ju 55365, Korea,
Foundation of Agri. Tech. Commercialization and Transfer, Iksan 54667, Korea
Correspondence to: e-mail: khc7027@korea.kr
Received October 24, 2018; Revised November 20, 2018; Accepted November 20, 2018.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

The objective of this study was to determine the most effective medium condition of shoot proliferation and root formation for the efficient in vitro micropropagation of M.26 (Malus pumila Mill). Simple sequence repeat (SSR) markers were used to analyze the genetic diversity of micro-propagated and greenhouse grown M.26. Shoot proliferation was carried out in MS (Murashige and Skoog) containing benzyladenin (BA, 0.5 ∼ 5.0 mg・L-1) and thidiazuron (TDZ, 0.01 ∼ 0.1 mg・L-1). The highest number of shoots (10.67 shoots per explant) was induced by adding BA at a concentration 1.0 mg・L-1. TDZ treatments caused higher hyperhydricity rate in cultured explants than in BA treatments. There was no significant effect of both BA and auxin on shoot proliferation, and the optimum proliferation medium for M.26 was MS medium containing 1.0 mg・L-1 BA. To find a suitable medium composition for shoot rooting, we tested different concentrations indole-3-butyric acid (IBA) and α-naphthaleneacetic acid (0.5 ∼ 5.0 mg・L-1), MS medium (1/4-1), sucrose (0 ∼ 30 g・L-1). The shoots showed good rooting on half-strength MS medium containing 1.0 mg・L-1 IBA and 15-20 g・L-1 sucrose. The rooting rate (100%), number of roots (10.45 ∼ 13.60 roots per explant), root length (7.41 ∼ 8.33 cm), and shoot length (4.93 ∼ 5.38 cm) were good on this medium. Fifteen SSR primers were detected in a total of 30 alleles in 20 micro-propagated plantlets, all SSR profiles from micro-propagated plantlets were monomorphic and similar to greenhouse grown control plantlet M.26 plant. The results indicated that M.26 micro-propagated plantlets were genetically stable.

Keywords : Apple, Genetic diversity, In vitro, Micro-propagation, Plant growth regulator
서언

우리나라의 사과재배는 왜성대목을 이용하여 노동 효율을 높이면서 생산성이 높은 밀식 재배로 전환되었다(Yoon et al. 2005). 이에 대량의 우량묘목을 필요로 함에 따라 사과 묘목을 생산하기 위한 다양한 방법이 적용되고 있다(Ko et al. 2018; Jun et al. 2001). 국내에서 가장 많이 사용하고 있는 사과 왜성대목 중의 하나는 M.26 (Malus pumila Mill)이다. 사과 대목은 주로 영양번식인 묻어떼기 방법으로 증식하고 있어 번식 효율이 낮고 병이나 바이러스 감염에 대한 문제점을 가지고 있다(Dobránszki and Teixeira da Silva 2010).

조직배양을 이용한 기내 대량 번식 방법은 균일한 묘목을 급속히 증식할 수 있을 뿐만 아니라 생장점 배양을 통해 바이러스 무병묘의 생산이 가능하다. 사과 조직배양에 관한 연구는 1960년대 후반부터 시작하여 다양한 사과 접수 및 대목 품종을 대상으로 수행되었고, 사과나무의 번식에 조직배양 방법이 성공적으로 적용되어 왔다(Castillo et al. 2015; Geng et al. 2016; Ghanbari 2014; Jones 1967; Yepes and Aldwinckle 1994). 그러나 기내라는 특수한 환경에서 생장 증식하기 위해서 필요한 양분이나 생장조절물질 등은 품종, 유전적 특성, 식물체의 생육단계에 따라 달라질 수 있어 광범위하게 적용하기 어렵다. 예를 들면 온실조건 하에 삽목을 통한 번식에서 M.26은 M.9보다 비교적 발근이 쉬워 발근력에 있어 차이를 보이는데, 이는 발근 유도에 M.9은 M.26보다 더 높은 농도의 왜생(exogenous) auxin이 필요하기 때문이다(James and Thurnbon 1981). 이와 같이 품종의 유전적 다양성에 의해 조직배양 반응이 다르게 나타날 수 있어 품종 특성에 따른 적정배지의 구명이 필요하다(Lane and Mcdougald 1982).

경정조직이나 액아에서 미세번식된 식물체는 개체별로 유전적으로 동일성을 유지하는 것으로 보고되었지만(McMeans et al. 1998; Pathak and Dhawan 2012), 기내 조직배양에서 나타나는 유전적 변이인 체세포 변이(somaclonal variation)의 가능성도 제시되었다(Jain 2001). 따라서 미세번식 과정 중에 유전적 차이가 발생할 수 있기 때문에 미세번식을 통해 유기된 식물체는 변이에 대한 검토가 필요하다. 많은 작물에서 미세번식된 식물체의 미세한 체세포 변이를 분석하기 위해 표현형, 세포학, 생화학 및 분자 수준에서 연구가 진행되었다(Amberger et al. 1992; Devarumath et al. 2002; Gimenez et al. 2001; McMeans et al. 1998; Palombi and Damiano 2002).

본 연구는 사과 대목 M.26을 기내에서 효과적으로 대량번식하기 위해 신초 증식과 뿌리 형성에 적합한 배지 조건을 구명하고, simple sequence repeat (SSR) 마커를 이용하여 증식된 소식물체의 유전적 다양성을 분석하였다.

재료 및 방법

시험재료 및 배지

시험재료는 농촌진흥청 국립원예특작과학원 온실에서 생육하고 있는 사과 대목 M.26을 사용하였다. 기내배양을 하기 위해서 왕성하게 생육하고 있는 신초(5 cm)를 채취하여 2 ∼ 3매의 잎을 남기고 정리한 다음, 수도물에 수 차례 세척 후 70% 에탄올에 침지하여 약 30초 간 표면살균하였다. 이후, 클린벤치 내에서 1% 차아염소산나트륨(sodium hypochlorite, NaOCl)에 2 ∼ 3분간 침지하여 2차 표면 살균을 하였다. 표면 살균된 신초는 0.5 cm 크기로 절단하여 1.0 mg・L-1 BA (benzyladenine), 0.1 mg・L-1 IBA (indole-3-butyric acid), 30 g・L-1 sucrose, 8 g・L-1 plant agar가 첨가된 MS (Murashige and Skoog, 1962)배지에서 배양하였으며, 증식된 신초를 다양한 식물생장조절제가 첨가된 배지에 치상하여 신초 증식 및 발근 배지 구명에 이용하였다.

신초의 증식

M.26의 신초 증식에 적합한 생장조절물질의 조성을 구명하고자 30 g・L-1 sucrose, 8 g・L-1 plant agar가 첨가된 MS 기본배지를 이용하여 cytokinin의 종류인 BA와 thidiazuron (TDZ)을 비교 조사하였다. BA 농도는 0.5, 1.0, 2.0, 3.0, 5.0 mg・L-1, TDZ 농도는 0.01, 0.05, 0.1 mg・L-1로 단용 처리하였다. Cytokinin과 auxin의 혼용 처리 효과를 알아보기 위하여 본 실험에서 적정 cytokinin으로 선발된 BA 농도(0.5, 1.0, 2.0 mg・L-1)를 달리하여 0.5 mg・L-1 IBA, 0.5 mg・L-1 indole-3-acetic acid (IAA) 및 0.2 mg・L-1 α-naphthaleneacetic acid (NAA)와 혼용으로 첨가한 배지에서 신초를 배양하였다. 시험구 배치는 각 처리별로 완전임의배치법 3반복으로 하였고 반복당 50 ml의 배지가 첨가된 450 ml 배양병에 약 2.0 cm 크기의 절편체를 7개씩 치상하였다.

증식된 신초의 발근

M.26의 기내 신초 발근에 효과적인 auxin 종류와 농도를 구명하고자 30 g・L-1 sucrose, 8 g・L-1 plant agar가 첨가된 MS 기본배지에 IBA와 NAA를 각각 0.5, 1.0, 2.0, 3.0, 5.0 mg・L-1로 처리하여 발근 정도를 비교하였다. 또한 발근에 적합한 배지의 무기염류 농도와 sucrose의 농도를 구명하고자 1.0 mg・L-1 IBA와 8 g・L-1 plant agar를 첨가하고 MS 배지의 농도를 1/4 (1.1 g・L-1), 1/2 (2.2 g・L-1), 1 (4.4 g・L-1)로 하였고, sucrose 농도를 0, 10, 15, 20, 30 g・L-1로 처리하여 발근 정도를 비교하였다. 시험구 배치는 증식배지 실험과 동일하게 각 처리별로 완전임의배치법 3반복으로 하였고 반복당 50 ml의 배지가 첨가된 450 ml 배양병에 약 2.0 cm 크기의 절편체를 5 ∼ 7개씩 치상하였다.

식물체 배양 및 조사

배양은 온도 25±2°C로 조절되는 배양실에서 광도 50-100 µmol・m-2・s-1 하에서 명주기 16시간/일로 배양하였다. 배양 6주 후에 신초 증식에서는 신초 수, 신초 길이, 생체중, 과수화 발생률을 조사하였으며, 발근에서는 발근율, 뿌리 수, 뿌리 길이 등을 조사하였다. 통계처리는 SAS 프로그램(SAS 9.2, SAS Institute Inc., NC, USA)을 이용하였으며 Duncan의 다중검정(p < 0.05)으로 평균치 간의 차이에 대한 유의성을 검정하였다.

기내 식물체의 DNA 추출

조직배양을 통해 얻은 M.26 기내 식물체의 유전적 다양성을 분석하기 위하여 온실에 생육하고 있는 조직배양의 시험재료로 이용한 식물체와 기내 배양하여 순화 중인 20개의 식물체를 이용하였다. 각각의 식물체에서 어린 잎을 채취하고 DNeasy plant mini kit (Qiagen, Valencia, CA, USA)를 사용하여 genomic DNA를 추출하였다. 추출된 DNA는 0.8% agarose gel에 전기영동하여 확인하였고 DNA 양은 NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, USA)로 정량한 후 5 ng・µL-1의 농도로 희석하여 SSR-polymerase chain reaction (PCR) 분석에 이용하였다.

SSR 분석

본 실험에 사용한 SSR primer는 Liebhard et al. (2002)에 의해 보고된 CH02a10 등 15종이었다(Table 5). PCR 증폭은 Cho et al. (2010)의 방법에 따라 genomic DNA 20 ng, 0.36 µM의 forward와 reverse primer, 200 µM dNTP, 1×PCR buffer, 0.4 unit Taq DNA polymerase (TaKaRa, Japan)를 혼합하여 총 반응액을 15 µL로 조정하여 실시하였다. PCR 반응은 thermocycler (iCycler, Bio-Rad Laboratories, Hercules, CA, USA)를 이용하여 94°C에서 2분 30초간 초기 변성시키고 94°C에서 30초, 60°C에서 30초, 72°C에서 1분간 35회 반복한 후 72°C에서 5분간 처리하였다. PCR 증폭 산물은 Fragment analyzer (Advanced analytical technologies, USA)을 이용하여 전기영동하였고 PROSize2.0 프로그램을 활용하여 M.26 기내 식물체 개체별로 대립유전자(allele)의 차이를 분석하였다.

In vitro shoot proliferation of M.26 apple rootstock on Murashige and Skoog media with benzyladenine (BA) and thidiazuron (TDZ) of different concentrations after 6 weeks of culture

Type of cytokinin Concentration (mg・L-1) Mean no. shoots/explant Mean shoot length (cm) Mean shoot weight/explant (g) Hyperhydricity rate (%)
Control - 1.00 g 3.32 g 0.14 e 0 e
BA 0.5 9.37 b 4.77 b 1.06 c 3.7 e
1.0 10.67 a 4.39 c 1.33 a 11.1 d
2.0 7.70 d 3.97 e 1.01 c 14.8 d
3.0 6.27 e 4.09 d 1.28 b 25.9 c
5.0 5.93 e 3.76 f 1.28 b 25.9 c
TDZ 0.01 3.17 f 5.19 a 0.47 d 3.7 e
0.05 7.43 d 3.42 g 1.21 b 44.4 b
0.1 8.40 c 3.05 h 1.43 a 88.9 a

Different letters within each column indicate significant differences based on Duncan’s multiple range test at p < 0.05.


In vitro shoot proliferation of M.26 apple rootstock on Murashige and Skoog media with benzyladenine (BA) of different concentrations and different types of auxin after 6 weeks of culture

Plant growth regulators (mg・L-1) Mean no. shoots/explant Mean shoot length (cm) Mean shoot weight (g)/explant Hyperhydricity rate (%)
BA 0.5 IBA 0.5 5.63 d 5.33 a 1.22 e 4.8 e
IAA 0.5 6.47 cd 5.08 ab 1.43 de 28.6 c
NAA 0.2 5.95 d 5.34 a 1.28 e 14.3 d
BA 1.0 IBA 0.5 8.28 a 4.33 de 2.20 a 23.8 c
IAA 0.5 7.34 bc 5.00 b 1.82 b 38.1 b
NAA 0.2 7.81 ab 4.45 c 1.68 bc 38.1 b
BA 2.0 IBA 0.5 6.90 bc 4.16 de 1.76 b 52.4 a
IAA 0.5 5.52 d 3.94 ef 1.79 b 38.1 b
NAA 0.2 4.05 e 3.68 f 1.53 cd 57.1 a

IAA, indole-3-acetic acid; IBA, indole-3-butyric acid; NAA, α-naphthaleneacetic acid

Different letters within each column indicate significant differences based on Duncan’s multiple range test at p < 0.05.


In vitro shoot rooting of M.26 apple rootstock on Murashige and Skoog media with benzyladenine (BA) and α-naphthaleneacetic acid (NAA) of different concentrations after 6 weeks of culture

Type of auxin Concentration (mg・L-1) Rooting rate (%) Mean no. roots/explant Mean root length (cm) Mean shoot length (cm)
Control - 4.77 d 0.33 e 0.43 i 3.38 g
IBA 0.5 86.7 c 7.43 c 6.53 a 5.82 d
1.0 100.0 a 11.73 a 5.45 b 7.40 a
2.0 100.0 a 8.07 c 4.43 c 6.49 b
3.0 93.3 b 7.50 c 3.66 d 6.28 bc
5.0 93.3 b 5.83 d 2.50 ef 4.60 f
NAA 0.5 100.0 a 10.33 b 2.81 e 6.05 cd
1.0 100.0 a 11.60 a 2.11 fg 5.36 e
2.0 100.0 a 10.40 b 0.96 h 5.32 e
3.0 93.3 b 5.82 d 1.78 g 5.75 d
5.0 100.0 a 7.73 c 1.03 h 5.07 e

In vitro shoot rooting of M.26 apple rootstock with Murashige and Skoog medium of different concentration and sucrose supplied with 1.0 mg·L-1 indole-3-butyric acid after 6 weeks of culture

MS strength Sucrose concentration (g·L-1) Rooting rate (%) Mean no. roots/explant Mean root length (cm) Mean shoot length (cm)
1/4 0 73.3 de 3.33 g 4.38 efg 1.92 h
10 86.7 bc 11.43 b 5.74 cd 2.25 h
15 80.0 cd 9.19 cd 5.95 c 3.22 de
20 86.7 bc 3.27 g 3.78 g 2.95 ef
30 60.0 f 3.19 g 4.58 efg 2.71 fg
1/2 0 66.7 ef 5.26 f 6.08 c 2.58 gh
10 100 a 11.40 b 5.05 de 3.41 cd
15 100 a 13.60 a 7.41 b 4.93 b
20 100 a 10.45 bc 8.33 a 5.38 a
30 100 a 8.93 cd 8.22 a 4.63 b
1 0 13.3 g 1.67 g 1.60 h 2.34 h
10 86.7 bc 7.48 de 5.08 de 3.39 cd
15 93.3 ab 6.53 ef 4.65 ef 3.60 c
20 93.3 ab 6.93 ef 3.82 fg 3.30 cd
30 80.0 cd 5.86 ef 4.36 efg 3.46 cd

Result of a simple sequence repeat (SSR) analysis of in vitro M.26 apple rootstock

SSR name Primer sequence (5’→3’) Repeat type Allele size (bp) No. of allele
CH01d08 F: CTCCGCCGCTATAACACTTC Perfect 255:269 2
R: TACTCTGGAGGGTATGTCAAAG
CH01f02 F: ACCACATTAGAGCAGTTGAGG Perfect 177:187 2
R: CTGGTTTGTTTTCCTCCAGC
CH01f03b F: GAGAAGCAAATGCAAAACCC Imperfect 166:182 2
R: CTCCCCGGCTCCTATTCTAC
CH02a10 F: ATGCCAATGCATGAGACAAA Imperfect 145:173 2
R: ACACGCAGCTGAAACACTTG
CH02c09 F: TTATGTACCAACTTTGCTAACCTC Perfect 251:275 2
R: AGAAGCAGCAGAGGAGGATG
CH02c11 F: TGAAGGCAATCACTCTGTGC Imperfect 196:216 2
R: TTCCGAGAATCCTCTTCGAC
CH02f06 F: CCCTCTTCAGACCTGCATATG Compound 148:153 2
R: ACTGTTTCCAAGCGATCAGG
CH03b10 F: CCCTCCAAAATATCTCCTCCTC Perfect 112:128 2
R: CGTTGTCCTGCTCATCATACTC
CH03d07 F: CAAATCAATGCAAAACTGTCA Perfect 198:231 2
R: GGCTTCTGGCCATGATTTTA
CH03d08 F: CATCAGTCTCTTGCACTGGAAA Perfect 129:165 2
R: TAGGGCTAGGGAGAGATGATGA
CH03d12 F: GCCCAGAAGCAATAAGTAAACC Compound 107:152 2
R: ATTGCTCCATGCATAAAGGG
CH03g06 F: ATCCCACAGCTTCTGTTTTTG Perfect 140:144 2
R: TCACAGAGAATCACAAGGTGGA
CH04c06 F: GCTGCTGCTGCTTCTAGGTT Imperfect 167:180 2
R: GCTTGGAAAAGGTCACTTGC
CH04d02 F: CGTACGCTGCTTCTTTTGCT Perfect 123:152 2
R: CTATCCACCACCCGTCAACT
CH04e05 F: AGGCTAACAGAAATGTGGTTTG Perfect 179:203 2
R: ATGGCTCCTATTGCCAATCAT

결과 및 고찰

기내 신초 증식에서 식물생장조절제의 영향

M.26 대목의 기내 신초 증식에 효과적인 cytokinin의 종류와 농도를 알아보고자 MS 기본배지에 BA와 TDZ를 첨가하여 비교한 결과, 신초 수는 1.0 mg・L-1 BA가 첨가된 배지에서 10.67개로 가장 많았으며 다음이 0.5 mg・L-1 BA가 첨가된 배지로 9.37개였다. (Table 1). 신초 길이도 BA 처리구에 있어서 0.5 mg・L-1와 1.0 mg・L-1 첨가에서 각각 4.77과 4.39 cm로 길었다. 오히려 BA 2.0 mg・L-1 이상으로 농도가 높아질수록 신초 수가 감소되는 경향이었다. TDZ이 첨가된 배지에서는 전반적으로 BA가 첨가된 배지보다 신초 수가 적었다.

기내 식물체의 과수화(hyperhydricity) 발생률도 BA 농도가 높아질수록 심해지는 경향이었다. 과수화 발생률은 BA 처리구(1.0 ∼ 5.0 mg・L-1) 보다 TDZ 0.05 mg・L-1 와 0.1 mg・L-1 처리구에서 각각 44.4%, 88.9%로 높아 배(Pyrus pyrifolia) ‘풍수’ 와 ‘행수’ 품종의 조직배양에서 adenine 유도체인 BA와 kinetin보다 합성 phenylurea 유도체인 TDZ와 N-(2-chloro-4- pyridyl)-N´-phenylurea (CPPU)에서 더 많은 과수화된 신초가 발생하였다는 Kadota and Niimi (2003)의 결과와 일치하였다. 과수화 현상은 산화적 스트레스와 연관이 있으며 식물체의 구조와 생리에 변화를 주어 결과적으로 식물체의 분화, 증식 및 이식 후의 생존율에 영향을 미친다(Picoli et al. 2001; Ziv 2005). 과수화에 영향을 미치는 요인은 고농도의 cytokinin, 높은 습도와 온도, 낮은 광도의 기내 배양환경, 고농도의 sucrose와 염류 등 다양하며(Chakrabarty et al. 2005), 과수화 현상을 효과적으로 억제하는 방법에 대한 연구가 진행되어 왔다(de Klerk and Pramanik 2017; Ivanova and Van Staden 2011; Liu et al. 2017; Yadav et al. 2003).

TDZ 처리에서는 농도가 높아질수록 신초 형성 수와 생체중은 증가하고 신초 길이는 감소하는 경향이 뚜렷하였다. TDZ 0.01 mg・L-1 처리구에서 신초 형성 수는 3.17개로 가장 낮았지만 신초 길이는 5.19 cm로 가장 길었다. Geng et al. (2016)은 왜성사과 대목인 ‘G.30’과 ‘G.40’의 기내 번식에서 TDZ의 농도(0.5 ∼ 2.0 mg・L-1)가 신초 생장에 영향을 미치지 않았다고 보고하였다. 본 연구에서 처리한 TDZ 농도 수준(0.01 ∼ 0.1 mg・L-1)이 Geng et al. (2016) 실험의 TDZ 농도보다 낮았고 실험재료가 달라 정확한 비교가 어려웠다. Van Nieuwkerk et al. (1986)은 ‘Gala’ 품종의 신초 증식에 TDZ 농도를 0.1 ∼ 10 µM 범위로 달리하여 IBA와 gibberellic acid (GA3)의 혼용 처리 효과를 보고한 바 있다. 신초 증식에 TDZ 처리가 4.4 µM BA 처리와 유의미한 차이는 없었지만, BA가 첨가된 배지보다 TDZ가 첨가된 배지에서 자란 식물체의 신초와 잎이 더 작으며, 큰 신초 덤불을 형성하였다. 이러한 신초 중에는 조직배양에서 얻을 수 있는 전형적인 식물체가 아닌 모습이 관찰되었다고 보고하였다. M.26에서는 TDZ보다는 BA가 신초의 증식에 효과적이었으며 BA 1.0 mg・L-1가 첨가된 배지에 신초 증식이 가장 양호하였다.

사과의 신초 증식에 cytokinin이 주요 생장조절물질이지만 낮은 농도의 auxin과 gibberellin의 혼용 효과에 대한 연구가 이루어졌으며 생장조절물질의 효과는 품종에 따라 매우 다른 것으로 알려져 있다(Ghanbari 2014). 신초 증식에 효과적이었던 BA (0.5, 1.0, 2.0 mg・L-1)에 auxin을 IBA, IAA, NAA 종류별로 혼용 처리한 결과는 Table 2와 같다. 신초 수는 0.5 mg・L-1 BA 또는 2.0 mg・L-1 BA에 auxin을 첨가한 배지보다 1.0 mg・L-1 BA에 auxin을 첨가한 배지에서 높았다. Auxin 중에서 0.5 mg・L-1 IBA를 첨가한 배지에서 신초 수가 8.28개로 가장 많았다. 그러나 신초 수가 BA 단용 처리보다는 BA와 auxin 혼용처리에서 낮아 사과대목 M.26 신초 증식에는 BA와 auxin의 혼용 처리는 효과가 없는 것으로 판단되었다.

과수화 현상은 BA 단용 처리와 비교하여 BA와 auxin 혼용처리에서 높은 경향으로, auxin 혼용 처리에 따른 과수화 발생에 대해 좀 더 검토할 필요가 있다. 신초 길이는 전반적으로 0.5 mg・L-1 BA와 auxin 혼용 처리구에서 5.08 ∼ 5.34 cm로 길었으며 2.0 mg・L-1 BA와 auxin 혼용 처리구에서 3.68 ∼ 4.16 cm로 짧았다. BA 농도가 1.0 mg・L-1에서 2.0 mg・L-1로 높아짐에 따라 모든 auxin 혼용 처리구에서 신초 수와 신초 길이는 감소하는 경향이었다. 본 연구에서는 M.26의 기내 증식에 있어 신초 생육과 증식률을 고려하여 1.0 mg・L-1 BA 단용 처리(Fig. 1)가 적합한 것으로 판단되었다. Sun et al. (2014)은 러시아와 중국에서 도입한 내한성과 왜성 또는 반왜성의 특성을 가지고 있는 3종의 사과 대목(Budagovosky 60-160, Budagovosky 71-3-150, GM256)의 신초 증식에 6-benzylaminopurine과 IBA를 혼용 처리한 배지에서 신초 증식에 효과적이었음을 보고하였다. 따라서 사과의 신초 증식에 cytokinin과 auxin의 혼용효과에 대하여는 금후 많은 품종에서 다양한 연구가 이루어져야 한다고 생각되었다.

Fig. 1.

Shoot proliferation of apple rootstock M.26 on Murashige and Skoog basal medium with 30 g·L-1 sucrose and 1.0 mg·L-1 BA. (A) A shoot of initial culture; (B) and (C), Shoot proliferation after 6 weeks of culture



기내 신초 발근 시 식물생장조절제의 영향

M.26 대목의 기내 발근에 효과적인 auxin의 종류와 농도를 알아보고자 MS 기본배지에 IBA와 NAA를 각각 0.5 ∼ 5.0 mg・L-1 농도로 첨가하여 비교하였다(Table 3). 신초 당 뿌리 수는 1.0 mg・L-1 IBA 처리구에서 11.73개로 가장 많았고 신초 길이가 7.40 cm로 발근이 양호하였다. IBA의 농도가 2.0 mg・L-1 이상으로 높아질수록 뿌리 길이와 신초 길이는 감소하는 경향이었다. 1.0 mg・L-1 NAA 처리구에서도 신초 당 뿌리 수가 11.60개로 많았지만 뿌리 길이와 신초 길이가 각각 2.11 cm와 5.36 cm로 1.0 mg・L-1 IBA 처리구보다 짧았다. NAA 처리구에서는 대체적으로 뿌리 길이가 0.96 ∼ 2.81 cm로 IBA 처리의 2.50 ∼ 6.53 cm와 비교하여 짧은 경향이었다.

Auxin이 첨가되지 않은 MS 기본 배지에서의 발근율은 4.77%였고 IBA가 첨가된 처리구에서는 86.7 ∼ 100%, NAA가 첨가된 처리구에서는 93.3 ∼ 100%의 높은 발근율을 나타내었다. Yeps and Aldwinckle (1994)은 사과 13종의 접수 및 대목 품종을 대상으로 발근 실험한 결과 발근에 적합한 IBA의 농도는 품종에 따라 달라 0.1 ∼ 1.0 mg・L-1 범위로 보고하였다. 본 연구에서는 M.26의 발근에 있어 효과적인 auxin의 종류와 농도는 순화 시 생존율을 높이기 위해 뿌리 길이와 신초 길이를 고려하여 IBA 1.0 mg・L-1 처리인 것으로 판단되었다.

기내 신초 발근 시 배지의 무기염류와 sucrose 농도의 영향

사과 기내 식물체의 발근 시에는 auxin의 첨가와 함께 사용하는 배지의 무기염류 농도를 1/3 ∼ 1/2로 낮추는 것이 효과적인 것으로 알려져 있다(Castillo et al. 2015; Ciccotti et al. 2008; Sun et al. 2014; Werner and Boe 1980). M.26 기내 식물체의 발근에 효과적인 auxin 종류로 선발된 IBA 1.0 mg・L-1를 기본 생장조절물질로 하여 MS 배지의 무기염류의 농도를 1/4, 1/2 및 1배 수준으로 달리하고, 배지의 탄소원인 sucrose 농도를 0 ∼ 30 g・L-1로 달리하여 발근 정도를 조사하였다(Table 4). 신초 당 뿌리 수는 1/4 MS + sucrose 10 g・L-1 (11.43개) 처리와 1/2 MS + sucrose 10 g・L-1 (11.40개), 1/2 MS + sucrose 15 g・L-1 (13.60개), 1/2 MS + sucrose 20 g・L-1 (10.45개) 처리에서 많았고 전반적으로 sucrose 농도가 높아질수록 적어지는 경향이었다. 뿌리 길이는 1/2 MS + sucrose 15, 20, 30 g・L-1 처리에서 각각 7.41, 8.33, 8.22 cm로 다른 처리에 비해 길었고, 신초 길이도 4.36 ∼ 5.38 cm로 길었다.

발근율은 1/2 MS + sucrose 10 ∼ 30 g・L-1 처리에서 100%로 높았고, sucrose가 첨가되지 않은 배지에서는 MS 배지의 무기염류 농도가 1, 1/2, 1/4로 낮아질수록 발근율은 13.3, 66.7, 73.3%로 높아지는 경향이었다. Sucrose가 첨가되지 않은 배지에서도 M.26 식물체가 발근되는 것을 확인할 수 있었다. Snir and Erez (1980)는 sucrose가 첨가되지 않은 배지에서 사과 대목인 ‘Malling Merton’의 뿌리가 발달하지 않았고 이 신초를 2% 농도의 sucrose가 첨가된 배지에 이식한 후 발근이 가능하여, sucrose가 뿌리 생장이 필수적이라고 보고하였다. 이는 뿌리 형성 수, 뿌리 길이, 신초 길이의 생장은 저조하였지만 sucrose가 첨가되지 않은 배지에서도 M.26 식물체가 발근되는 것을 확인한 본 연구결과와 상이하였다.

MS 배지의 무기염류 농도와 상관없이 전반적으로 sucrose가 10 ∼ 20 g・L-1 첨가된 처리구에서 신초 당 뿌리 수가 많고 뿌리 길이가 길어지는 경향이었다. 이는 sucrose의 농도가 부정근 형성 수에 영향을 미친다(Calamar and De Klerk 2002)는 기존의 보고와 유사하였다. 그러나 30 g・L-1 sucrose 처리구에서 다른 처리에 비해 생장이 저조하여, 고농도 sucrose (120 mM)에서 MM.106 식물체의 발근율, 뿌리 수 및 뿌리 길이가 감소되었다는 Bahmani et al. (2009)의 보고와 일치하였다. 본 연구에서는 무기염류 농도 수준인 낮은 1/4 MS 처리구에서는 신초의 엽이 갈변되는 증상이 나타나 양분이 부족한 것으로 판단되었다(자료 미제시). 이러한 결과를 종합하여 M.26 기내 식물체의 발근에는 1.0 mg・L-1 IBA, 15-20 g・L-1 sucrose가 첨가된 1/2 MS 배지가 적합한 것으로 판단되었다(Fig. 2).

Fig. 2.

In vitro rooted plantlets of M.26 apple rootstock on 1/2 Murashige and Skoog with 20 g·L-1 sucrose and 1.0 mg·L-1 indole-3-butyric acid (A) and acclimatized plantlet of M.26 (B)



SSR 마커를 이용한 기내 식물체의 유전적 다양성 분석

조직배양에 의한 급속 대량 번식에서 가장 중요한 조건 중의 하나는 유전적으로 균일한 개체를 증식하는 것이다(Dobránszki and Teixeira da Silva 2010). 여러 작물에서 기내배양 중에 발생하는 유전적 변이 특성을 분석하기 위해 random amplified polymorphic DNA(RAPD), amplified fragment length polymorphism, inter-simple sequence repeats (ISSR) 등 다양한 분자마커가 적용되었다(Li et al. 2002; Martins et al. 2004; Prado et al. 2007).

본 연구에서는 사과에서 유래한 SSR primer를 이용하여 온실에서 생육 중인 M.26 식물체와 기내배양을 통해 얻은 순화하고 있는 식물체 중 20개체를 대상으로 유전적 다양성을 분석하였다(Table 5). CH01d08 primer로부터 255 bp와 269 bp 크기의 대립유전자가 모든 개체에서 동일하게 증폭되었다(Fig. 3). 15종의 primer를 이용하여 분석한 결과 primer별로 각각 2개의 대립유전자가 증폭되어 총 30개의 대립유전자가 검출되었는데 모두 동일한 밴드 패턴을 보였다. 이는 사과 대목 ‘Merton 793’의 기내 식물체를 ISSR 분석한 결과 모식물체와 동일한 밴드 패턴을 나타내어 조직배양을 통한 액아 증식이 본연의 특성을 가진 식물체를 증식하는 가장 안전한 방법이라고 제시한 Pathak and Dhawan (2012)의 보고와 일치하였다. McMeans et al. (1998)은 사과나무 ‘Gala’와 ‘Royal Gala’의 액아와 부정아에서 유래한 기내 식물체와 기외 접목한 식물의 형태적 특성 검정을 통해 체세포 변이 발생 여부를 검정하였다. 조직배양을 통해 얻은 나무는 접목한 나무에 비해 비교적 직립이며 분지각(branch angle)이 좁은 편이었지만 과실 형질, 개화기, 화기 형태 등은 차이가 없어 조직배양이 유용한 번식 방법이라고 보고하였다.

Fig. 3.

Simple sequence repeat profiles of M.26 plants using a CH01d08 primer. (A) Greenhouse grown control plantlet; (B)-(D) Micro-propagated plantlets



기내 조직배양 중의 체세포 변이는 유전자형과 장기간의 배양 기간, 배지에 첨가하는 생장조절물질 등 배양 조건에 의해 발생한다고 알려져 있다. Modgil et al. (2005)은 RAPD 마커를 이용하여 기내 배양한 MM.106 신초의 유전적 안정성을 분석한 연구에서 장기간 배양기간이 변이를 유기하는 하나의 요인이라고 추정하였다. 반면에 Devarumath et al. (2002)은 기내 배양한 차나무(Camellia sinensis)에서의 유전적 변화는 배양조건보다는 유전자형과 더 높은 관련이 있다고 보고하였다. 본 연구에서는 기내 배양된 M.26 개체들이 SSR 마커 분석을 통해 유전적으로 안정한 편으로 판단되었으나, 추후 형태적인 특성 검정 결과를 종합하여 검토할 필요가 있다.

적요

본 연구는 사과 대목 M.26 (Malus pumila Mill))의 효과적인 기내 대량번식하기 위해 신초 증식과 뿌리 형성에 적합한 배지 조건을 확립하고, simple sequence repeat (SSR) 마커를 이용하여 증식된 소식물체의 유전적 다양성을 분석하고자 수행하였다. MS (Murashige and Skoog) 기본배지에 benzyladenin (BA, 0.5 ∼ 5.0 mg・L-1)와 thidiazuron (TDZ, 0.01 ∼ 0.1 mg・L-1)을 첨가하여 신초를 배양한 결과, 1.0 mg・L-1 BA 처리에서 절편체 당 신초 수가 10.67개로 가장 많았으며 과수화 발생률은 BA 처리구보다 TDZ 처리구에서 높았다. M.26 신초 증식에 BA와 auxin과의 혼용처리 효과는 없었고, 1.0 mg・L-1 BA가 첨가된 MS 기본배지가 적합하였다. 신초 발근에 적합한 배지를 구명하고자 auxin인 indole-3-butyric acid (IBA)와 α-naphthaleneacetic acid의 농도(0.5 ∼ 5.0 mg・L-1), MS 배지의 무기염류(1/4 ∼ 1배) 및 sucrose 농도(0 ∼ 30 g・L-1)를 달리하여 처리한 결과, 1.0 mg・L-1 IBA, 15 ∼ 20 g・L-1 sucrose가 첨가된 1/2 MS 배지에서 발근율(100%), 뿌리 수(10.45 ∼ 13.60개/절편체), 뿌리 길이(7.41 ∼ 8.33 cm) 및 신초 길이(4.93 ∼ 5.38 cm)가 양호하였다. 15종의 SSR primer를 이용하여 증식된 20개의 소식물체를 분석한 결과, 총 30개의 대립유전자가 검출되었으며 모두 동일한 밴드 패턴을 보여 온실에서 자란 M.26 식물체와 유사하여 유전적으로 안정한 것으로 판단되었다.

사사

본 논문은 농촌진흥청 연구사업(세부과제번호: PJ01022803)의 지원에 의해 이루어진 것임

References
  1. Amberger PV, Shoemaker RC, and Palmer RG. (1992) Inheritance of two independent isozyme variants in soybean plants derived from tissue culture. Theor Appl Genet 84, 600-607.
    Pubmed CrossRef
  2. Bahmani R, Karami O, and Gholami M. (2009) Influence of carbon sources and their concentrations on rooting and hyperhydricity of apple rootstock MM.106. World Appl Sci J 6, 1513-1517.
  3. Calamar A, and De Klerk GJ. (2002) Effect of sucrose on adventitious root regeneration in apple. Plant Cell Tissue Org Cult 70, 207-212.
    CrossRef
  4. Castillo A, Cabrera D, Rodríguez P, Zoppolo R, and Robinson T. (2015) In vitro micropropagation of CG41 apple rootstock. Acta Hort 1083, 569-576.
    CrossRef
  5. Chakrabarty D, Park SY, Ali MB, Shin KS, and Paek KY. (2005) Hyperhydricity in apple: ultrastuctural and physiological aspects. Tree Physiol 26, 377-388.
    Pubmed CrossRef
  6. Cho KH, Heo S, Kim JH, Shin IS, Kim SE, Kim DH, Han SE, and Kim HR. (2010) Analysis of genetic diversity of apple cultivars using RAPD and SSR markers. Kor J Breed Sci 42, 525-533.
  7. Ciccotti AM, Bisognin C, Battocletti I, Salvadori A, Herdemertens M, and Jarausch W. (2008) Micropropagation of apple proliferation-resistant apomictic Malus sieboldii genotypes. Agron Res 6, 445-458.
  8. deKlerk G-J, and Pramanik D. (2017) Trichloroacetate, an inhibitor of wax biosynthesis, prevents the development of hyperhydricity in Arabidopsis seedlings. Plant Cell Tiss Org Cult 131, 89-95.
    CrossRef
  9. Devarumath RM, Nandy S, Rani V, Marimuthu S, Muraleedharan N, and Raina SN. (2002) RAPD, ISSR and RFLP fingerprints as useful markers to evaluate genetic integrity of micropropagated plants of three diploid and triploid elite tea clones representing Camellia sinensis(China type) and C. assamica ssp. assamica(Assam-India type). Plant Cell Rep 21, 166-173.
    CrossRef
  10. Dobránszki J, and Teixeira daSilva JA. (2010) Micropropagation of apple- a review. Biotechnol Adv 28, 462-488.
    Pubmed CrossRef
  11. Geng F, Moran R, Day M, Halteman W, and Zhang D. (2016) Increasing in vitro shoot elongation and proliferation of 'G.30'and 'G.41'apple by chilling explants and plant growth regulators. HortScience 51, 899-904.
    CrossRef
  12. Ghanbari A. (2014) Impacts of plant growth regulators and culture media on in vitro propagation of three apple (Malus domestica Borkh.) rootstocks. Iran J Gent Plant Breed 3, 11-20.
  13. Gimenez C, Garcia ED, Enrech NXD, and Blanca I. (2001) Somaclonal variation of banana: cytogenetic and molecular characterization of somaclonal variant CIEN BTA-03. In Vitro Cell Dev Biol Plant 37, 217-222.
    CrossRef
  14. Ivanova M, and Van sStaden J. (2011) Influence of gelling agent and cytokinins on the control of hyperhydricity in Aloe polyphylla. Plant Cell Tiss Org Cult 104, 13-21.
    CrossRef
  15. Jain SM. (2001) Tissue culture-derived variation in crop improvement. Euphytica 118, 153-166.
    CrossRef
  16. James DJ, and Thurnbon IJ. (1981) Shoot and root initiation in vitro in the apple rootstock M.9 and the promotive effects of phloroglucinol. J Hortic Sci 56, 15-20.
  17. Jones OP. (1967) Effect of benzyladenine on isolated apple shoots. Nature 215, 1514-1515.
    Pubmed CrossRef
  18. Jun JH, Chung KH, Jeong SB, Hong KH, and Kang SJ. (2001) Rapid multiplication of M.9 apple rootstocks in vitro. Kor J Hort Technol 19, 34-38.
  19. Kadota M, and Niimi Y. (2003) Effects of cytokinin types and their concentrations on shoot proliferation and hyperhydricity in in vitro pear cultivar shoots. Plant Cell Tiss Org Cult 72, 261-265.
    CrossRef
  20. Ko S-M, Lee J-H, and Oh M-M. (2018) Development of nutrient solution for in vitro propagation of 'M9' apple rootstock plantlets. Hortic Sci Technol 36, 202-214.
  21. Lane WD, and Mcdougald JM. (1982) Shoot tissue culture of apple: comparative response of five cultivars to cytokinin and auxin. Can J Plant Sci 62, 689-694.
    CrossRef
  22. Li X, Xu M, and Korban SS. (2002) DNA methylation profiles differ between field- and in vitro-grown leaves of apple. J Plant Physiol 159, 1229-1234.
    CrossRef
  23. Liebhard R, Gianfranceschi L, Koller B, Ryder CD, Tarchini R, Van de Weg E, and Gessler C. (2002) Development and characterisation of 140 new microsatellites in apple (Malus×domestica Borkh.). Mol Breed 10, 217-241.
    CrossRef
  24. Liu M, Jiang F, Kong X, Tian J, Wu Z, and Wu Z. (2017) Effects of multiple factors on hyperhydricity of Allium sativum L. Sci Hortic 217, 285-296.
    CrossRef
  25. Martins M, Sarmento D, and Oliveira MM. (2004) Genetic stability of micropropagated almond plantlets, as assessed by RAPD and ISSR markers. Plant Cell Rep 23, 492-496.
    Pubmed CrossRef
  26. McMeans O, Skirvin RM, Otterbacher A, and Mitiku G. (1998) Assessment of tissue culture-derived 'Gala' and 'Royal Gala' apples (Malus×domestica Borkh.) for somaclonal variation. Euphytica 103, 251-257.
    CrossRef
  27. Modgil M, Mahajan K, Chakrabarti SK, Sharma DR, and Sobti RC. (2005) Molecular analysis of genetic stability in micropropagated apple rootstock MM106. Sci Hortic 104, 151-160.
    CrossRef
  28. Murashige T, and Skoog F. (1962) A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol Plant 15, 473-497.
    CrossRef
  29. Palombi MA, and Damiano C. (2002) Comparison between RAPD and SSR molecular markers in detecting genetic variation in kiwifruit (Actinidia deliciosa A. Chev). Plant Cell Rep 20, 1061-1066.
    CrossRef
  30. Pathak H, and Dhawan V. (2012) ISSR assay for ascertaining genetic fidelity of micropropagated plants of apple rootstock Merton 793. In Vitro Cell Dev Biol Plant 48, 137-143.
    CrossRef
  31. Picoli EAT, Otoni WC, Figueira ML, Carolino SMB, Almeida RS, Silva EAM, Carvalho CR, and Fontes EPB. (2001) Hyperhydricity in vitro eggplant regenerated plants: structural characteristics and involvement of BiP (Binding Protein). Plant Sci 160, 857-868.
    Pubmed CrossRef
  32. Prado MJ, Gonzalez MV, Romo S, and Herrera MT. (2007) Adventitious plant regeneration on leaf explants from adult male kiwifruit and AFLP analysis of genetic variation. Plant Cell Tiss Org Cult 88, 1-10.
    CrossRef
  33. Snir I, and Erez A. (1980) In vitro propagation of Malling Merton apple rootstocks. HortScience 15, 597-598.
  34. Sun QR, Sun HY, Bell RL, Li LG, Xin L, Tao JH, and Li Q. (2014) Optimisation of the media for in vitro shoot proliferation and root induction in three new cold-hardy and dwarfing or semi-dwarfing clonal apple rootstocks. J Hortic Sci Biotech 89, 381-388.
    CrossRef
  35. Van Nieuwkerk JP, Zimmerman RH, and Fordham I. (1986) Thidiazuron stimulation of apple shoot proliferation in vitro. HortScience 21, 516-518.
  36. Werner EM, and Boe AA. (1980) In vitro propagation Malling 7 apple rootstock. HortScience 15, 509-510.
  37. Yadav MK, Gaur AK, and Garg GK. (2003) Development of suitable protocol to overcome hyperhydricity in carnation during micropropagation. Plant Cell Tiss Org Cult 72, 153-156.
    CrossRef
  38. Yepes LM, and Aldwinckle HS. (1994) Micropropagation of thirteen Malus cultivars and rootstocks, and effect of antibiotics on proliferation. Plant Growth Regul 15, 55-67.
    CrossRef
  39. Yoon TM, Park HY, and Sagong DH. (2005) Effect of root pruning on tree growth and fruit quality of 'Fuji'/M.9 apple trees. Kor J Hort Sci Technol 23, 275-281.
  40. Ziv M. (2005) Simple bioreactors for mass propagation of plants. Plant Cell Tiss Org Cult 81, 277-285.
    CrossRef


March 2019, 46 (1)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM