Large functional genomics initiatives have revealed that many human disorders are affected by multiple genes and their genetic and molecular interactions with each other and the environment. Thus, the use of various model systems such as human and mammalian cell lines, yeast (i.e., Saccharomyces cerevisiae), as well as other organisms such as Caenorhabditis elegans and Drosophila melanogaster contributes to important discoveries within human disease research and the design of new diagnostic tools and medical treatment strategies (Xu and Moller 2011).

Recent reports have shown that Arabidopsis thaliana known as a model organism for plant biology is a valuable model system to study molecular mechanisms underlying human disease states (Hays 2002). According to the comparison between Arabidopsis and human genome sequences, Arabidopsis genome encodes many orthologues of human proteins albeit Arabidopsis and humans diverged 1.6 billion years ago (Xu and Moller 2011). For example, TAIR WU-BLAS tool (http://www.arabidopsis.org) analysis showed that 71% of genes involved in neurological human diseases have Arabidopsis orthologues with high E-value cutoffs. Furthermore, Arabidopsis has some advantages for human disease research: (i) Simple cultivation and maintenance with low infrastructure and operating costs, (ii) Fast and simple transformation techniques for transgenic analyses, (iii) The availability of large mutants and genomic resources, and (iv) few ethical restrictions (Xu and Moller 2010).

Alzheimer’s disease (AD) is the most common age-related neurodegenerative disorder of the central nervous system (Mattson 2004), which is characterized by the deposition of aggregation-prone amyloid-β peptides (Aβs) as the degraded products of the amyloid precursor protein (APP) and neurofibrillary tangles in the brain (Selkoe 1998). In humans, presenilin (PS) was identified from the genetic screens of patients suffering from AD and mutations in PS1 or PS2 led to improper cleavage of APP, which resulting in Aβs accumulation and progressive neurodegeneration (Sherrington et al. 1995). PS as a catalytic core protein is a component of γ-secretase, which is implicated in the process of regulated intramembrane proteolysis (RIP) (Sannerud and Annaert 2009). Besides PS, nicastrin (NCT), presenilin enhancer 2 (PEN-2), and anterior pharynx-defective 1 (APH-1) as other constituents of γ-secretase are required for complex assembly, stabilization, trafficking, and substrate recognition (Parks and Curtis 2007).

APP as one of more than 80 substrates for γ-secretase is a metazoan protein, which is only present in genomes of multicellular animals (Haapasalo and Kovacs 2011). However, the components of γ-secretase have been identified in both metazoan and plants (Grigorenko et al. 2002; Kimberly and Wolfe 2003; Moliaka et al. 2004; Ponting et al. 2002; Wigge and Weigel 2001). The moss Physcomitrella patens also harbors homologues of all γ-secretase subunits with PS present in one copy. A lesion in moss PS (PpPS) showed several pleiotropic defects such as abnormal growth pattern, impaired chloroplast movement, and decreased uptake of an endocytosis tracer (Khandelwal et al. 2007). The mutation in PS of Dictyostelium discoideum as a slime mould affected cell fate determination and the regulation of phagocytosis (McMains et al. 2010). In Arabidopsis as a higher plant, all γ-secretase subunits interacted with each other and colocalized in endomembrane system compartments (Smolarkiewicz et al. 2014). These data suggest that γ-secretase is evolutionarily conserved and its role may be extended beyond RIP found from animal studies.

Here we presented the effect of 42 amino acids long- human amyloid-β peptide (hAβ₄₂) on Arabidopsis protoplasts, tissues, and transgenic plants.

Plant materials and growth conditions

The wild-type [ecotype Columbia (Col-0)] and the transgenic Arabidopsis plants were grown in soil or a murashige and skoog (MS) medium at 23°C under long-day (LD) conditions (16 h light/8 h dark) at a light intensity of 120 mmol･m^-2･s^-1.

For treatment of 42 amino acids long-human amyloid-β peptide (hAβ₄₂) at cellular level, we followed the procedures for isolation of Arabidopsis mesophyll protoplasts, as previously described (Lee et al. 2017; Yoo et al. 2007). Isolated protoplasts (2 × 10⁴) were treated with 3 and 5 mM hAβ₄₂ monomer or DMSO, and then the percentage of dead cells at indicated times was determined by staining protoplasts with Evans blue dye (Sigma-Aldrich), which was added to the samples to a final concentration of 0.04 % (Danon et al. 2005; Wright et al. 2000). The number of stained cells was measured using a light microscope (Zeiss, Oberkochen, Germany). For treatment of hAβ₄₂ at tissue level, Arabidopsis plants were grown on soil or MS medium under LD conditions at 23°C. 10-d-old plants were treated with 3 mM hAβ₄₂ monomer or Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, St. Louis, Missouri, USA), as previously described (Kim et al. 2017), and then hAβ₄₂-treated plants were observed after 2 and 4 days under a light microscope (Nikon, Tokyo, Japan).

Preparation of hAβ42 monomer

The procedures for were previously described (Dahlgren et al. 2002; Kook et al. 2012). hAβ₄₂ peptide was dissolved at a concentration of 1 mg･ml^-1 in 3,3,3-Hexafluoro-2- propanol (HFIP) (Sigma-Aldrich). HFIP was evaporated using Speed Vacuum concentrator and lyophilized peptide was resolved in 10 ml DMSO. After calculation of the molar concentration, aliquots of 1 mM lyophilized hAβ₄₂ monomer were stored at -80°C until use.

Generation of transgenic Arabidopsis plants

For p35S::hAβ₄₂ construct, the region of human Aβ₄₂ was polymerase chain reaction (PCR)-amplified using plasmid DNA template with the gene encoding human amyloid precursor protein (hAPP) [gifted form Dr. Jeong (Jeonbuk National University, South Korea) and the resulting products were cloned into the pCHF3 vector harboring cauliflower mosaic virus (CaMV) 35S promoter. The resulting recombinant plasmid was sequenced to verify the absence of the PCR errors during amplification. Oligonucleotide primers used for cloning were as follows: 5’-ACGAGCTC GGTACCCGGGATGCTGCCCGGTTTGGC -3’ and 5’-CT CTAGAGGATCCCCGGGCGCTATGACAACACCGCCC -3’. This construct was transformed into Agrobacterium tumefaciens strain GV3101 and then infiltrated into the wild-type (Col-0) plants. Transgenic plants were generated using the floral dip method with minor modifications (Weigel and Glazebrook 2002). The transgenic seedlings were first selected using kanamycin for a pCHF3 vector and then verified using PCR-based DNA genotyping. At least 30~40 T₁ seedlings were analyzed for the construct. To examine the expression of hAβ₄₂ in the transgenic Arabidopsis plants, we performed semi-quantitative reverse transcription (RT)–PCR, as described previously (Lee et al. 2007). Total RNA was extracted from 8-d-old seedlings using a RiboEx Total RNA kit (GeneAll, Seoul, Korea), and first-strand complementary DNA (cDNA) was synthesized from 1 µg of total RNA, in accordance with the manufacturer’s instructions (GeneAll). The following oligonucleotides were employed as gene-specific primers in the RT-PCR analyses: for hAβ₄₂, 5’-GAGCTCATGCTGCCCGGTTTGG CACT -3’ and 5’-TCTAGACGCTATGACAACACCGCCC ACC-3’; for AtPP2AA3, 5’-GCGGTTGTGGAGAACATGA TACG-3’ and 5’-GAACCAAACACAATTCGTTGCTG-3’. AtPP2AA3 was used as a reference gene.

The treatment of hAβ₄₂ monomer in Arabidopsis mesophyll protoplasts affects the viability of the cells

Because the accumulation of aggregated form of Aβ₄₂ in the brain leads to mitochondrial dysfunction and elevated reactive oxygen species (ROS), consequently resulting in cell death (Reddy and Beal 2008), we investigated whether hAβ₄₂ monomer affects the viability of plant cells. Mesophyll protoplasts were isolated form 10-d-old Arabidopsis wild-type (Col-0) plants grown at 23°C under LD conditions and 2 × 10⁴ protoplasts were treated with 3 or 5 mM hAβ₄₂ monomer at 1, 2, 4, 8, and 24 h under continuous light conditions. The protoplasts treated with DMSO were used as a control. Because dead cells were specifically stained with Evans blue dye (Danon et al. 2005; Wright et al. 2000), we stained 3 or 5 mM hAβ₄₂ monomer-treated protoplasts after 24 h with Evans blue dye. This indicates that dead cells were increased in the protoplasts treated with 3 or 5 mM hAβ₄₂ monomer, compared with DMSO-incubated protoplasts (Fig. 1a). We also calculated the percentage of dead cells at 0, 1, 2, 4, 8, and 24 h under a light microscope. The percentage of dead cells in protoplasts treated with hAβ₄₂ monomer gradually increased and reached approximately 60% after 24 h (Fig. 1b). The portion of dead cells was nearly similar irrespective of treatment of 3 or 5 mM hAβ₄₂ monomer. In contrast, the percentage of dead cells in DMSO-treated mesophyll protoplasts remained almost constant until 8 h and showed approximately 40% after 24 h (Fig. 1b). These results indicated that hAβ₄₂ monomer reduces the viability of Arabidopsis mesophyll protoplasts.

Fig. 1. Effect of hAβ₄₂ peptide treatment on Arabidopsis mesophyll protoplasts. (a) Morphology of protoplasts treated with 5 µM of hAβ₄₂ monomer and DMSO. 10-d-old Arabidopsis (Col-0) plants were used for isolation of protoplasts, after which 2×10⁴ protoplasts were incubated at 23°C under continuous light conditions and treated with 3 and 5 µM of hAβ₄₂ monomer. After staining protoplasts with Evans blue dye, the dead cells were observed under the microscope (scale bars: 100 µm). (b) Percentage of dead cells at 0, 1, 2, 4, 8, and 24 hours. The asterisks indicate a significant difference in the percentage of dead cells in 3 and 5 µM hAβ₄₂ monomer-treated protoplasts compared with DMSO- treated protoplasts (Student’s t-test, *P < 0.05)

The treatment of hAβ₄₂ monomer does not cause any morphological changes in Arabidopsis young seedlings

Because hAβ₄₂ monomer affects the viability of Arabidopsis mesophyll protoplasts at cellular level (Fig. 1), we next examined the effect of hAβ₄₂ monomer at plant tissue levels. Then, we sowed Arabidopsis wild-type (Col-0) seeds in solid MS medium, transferred 10-d-old seedlings into 6-well plates containing 1 mL of liquid MS medium with 3 mM hAβ₄₂ monomer or DMSO, and observed the the morphological changes of seedlings after 2 and 4 days. The 3 mM hAβ₄₂ monomer-treated seedlings after 2 and 4 days did not show any defects of morphology such as leaves, hypocotyls, and roots (Fig. 2). This result indicated that hAβ₄₂ monomer does not affect the growth of young seedlings at the tissue level. However, we cannot dismiss the possibility that young seedlings may be more resistant to physical and chemical treatment than protoplasts.

Fig. 2. Effect of Aβ42 peptide treatment on Arabidopsis young seedlings. 10-d-old wild-type Arabidopsis (Col-0) plants grown at 23°C under long-day (LD) conditions were treated with 3 µM hAβ₄₂ monomer and morphological changes in Arabidopsis plants were observed after 2 and 4 days. DMSO-treated Arabidopsis seedlings were used as controls

The overexpression of hAβ₄₂ in transgenic Arabidopsis plants leads to morphological changes in root length and silique phyllotaxy

In order to investigate the effect of the hAβ₄₂ overexpression in Arabidopsis plants, we expressed the region of hAβ₄₂ under the control of a 35S promoter (p35S::hAβ₄₂) in Arabidopsis wild-type (Col-0) plants. We obtained 37 independent transgenic plants in the T₁ generation from DNA genotyping (Fig. 3a). To examine the morphological changes of the p35S::hAβ₄₂ plants in more detail, we generated the transgenic plants with a single p35S::hAβ₄₂ insertion in the T₃ generation and confirmed a higher expression level of introduced hAβ₄₂ gene (Fig. 3b). Firstly, we compared root growth phenotypes of wild-type (Col-0) and p35S::hAβ₄₂ plants. The seedlings were grown on MS medium and primary root lengths were quantified 8 days after germination. We found that three independent p35S::hAβ₄₂ lines had long primary roots than wild-type (Col-0) seedlings (Fig. 3c). The degree of primary root lengths was correlated with the expression levels of hAβ₄₂ gene in independent p35S::hAβ₄₂ lines. For instance, a p35S::hAβ₄₂ line (#16) showing strong hAβ₄₂ gene expression had more longer primary roots than p35S::hAβ₄₂ line (#8). Secondly, we measured the flowering time in six independent p35S::hAβ₄₂ lines under long-day (LD) conditions at 23°C. We found that the flowering time of four independent p35S::hAβ₄₂ lines (#14, #22, #26, and #36) was unchanged, whereas two independent lines (#8 and #16) has altered flowering time (Fig. 3d and e). However, the degree of flowering time was not correlated with the expression levels of hAβ₄₂ gene in independent p35S::hAβ₄₂ lines. Lastly, we detected abnormal phyllotaxy in the inflorescence of two independent p35S::hAβ₄₂ lines (#16 and #22) (Fig. 3f), which showing that strong hAβ₄₂ gene expression in p35S::hAβ₄₂ lines affected the degree of defects in phyllotaxy. These results indicated that the increased hAβ₄₂ expression affects morphological changes in root length and silique phyllotaxy in the p35S::hAβ₄₂ plants.

Fig. 3. Effect of hAβ₄₂ overexpression on transgenic Arabidopsis plants. (a) Confirmation of hAβ₄₂ integration in p35S::hAβ₄₂ plants at the T₃ generation. P was used as a control for DNA genotyping. (b) Overexpression of hAβ₄₂ in p35S::hAβ₄₂ plants at the T₃ generation. Wild-type Arabidopsis (Col-0) plant was used as a control for RT–PCR. (c) Root length measurements in p35S::hAβ₄₂ plants. The number of measured plants is shown above each genotype in the bar graph. The error bars indicate the standard error of the mean of three biological replicates. Asterisks denote statistically significant differences compared with wild-type Arabidopsis (Col-0) plants (Student’s t-test, ***P < 0.001). (d and e) Flowering time phenotypes of p35S::hAβ₄₂ plants at 23°C under LD conditions. Asterisks denote statistically significant differences compared with wild-type Arabidopsis (Col-0) plants (Student’s t-test, *P < 0.05, ***P < 0.001, n.s., not significant). Photographs were taken when wild-type Arabidopsis (Col-0) plants flowered. Scale bars: 1 cm. (f) Silique phyllotaxy in p35S::hAβ₄₂ plants. Scale bars: 1 cm

Here we provide the first data on the effect of hAβ₄₂ monomer as a metazoan protein in angiosperms. In a series of experiments, we showed that the viability of cells was reduced in hAβ₄₂ monomer-treated Arabidopsis mesophyll protoplasts (Fig. 1), suggesting that hAβ₄₂ monomer may lead to cell death. Because the protoplast system is known as a useful tool that allows an easy uptake of bioactive agents and a concise quantification of cell death response (Yoo et al. 2007), we will further investigate whether the features of the cellular destruction such as DNA cleavage, the activation of caspase-like molecules, and the release of mitochondrial components are observed in hAβ₄₂ monomer-treated protoplasts (Reape and McCabe 2008). Although treatment of hAβ₄₂ monomer did not affect the growth of young seedlings at the tissue level, hAβ₄₂ gene expression in the transgenic Arabidopsis plants caused the morphological changes in primary root length and silique phyllotaxy (Fig. 3). A recent report have shown that Arabidopsis ps1 ps2 double mutants have accelerated chlorosis in the dark (Smolarkiewicz et al. 2014). Because darkness and starvation induce senescence and autophagy in plants (Sobieszczuk-Nowicka et al. 2018), we will further examine the effect of prolonged darkness treatment on hAβ₄₂ monomer-treated Arabidopsis seedlings and p35S::hAβ₄₂ plants.

We thank Dr. Mook-Jung (Seoul National University) for kindly providing research methods. This work was supported by National University Promotion Program in 2019 (to J.H. Lee).