search for




 

Quality and genetic relationship on dehulling characteristic in oat variety
J Plant Biotechnol 2018;45:375-381
Published online December 31, 2018
© 2018 The Korean Society for Plant Biotechnology.

Kyeong-Min Kim, Dongjin Shin, Kyeong-Hoon Kim, Yu-Ri Kwon, Hyo-Jin Park, Jong-Nae Hyun, Young-Jin Kim, Myung-Kyu Oh, and Young-Hoon Park

Department of Southern Area Crop Science, National Institute of Crop Science, Rurar Development Administration, Miryang, 50424, Korea,
Department of Horticultural Bioscience, Pusan National University, Miryang, 50463, Korea
Correspondence to: e-mail: ypark@pusan.ac.kr
Received October 22, 2018; Revised December 5, 2018; Accepted December 5, 2018.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

The consumption of oats (Avena sativa L.) with high nutritional utility is accelerating due to the increased consumers’ demand for functional foods. In Korea, naked oats are used as food, while covered oats are used for animal feed. However, it is difficult to distinguish naked oats from covered oats when the husk is removed from the grains by a special process. The present study was carried out to investigate experimental methods that would be beneficial in the segregation of different types of oats after husk removal. Grain quality-related biochemical compounds were analyzed in a bid to differentiate the oat dehulling characteristics. In addition, 61 SSR markers were examined for genetic relationship and variety identification of oats using five naked and seven covered oat varieties. Results showed that, the contents of protein, lipid, and β-glucan were not significantly different among the oat varieties and this could not be used as an index for distinguishing oats husk character. However, in the fatty acid composition ratio,, naked oats had a higher ratio of stearic acid (C18:0) and oleic acid (C18:1) than covered oats, and covered oats had a higher ratio of linoleic acid (C18:2) and linoleic acid (C18:3) than naked oats. The assessment of SSR marker genotype revealed that 33 polymorphic bands among 12 oat varieties and 1 variety could be distinguished through the combination of polymorphic markers thus indicating the usability of these markers for variety identification in oats.

Keywords : Oat (Avena sativa L.), biochemical compound, simple sequence repeats, and variety identification
서언

귀리(Avena sativa L.)는 세계적으로 벼과 작물 중에서 밀, 옥수수, 벼, 보리 다음으로 생산량이 많은 작물이며, 대부분이 가축사료로 쓰이나, 종실은 단백질과 지질이 풍부하고, 체내 이용률이 높은 식이섬유인 베타글루칸이 3 ∼ 6% 들어있어 섭취 시 인체 내의 혈장 콜레스테롤을 감소시키기 때문에 성인병 예방 등 식용으로도 그 가치를 인정받고 있다(Han et al. 2014). 또한 귀리에는 다양한 폴리페놀이 존재하며, 귀리에 특이적으로 있는 항산화성분인 아베난스라마이드류는 아토피에 효과가 있는 것으로 알려져있다(Cai et al. 2011; Dimberg et al. 1993; Peterson et al. 2002). 이와 관련하여 귀리 도입량은 2011년 3,890톤에서 2015년 상반기만 20,000톤으로 급격하게 증가하였고(Customs import and export trade statistics 2015, KDI Economic Information Center 2015), 이는 귀리에 대한 국내 소비자의 요구가 매우 많다는 것을 알 수 있다.

귀리는 겉귀리와 쌀귀리가 있는데, 영양 면으로 볼 때 쌀귀리는 겉귀리보다 단백질, 필수아미노산 및 베타글루칸 함량이 높아 식용으로 가치가 높다(Han et al. 2008, 2009). 특히 귀리는 식이섬유가 많은 곡물로 알려져 있는데, 국내 육성 귀리의 총 식이섬유 함량은 쌀귀리인 ‘대양’과 ‘조양’ 품종이 4%로 가장 많고, 불용성 식이섬유도 ‘대양’과 ‘조양’ 품종이 가장 높은 등 수용성 및 불용성 모두 쌀귀리가 겉귀리에 비해 높다(Lee et al. 2016). 겉귀리와 쌀귀리는 종실의 껍질 유무로 구분되는데 겉귀리는 종실에 내영과 외영이라는 껍질이 있고 쌀귀리는 껍질이 없다. 이런 이유로 겉귀리는 수확 후 껍질을 탈피하기 위한 노력이 필요하지만, 쌀귀리는 탈곡과 함께 껍질이 제거되어 식용으로 이용하기 유리한 점이 있어 현재 우리나라에서 대부분 쌀귀리를 식용으로 사용하고 있다. 하지만 종실의 껍질을 제거한 후에는 겉귀리와 쌀귀리가 외관적으로 비교가 잘 되지 않고, 도입되는 귀리가 국내산 쌀귀리와 판별이 어려운 실정이다.

이러한 차이점을 판별하는 방법으로는 분자마커를 이용한 방법이 있는데, 그 중 동‧식물의 염색체에 고르게 분포하고 있는 Microsatellite는 이들과 인접한 염기서열이 매우 보존적이며 생성되는 대립유전자(allele)의 수가 많아 품종간 높은 다형성을 보이기 때문에 게놈 연구에 중요하게 이용되고 있으며, 단순 반복 염기서열의 반복 횟수의 차이로 관찰되므로 Simple Sequence Repeat (SSR) 마커라고 부른다(Xiao et al. 2016). 벼의 경우 품종판별에 Ramdom ampified polymorphic DNA (RAPD), Amplified fragment length polymorphism (AFLP), SSR 등과 같은 마커가 활용되고 있는데, RAPD 분석 방법은 분석의 재현성과 비용뿐만 아니라 마커의 특성이 우성(dominant) 형태를 나타내기 때문에 이용에 제한 요소가 있는 반면 SSR은 다형성정도가 아주 높고 마커가 공우성(co-dominant) 상태를 나타내기 때문에 검정 계통의 이형접합 (heterozygosity) 여부를 쉽게 확인할 수 있는 장점이 있다(Kwon et al. 2006).

다른 작물에 비해 국내에서는 귀리의 게놈 연구가 이루어지지 않고 품종 판별 또한 시도한 연구는 없는 실정이다. 따라서 본 연구는 현재 농촌진흥청 국립식량과학원에서 개발된 쌀귀리 5품종과 겉귀리 7품종을 SSR마커를 이용하여 쌀귀리와 겉귀리 판별마커 및 나아가 귀리품종판별 마커를 선발하고자 수행하였다

재료 및 방법

시험재료

본 실험에 사용한 재료는 농촌진흥청 국립식량과학원 육성 품종인 쌀귀리 ‘조양’, ‘대양’, ‘선양’, ‘수양’, ‘중모2005’ 5품종과 겉귀리 ‘삼한’, ‘동한’, ‘풍한’, ‘옥한’, ‘태한’, ‘조풍’, ‘다한’ 7품종을 국립식량과학원 남부작물부(경남, 밀양) 답리작포장에서 2015년 10월에 파종하여 2016년 6월에 수확한 종실을 이용하여 품질 및 탈부 특성을 조사하였다. 파종방법은 휴립광산파로 실시하고 파종량은 15 kg/10a를 기준으로 하였으며, 시비량은 보리 표준시비량인 10a당 N2 9.4 kg, P2O5 7.5 kg, K2O 4.0 kg를 기준으로 시용하였다.

이화학적 특성 및 식이섬유 함량

귀리의 조단백질 함량은 질소/단백질 분석기(Kjeltec 8400, FOSS, Hillerod, Denmark)를 이용하여 전질소 함량을 구한 다음 질소계수 5.83을 곱하여 산출하였고 조지방은 조지방 자동 추출기(SoxtecTM 2050, FOSS, Hillerod, Denmark)를 이용하여 정량하였으며(NICS 2009), 귀리의 총 베타글루칸은 Megazyme kit(K-BGLU, Bray Business Park, Bray, Ireland)를 이용하여 분석하였다.

지방산 조성

귀리의 지방산 조성은 조지방 자동 추출기로 분리한 지방을 150 µl 취하여 시약(MeOH: H2SO4 : Toluene =20:1:10(v:v:v))을 5 ml 첨가하였다. 그 후 튜브를 밀봉하고 수조에 150°C 1시간 반응시켜 fatty acid methyl ester형태로 변환시켰다. 방냉 후 초순수를 5 ml 첨가하여 흔들어 주었고 방치한 후 상등액을 취해 NaSO4를 소량(50 mg±10) 첨가한 e-튜브에 넣고 vortex mixer로 남은 물을 제거해주었다. 그 후 상등액을 auto sample vial에 0.7 ml 준비하고 sample 수만큼 증류수가 담긴 vial을 준비한 후 Gas Chromatography (7890A, Agilent Technologies, Santa Clara, USA)를 이용해 분석하였다.

DNA 추출 및 PCR

파종 후 14일된 어린묘의 잎을 채취하여 액체질소를 이용하여 마쇄하고 CTAB (cetyltrimethylammonium bromide)을 사용하여 DNA를 추출하였다(Murray & Thomson 1980). PCR 증폭반응은 유전자증폭기(Applied Biosystems, VERITI, Waltham, USA)를 이용하여 94°C에서 10분 denaturation 후, 94°C에서 30초, 59°C에서 30초, 72°C에서 1분 30초를 35cycle을 실행한 후 마지막으로 72°C에서 10분간 extention 하였다. 증폭된 PCR 산물은 자동전기영동장치(HDA-GT12, QIAGEN, Hilden, Germany)을 통해 분석하였다.

SSR 분석

귀리의 탈부특성에 따른 근연관계 분석을 위해 University of Sasakatchewan의 CMG-Lab (http://www.cmglab.usask.ca)에서 제공하는 61개의 SSR 마커를 이용하여 분석하였다.

근연관계 분석

귀리의 근연관계 분석은 귀리 12품종을 61개의 SSR 마커로 분석한 후 특정 사이즈에 밴드가 나타나면 1, 밴드가 나타나지 않으면 0으로 값을 주었다. 그 후 결과 값들을 NTSYSpc 2.1 프로그램을 사용하여 분석하여 Genetic similarity를 구하고 집단화(Clustering)한 다음 Phenetic tree 모형으로 나타내었다.

통계 분석

이 실험에서 얻어낸 조단백질, 조지방, 베타글루칸 비율의 데이터는 SAS Ver. 12.0 program (SAS, 2004)을 이용하여 분산분석을 실시하였으며, Duncan’s multiple range test에 의하여 5% 유의수준에서 처리구간의 통계적인 차이를 구명하였다.

결과 및 고찰

귀리 이삭 및 탈부 특성

쌀귀리와 겉귀리를 식물체 상태에서 구분할 수 있는 방법은 출수 후 이삭의 형태를 관찰하는 것인데 쌀귀리의 경우 한 소수에 영화수가 5개 내외로 생기는데 비해 겉귀리는 2 ∼ 3개로 구별이 된다(Fig. 1). 귀리의 탈부 특성은 수확 후 탈곡기를 이용해 탈곡한 종실형태(Fig. 2)를 관찰하여 조사하였으며, 품종별로 Table 1에 나타난 바와 같다.

Fig. 1.

Two kinds of oats (Avena sativa L.) ear phenotype after heading. (A) Naked oat, (B) Covered oat


Fig. 2.

Two kinds of oats (Avena stiva L.) seed phenotype after threshing. (A) Naked oat, (B) Covered oat


List of oat varieties (Avena stiva L.) and husk characteristics surveyed in this study

No. Varieties Characteristics Cross combination Developed year
1 Choyang naked Sikyonggwiri/gwiri23 2008
2 Daeyang naked FLX446-1-84-Q1/SO92004-B-3-3-5-7 2008
3 Seonyang naked Early80/Cuauthemoc 2004
4 Suyang naked Sikyonggwiri/gwiri23 2011
5 Jungmo2005 naked Early80/gwiri33 2011
6 Samhan husked Early80/Cl7518 2004
7 Donghan husked Early80/Cl7518 2004
8 Punghan husked Sikyonggwiri/PA202-210 2012
9 Okhan husked Early80/Maine Pl590 2012
10 Taehan husked Sprinter/73625//gwiri26 2012
11 Jopung husked Early80/gwiri23 2012
12 Dahan husked Sprinter/73625//gwiri26 2012


이화학적 특성 및 식이섬유 함량

귀리의 품종별 이화학적 특성 및 식이섬유인 베타글루칸 함량은 Table 2에 나타난 바와 같았다. 귀리의 단백질의 경우 총 단백질 함량에 관계없이 라이신 함량이 일정하여 좋으며, 다른 곡물에 비해 단백질 함량이 높다고 알려져 있는데, Flander et al. (2007); Gangopadhyay et al. (2015) 쌀귀리는 13.45 ∼ 16.56%, 겉귀리는 12.95 ∼ 15.31%의 함량 분포를 나타내었다. 가장 단백질 함량이 높은 품종은 16.56%의 함량을 나타낸 ‘선양’으로 이는 Lee et al. (2016)이 보고한 것과 같은 결과이다. 조지방의 경우 쌀귀리는 7.26 ∼ 10.34%의 함량 분포를 나타내었고 겉귀리는 7.53 ∼ 10.82%의 함량 분포를 나타내었으며, 그 중 ‘동한’이 10.82%로 가장 높은 조지방 함량을 나타내었다.

Comparison of protein and lipid and β-glucan ratio of oat varieties (Avena stiva L.)

 Varieties  Protein (%)  Lipid (%)  β-Glucan (%)
Choyang 14.38±0.17cz 9.88±0.04bz 4.97±0.10cz
Daeyang 13.60±0.13efz 9.91±0.27bz 4.86±0.04cz
Seonyang 16.56±0.10az 7.26±0.50ez 4.19±0.04ez
Suyang 13.90±0.03dz 10.34±0.33abz 5.05±0.08cz
Jungmo2005 13.45±0.10fz 9.99±0.21bz 4.67±0.01dz
Samhan 13.45±0.11fz 7.53±0.24ez 5.60±0.21az
Donghan 13.87±0.17dz 10.82±0.70az 5.29±0.11bz
Punghan 12.95±0.17gz 8.39±0.17cdz 3.76±0.19fz
Okhan 13.77±0.11dez 7.80±0.34dez 5.29±0.01bz
Taehan 15.31±0.23bz 8.50±0.46bz 3.49±0.14gz
Jopung 13.36±0.06fz 8.17±0.10fz 5.35±0.09bz
Dahan 14.30±0.17cz 8.22±0.17cz 4.31±0.07ez

a-dMeans in a row with different superscripts are significantly different (p<0.05).



귀리의 베타글루칸은 보리의 베타글루칸과는 달리 수용성 베타글루칸 함량이 높아 불용성 식이섬유에 비해 생리적 기능이 더 우수하다. 본 시험에서 쌀귀리는 4.19 ∼ 5.05%, 겉귀리는 3.49 ∼ 5.60%의 함량 분포를 품종별로 나타내었으며, 그 중 ‘삼한’이 5.60%로 가장 높은 베타글루칸 함량을 나타내었다. 귀리의 이화학적인 품질 특성 및 심이섬유의 함량은 품종 간에는 차이를 나타내었으나 쌀귀리와 겉귀리를 구분 할 수 있을 정도의 유의성을 찾아내진 못하였다.

지방산 조성

귀리의 지방산 조성은 올레인산(C18:1, oleic acid, 40.2 ∼ 50.9%), 리놀레산(C18:2, linoleic acid, 30.6 ∼ 41.2%), 팔미트산(C16:0, palmitic acid, 14.3 ∼ 16.6%), 스테아르산(C18:0, stearic acid, 1.2 ∼ 2.5%), 리놀렌산(C18:3, linolenic acid, 0.7 ∼ 1.3%), 아라키딘산(C20:0 arachidic acid, 0.8 ∼ 12%) 비율 순이었다(Table 3). 팔미트산은 쌀귀리 14.3 ∼ 16.4%, 겉귀리 14.0 ∼ 16.6%의 함량 분포를 나타내었고, 스테아르산은 쌀귀리 1.7 ∼ 2.5%, 겉귀리 1.2 ∼ 1.7%의 함량 분포를 나타내었고, 올레인산은 쌀귀리 44.3 ∼ 50.9%, 겉귀리 40.2 ∼ 46.2%의 함량 분포를 나타내었고, 리놀레산은 쌀귀리 30.6 ∼ 35.7%, 겉귀리 35.0 ∼ 41.2%의 함량 분포를 나타내었고, 리놀렌산은 쌀귀리 0.7 ∼ 1.0%, 겉귀리 1.1 ∼ 1.2%의 함량 분포를 나타내었고, 아라키딘산은 쌀귀리 0.8 ∼ 1.2%, 겉귀리 0.8 ∼ 1.1%의 함량 분포를 나타내었다. 불포화지방산은 올레인산과 레놀레산 그리고 리놀렌산이며 총 불포화지방산 함량은 쌀귀리 80.4 ∼ 82.3%, 겉귀리 81.0 ∼ 83.5%의 함량 분포를 나타냈다. 결과를 정리해 보면 쌀귀리가 겉귀리에 비해 올레인산과 스테아르산이 높고 겉귀리는 쌀귀리에 비해 리놀레산과 리놀렌산이 높은 경향을 나타내었는데, Lee et al. (2016)의 보고와 일치한다.

Comparison of fatty acid ratio of oat varieties (Avena stiva L.)

 Varieties Palmitic acid (%) Stearic acid (%) Oleic acid (%) Linoleic acid (%) Linolenic acid (%) Arachidic acid (%) Unsaturated fatty acid (%)

(C16:0) (C18:0) (C18:1) (C18:2) (C18:3) (C20:0)
Choyang 14.7 2.1 48.2 33.2 0.9 0.9 82.3
Daeyang 14.3 2.5 50.9 30.6 0.7 1.1 82.2
Seonyang 16.4 2.5 44.3 35.1 1 0.8 80.4
Suyang 16.3 2.1 48.8 30.6 1 1.2 80.4
Jungmo2005 15.2 1.7 45.6 35.7 0.7 0.9 82.0
Samhan 15.1 1.5 40.2 41.2 1.1 0.9 82.5
Donghan 14 1.7 44 38.3 1.2 0.8 83.5
Punghan 14.9 1.2 41.9 39.9 1.2 1 83.0
Okhan 15.1 1.6 46.2 35 1.2 1 82.4
Taehan 14.7 1.6 44.2 37.1 1.3 1 82.6
Jopung 14.3 1.5 45.8 36.2 1.1 1 83.1
Dahan 16.6 1.2 42.5 37.3 1.2 1.1 81.0


유연관계 분석

61개의 SSR 마커를 12개 귀리 품종에 이용한 결과 33개의 SSR 마커에서 다형성을 나타나는 밴드를 확인하였고, 15-300 bp사이의 DNA밴드를 데이터화 하였다(Table 4). 총 155개의 밴드패턴으로 Phenetic tree를 그려본 결과는 Fig. 3에 나타난 바와 같다. Phenetic tree에서 유전적 거리(Genetic Distance)가 가까울수록 계수(Coefficient) 0에 가깝다. 임의로 계수(Coefficient) 1.22에서 그룹화 한 결과 겉귀리 6품종과 쌀귀리 1품종으로 그룹 되었고 유전적 거리(Genetic Distance)는 ‘동한’과 ‘태한’이 가장 가깝게 나타났으며 다음은 ‘풍한’, ‘삼한’, ‘옥한’, ‘조풍’, ‘중모2005’ 순으로 가까웠다. 계수(Coefficient) 1.22에서 그룹되지 않은 귀리는 겉귀리 1품종과 쌀귀리 4품종으로 ‘수양’, ‘다한’, ‘대양’, ‘선양’, ‘조양’ 순으로 그룹에서 먼 것으로 나타났다. 유전적 거리(Genetic Distance)가 대체적으로 겉귀리와 쌀귀리가 멀게 나타났으나, 겉귀리와 쌀귀리 두가지 그룹으로 확실하게 구분되지는 않았다. 이는 실험에서 사용된 마커의 수와 다형성을 나타낸 밴드의 수가 적어 겉귀리와 쌀귀리를 완벽하게 구분할 정도가 아니었다고 판단되며, 더욱 다양하고 많은 마커를 사용하여 근연관계를 분석한다면 겉귀리와 쌀귀리가 유전적으로 구분될 것으로 보인다.

List of the SSR markers for representing polymorphism used for genotyping of 12 oat cultivars (Avena stiva L.)

SSR Marker (AM) Tm (°C) Length  (Repeat motif) number  Forward primer (5’ to 3’)  Reverse primer (5’ to 3)’ Number of allels PIC value
AM1 46 204 (AG)21.(CAGAG)6 GGATCCTCCACGCTGTTGA CTCATCCGTATGGGCTTTA 4 0.65
AM4 48 166 (AG)34 GGTAAGGTTTCGAAGAGCAAAG GGGCTATATCCATCCCTCAC 8 0.87
AM7 48 156 (AG)21 GTGAGCGCCGAATACATA TTGGCTAGCTGCTTGAAACT 8 0.75
AM9 48 217 (AG)19 CAAAGCATTGGGCCCTTGT GGCTTTGGGACCTCCTTTCC 3 0.65
AM17 44 250 (AC)13 CGAGATTTCGGTGTAGAC CCGGGAATTAACGGAGTC 3 0.43
AM19 48 251 (AC)3..(AC)6..(AC)5..(AC)7 ATAGAACGGCATGATAACGAAATA GCGCGACAACAGGACCTTC 3 0.63
AM20 50 258 (TG)10.(CG)5 TGTCGATTTCTTTAGGGCAGCACT TCGCGAGAAAGATGGAAAGGAGA 3 0.62
AM21 46 210 (AT)5..(AC)5..(AC)5 ACGTTGGTCTCGGGTTGG AAATCCTTGACTTCGCTCTGA 3 0.57
AM22 46 138 AC)22 ATTGTATTTGTAGCCCCCAGTTC AAGAGCGACCCAGTTGTATG 2 0.28
AM23 45 247 (AC)19 TCTTTAAGGATTTGGGTGGAG AATCTTCGAGGGTGAGTTTCT 5 0.68
AM24 45 170 (AAG)5..(TCA)5 GTTATTGATTTCCTGATGTAGAGA AGAGCCAAGAAAGCAACTG 2 0.38
AM25 47 229 (AC)8..(AC)4(CT)4 AGCCTGGACATGTAATCTGGT AGCCCTGGTCTTCTTCAACA 3 0.53
AM27 45 161 (AAG)10 CAAAGGCCAAATGGTGAG CCGCAAAGTCATATGGAGCAT 6 0.79
AM28 46 135 (GAA)8 GACCTCTTGAGTAAGCAACG TGGTCTTCCTATCCACAATG 5 0.73
AM29 43 143 (GAA)9 TCCCGCAAAATCATCACGA AAGGGAGCATTGGTTTTGTT 3 0.54
AM30 43 203 (GAA)14 TGAAGATAGCCATGAGGAAC GTGCAAATTGAGTTTCACG 10 0.87
AM31 47 186 (GAA)23 GCAAAGGCCATATGGTGAGAA CATAGGTTTGCCATTCGTGGT 6 0.81
AM1 46 204 (AG)21.(CAGAG)6 GGATCCTCCACGCTGTTGA CTCATCCGTATGGGCTTTA 4 0.65
AM4 48 166 (AG)34 GGTAAGGTTTCGAAGAGCAAAG GGGCTATATCCATCCCTCAC 8 0.87
AM7 48 156 (AG)21 GTGAGCGCCGAATACATA TTGGCTAGCTGCTTGAAACT 8 0.75
AM9 48 217 (AG)19 CAAAGCATTGGGCCCTTGT GGCTTTGGGACCTCCTTTCC 3 0.65
AM17 44 250 (AC)13 CGAGATTTCGGTGTAGAC CCGGGAATTAACGGAGTC 3 0.43
AM19 48 251 (AC)3..(AC)6..(AC)5..(AC)7 ATAGAACGGCATGATAACGAAATA GCGCGACAACAGGACCTTC 3 0.63
AM20 50 258 (TG)10.(CG)5 TGTCGATTTCTTTAGGGCAGCACT TCGCGAGAAAGATGGAAAGGAGA 3 0.62
AM21 46 210 (AT)5..(AC)5..(AC)5 ACGTTGGTCTCGGGTTGG AAATCCTTGACTTCGCTCTGA 3 0.57
AM22 46 138 AC)22 ATTGTATTTGTAGCCCCCAGTTC AAGAGCGACCCAGTTGTATG 2 0.28
AM23 45 247 (AC)19 TCTTTAAGGATTTGGGTGGAG AATCTTCGAGGGTGAGTTTCT 5 0.68
AM24 45 170 (AAG)5..(TCA)5 GTTATTGATTTCCTGATGTAGAGA AGAGCCAAGAAAGCAACTG 2 0.38
AM25 47 229 (AC)8..(AC)4(CT)4 AGCCTGGACATGTAATCTGGT AGCCCTGGTCTTCTTCAACA 3 0.53
AM27 45 161 (AAG)10 CAAAGGCCAAATGGTGAG CCGCAAAGTCATATGGAGCAT 6 0.79
AM28 46 135 (GAA)8 GACCTCTTGAGTAAGCAACG TGGTCTTCCTATCCACAATG 5 0.73
AM29 43 143 (GAA)9 TCCCGCAAAATCATCACGA AAGGGAGCATTGGTTTTGTT 3 0.54
AM30 43 203 (GAA)14 TGAAGATAGCCATGAGGAAC GTGCAAATTGAGTTTCACG 10 0.87
AM31 47 186 (GAA)23 GCAAAGGCCATATGGTGAGAA CATAGGTTTGCCATTCGTGGT 6 0.81

Fig. 3.

A phylogenetic tree showing genetic relationship among 12 oat varieties (Avena sativa L.) assessed by SSR markers. (1, ‘Choyang’; 2, Daeyang’; 3, ‘Syeonyang’; 4, ‘Suyang’; 5, ‘Jungmo2005’; 6, ‘Samhan’; 7, ‘Donghan’; 8, ‘Punghan’; 9, ‘Okhan’; 10, ‘Taehan’; 11, ‘Jopung’; 12, ‘Dahan’)



조양판별 마커조합 설정

12개의 귀리품종 중 61개의 SSR 마커를 이용하여 판별할 수 있는 품종은 ‘조양’ 이었다. ‘조양’은 AM28, 29, 32, 34, 36 5개의 마커를 이용해 나타나는 밴드패턴으로 다른 품종과 구분해낼 수 있었다. 5개의 SSR마커는 12개 품종 모두 100 bp ∼ 250 bp 사이에 밴드가 확인되었으며 ‘조양’은 다른 11개의 품종보다 더 많은 분자량을 보였다(Fig. 4). 그 외에 다른 품종에는 특이적으로 구분될 만한 밴드패턴을 나타내는 SSR마커는 없었지만, 더욱 다양한 SSR마커와 또 다른 종류의 분자마커를 이용한다면 귀리품종별 특이적인 품종판별 마커를 개발 할 수 있을 것이다.

Fig. 4.

SSR maker combinations for identification of oat varieties (Avena sativa L.) ‘Choyang’ (1, ‘Choyang’; 2, Daeyang’; 3, ‘Syeonyang’; 4, ‘Suyang’; 5, ‘Jungmo2005’; 6, ‘Samhan’; 7, ‘Donghan’; 8, ‘Punghan’; 9, ‘Okhan’; 10, ‘Taehan’; 11, ‘Jopung’; 12, ‘Dahan’


적요

귀리(Avena Sativa L., Oat)에서 이삭모양과 탈부특성이 다른 겉귀리와 쌀귀리를 품질특성으로 구분하고자 12 품종 귀리종실의 이화학적 특성 및 식이섬유를 분석하였고, 61개의 SSR 분자마커를 이용하여 근연관계 및 조양 판별 마커조합을 설정하였으며 결과를 요약하면 다음과 같다.

공시한 12개의 귀리 품종을 생육조사 한 결과 쌀귀리는 이삭의 한 소수에서 영화수가 4 ∼ 5개 생기는데 비해 겉귀리는 2 ∼ 3개 생겼으며, 탈곡 후 종실의 껍질 유무 또한 쌀귀리는 없었고 겉귀리는 껍질이 남아있는 형태로 기존에 알려진 것과 같은 결과를 보였다.

단백질은 쌀귀리가 13.45 ∼ 16.56%, 겉귀리는 12.95 ∼ 15.31%의 함량 분포를 나타내었으며, 지방은 쌀귀리가 7.26 ∼ 10.34%, 겉귀리는 7.53 ∼ 10.82%의 함량 분포를 나타내었으며, 베타글루칸은 쌀귀리가 4.19 ∼ 5.05%, 겉귀리는 3.49 ∼ 5.60%의 함량 분포를 나타내어 귀리 품종 간에는 품질특성이 차이가 나타났으나 쌀귀리와 겉귀리를 구분 할 수 있을 정도는 아니었다.

지방산 조성 비율은 쌀귀리가 겉귀리에 비해 올레인산(C18:1, Oleic acid, 40.2 ∼ 50.9%)과 스테아르산(C18:0, Stearic acid, 1.2 ∼ 2.5%)이 높은 비율을 나타냈으며, 겉귀리는 쌀귀리에 비해 리놀레산(C18:2, Linoleic acid, 30.6 ∼ 41.2%)과 리놀렌산(C18:3, Linolenic acid, 0.7 ∼ 1.3%)이 더 높은 비율을 보였다.

귀리의 근연관계는 계수(Coefficient) 1.22에서 그룹 하여 정리한 결과 겉귀리 6품종과 쌀귀리 1품종으로 그룹 되었고 유전적 거리(Genetic Distance)는 ‘동한’과 ‘태한’이 가장 가깝게 나타났으며 다음은 ‘풍한’, ‘삼한’, ‘옥한’, ‘조풍’, ‘중모2005’ 순으로 나타났다. 계수(Coefficient) 1.22에서 그룹 되지 않은 귀리는 겉귀리 1품종과 쌀귀리 4품종으로 ‘수양’, ‘다한’, ‘대양’, ‘선양’, ‘조양’ 순으로 그룹에서 먼 것으로 나타나 대체적으로 겉귀리와 쌀귀리가 서로 멀게 나타났다.

12개의 귀리품종에 61개의 SSR maker를 이용하여 분석한 결과 ‘조양’은 AM28, 29, 32, 34, 36의 5개 SSR마커에서 다른 품종과 다른 밴드 패턴을 나타내어 품종 구분이 가능하였다.

사사

본 논문은 농촌진흥청 연구사업(세부과제명: 쌀귀리 소비확대를 위한 가공 이용 향상 연구, 세부과제번호: PJ011903 2018)의 지원에 이루어진 것이며, 이의 지원에 감사드립니다.

References
  1. Cai S, Huang C, Ji B, Zhou F, Wise M, Zhang D, and Yang P. (2011) In vitro antioxidant activity and inhibitory effect, on oleic acid-induced hepatic steatosis, of fractions andsubfractions from oat (Avena sativa L.) ethanol extract. Food chem 124, 900-905.
    CrossRef
  2. Customs import and export trade statistics. (2015) Reportimport and export trends .
  3. Dimberg LH, Theander O, and Lingnert H. (1993) Avenanthramides- A group of phenolic antioxidants in oats. Cereal Chem 70, 637-641.
  4. Flander L, Salmenkallio-Marttila M, Suortti T, and Autio K. (2007) Optimization of ingredients and baking process for improved whole meal oat bread quality. LWT-Food Sci.and Technol 40, 860-870.
    CrossRef
  5. Gangopadhyay N, Hossain MB, Rai DK, and Brunton NP. (2015) A review of extraction and analysis of bioactivities in oat and barley and scope for use of novel food processing technologies. Molecules 20, 10884-10909.
    Pubmed KoreaMed CrossRef
  6. Korea Development Institute (KDI) Economic InformationCenter (2015) Statistical appendices. July 2015
  7. Kwon YS, Park EK, Park CU, Bae KM, Yi SI, and Cho IH. (2006) Identification of rice variety using simple sequence repeat (SSR) marker. Journal of Life Sci 16, 1001-1005.
    CrossRef
  8. Lee YY, Ham HM, Park HH, Kim YK, Lee MJ, Han OK, Kim YH, Park HM, Lee BW, Park JY, Sim EY, Lee CW, and Kim WH. (2016) The physicochemical properties and dietary fiber contents in naked and hulled korean oat cultivars. Korean J. Breed. Sci 48 (1), 37-47.
    CrossRef
  9. Han OK, Park HH, Park TI, Seo JH, Park KH, Kim JG, Heo HY, Hong YG, and Kim DH. (2008) A new early-heading and high- yielding naked oat cultivar for human consumption, 'Choyang'. Korean J. Breed. Sci 40, 512-516.
  10. Han OK, Park HH, Heo HY, Park TI, Seo JH, Park KH, Kim JG, Hong YG, and Kim DH. (2009) A new oat cultivarfor human food, 'Daeyang' with high-yielding and good-quality. Korean J. Breed. Sci 41, 56-60.
  11. Han OK, Park TI, Park HH, Park KH, Oh YJ, Kim KJ, Song TH, Jang YJ, Kim DH, Hwang JJ, and Kwon YU. (2014) 'Suyang', A new naked oat cultivar with early-heading and high-yielding. Korean J. Breed. Sci 46 (3), 323-327.
    CrossRef
  12. Murray MG, and Thompson WF. (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8, 4321-4325.
    Pubmed KoreaMed CrossRef
  13. NICS (2009) Manual of quality analysis for crop. National Institute of Crop Science .
  14. Peterson DM, Hahn MJ, and Emmons CL. (2002) Oat avenanthramides exhit antioxidant activities in vitro. Food Chem 79, 473-478.
    CrossRef
  15. Xiao L, Balkunde S, Yang P, Lee HS, and Ahn SN. (2012) Dicersity analysis off japonica rice using microsatellite markers. Korean J. of Agricultural Sci 39, 9-15.


March 2019, 46 (1)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM