Zoysia japonica, also known Korean lawngrass or zoysiagrass, is a perennial C4-type-plant capable of generation criss-cross rhizomes and stolons resulting in a soft law (Cai et al. 2005). Moreover, Korean lawngrass has been used widely in courtyards, parks, playgrounds, and golf courses in transitional and warm climate areas due to its strong adaptability to abiotic and biotic stresses as well as its low maintenance requirements (Patton and Reicher 2007). However, the warm-season turf lacks cold tolerance, leading to leaf senescence in autumn and yellowing of leaves during the winter season (Pompeiano et al. 2013). Therefore, prolonging the green period of Korean lawngrass by delaying the leaf senescence will make the turfgrass more valuable in the grass market.

Leaf senescence is the last stage in plant growth and development, which is regulated through complex molecular mechanisms involving plant hormones, enzymes, and transcription factors (Rinerson et al. 2015). However, while leaf senescence is mainly regulated by leaf age and developmental cues, it is also affected by external environmental factors such as cold and drought (Zhao et al. 2020). Furthermore, a noticeable correlation exists between the senescence of the largest leaves in the rosette and the timing of flowering in Arabidopsis, which implies an evolved association between the initiation of flowering and the overall lifespan of the plant (Levey and Wingler 2005). Numerous studies have shown that transcription factor families including NAC, WRKY, AP2/EREBP, and MYB play an important role in regulating plant senescence (Breeze et al. 2011).

WRKY transcription factors (TFs) constitute one of the largest families involved in transcriptional regulation and play a crucial role in various aspects of plant growth and development, intricate defense mechanisms and hormone-regulated processes including leaf senescence (Ulker and Somssich 2004). WRKY TFs are characterized by approximately 60 amino acids and possess a highly conserved DNA-binding WRKY domain, along with zinc-finger motif located at the C-terminus. These TFs are further classified into three main groups based on the number of WRKY domains and the composition of zinc finger-like motif (Rushton et al. 1996). Group I WRKY TFs consist of two WRKY domains and one C₂H₂ zinc-finger structure. Both group II and group III, on the other hand, have a single WRKY domain. However, group II has the C₂H₂ type of zinc-finger, while group III possesses the C₂HC type of zinc finger. Furthermore, group II is divided into five distinct subgroups (IIa-IIe). Most WRKY TFs exhibit a strong binding affinity to a cis-element known as W-box (TTGACT/C), which is commonly found in the promoters of defense-related genes (Eulgem et al. 2000). SWEET POTATO FACTOR1 (SPF1), the first WRKY TF identified from sweet potato, binds specifically to W-box and regulates negatively the expression of sporamin and β-amylase proteins (Ishiguro and Nakamura 1994). The CpWRKY71 gene of wintersweet (Chimonanthus praecox) accelerate flowering and senescence in Arabidopsis (Huang et al. 2019). Overexpression of AtWRKY75 showed the interaction with DELLA proteins to regulate flowering in Arabidopsis (Zhang et al. 2018a). AtWRKY45 interacts with DELLA protein RGL1 to actively control leaf senescence (Chen et al. 2017). AtWRKY6 directly activates the promoter of the SIRK gene, which encodes a receptor-like protein kinase that is strongly induced during leaf senescence, thereby expediting leaf senescence (Robatzek and Somssich 2002). AtWRKY71 is known to promote flowering by way of directly activating the flowering time integrator gene FLOWERING LOCUS T (FT) and the floral meristem identity genes LEAFY (LFY) in Arabidopsis (Yu et al. 2016). AtWRKY57 is involved in JA- and auxin-mediated signaling pathways, and it counteracts JA-induced senescence through auxin (Jiang et al. 2014). AtWRKY2 mediates the seed germination and post-germination developmental arrest in response to abscisic acid (Jiang and Yu 2009). AtWRKY12 has been identified as a negative regulator of pith secondary cell wall formation (Wang et al. 2010). The overexpression of TaWRKY93 in Arabidopsis has been shown to enhance tolerance to multiple abiotic stresses (Qin et al. 2015). GhWRKY17 has been found to respond to drought and salt stress by modulating ABA signaling and cellular ROS production in transgenic Nicotiana benthamiana (Yan et al. 2014). CaWRKY40, a WRKY transcription factor of pepper, has demonstrated the ability to improve heat stress tolerance and resistance to Ralstonia solanacearum infection in tobacco (Dang et al. 2013). ZjGRP, isolated from Korean lawngrass,has been identified as a factor responsible for salt sensitivity in Arabidopsis (Teng et al. 2017).

In this study, we isolated a novel WRKY gene named ZjWRKY10 from Korean lawngrass and investigated its potential role in delaying leaf senescence and enhancing tolerance to abiotic stresses such as cold, salt, and drought.

Plant materials and growth conditions

The seeds of Z. japonica were germinated on a half MS medium and grown in a 25°C culture room under a light/dark cycle of 16h light and 8h dark. The Z. japonica plants grown during two-month on the MS medium were transplanted into the soil of the greenhouse with a white LED light (4000K neutral white); at 30-35°C at the day and 20-25°C at the night. For salt, cold, dehydration, and senescence stress treatment, the fourth leaves of the underground runners were collected, cut off both ends, and the middle part were used as the experimental samples. Leaf samples were frozen immediately in liquid nitrogen, then stored at -70°C for further experiment such as RNA extraction. Arabidopsis thaliana ecotype Columbia (Col-0) were grown in a growth room controlled at 16h light and 8h dark (Kang et al. 2011).

Isolation and sequence analysis of ZjWRKY10 cDNA

Total RNA was extracted from Z. japonica leaves using Trizol reagent (Invitrogen) and synthesized the first-stand cDNA using M-MLV reverse transcriptase using 2 μg RNA (Promega, Madison, WI, USA). To isolate a WRKY gene (ZjWRKY10) of Z. japonica with high homology from wheat WRKY10, were used the NCBI database and Z. japonica genome database (Zoysia Genome Database, kazusa.or.jp). Primers were designed based on the Z. japonica genome database (Table 1). The PCR was performed at 95°C 5 min, 95°C 30 sec, 65°C 30 sec, 72°C 30 sec, 72°C 10 min, 30 cycle. The DNA sequencing results have confirmed the open reading frame (ORF) of ZjWRKY10, spanning from the start codon (ATG) to the stop codon. (Macrogen Inc. Seoul, Korea). Multiple sequence alignment of the protein deduced from ZjWRKY10 was represented using the Clustal Omega and the neighbor-joining method with 1000 replicates was used to construct the phylogenetic tree by the MEGA 11.0 program.

Table 1 . The polymerase chain reaction (PCR) primers used in this study.

Name	Oligonucleotides (5'-3')	Use
ZjWRKY10-F ZjWRKY10-R	Forward ATGGGATCGATGGCGGCGTCG Reverse CTAGAAGAGGAGGGAGCCCGA	Cloning ZjWRKY10
ZjWRKY10-F1 ZjWRKY10-R1	Forward TGTCGTCTCTTTGACTTTGGG Reverse TTCTTCCCGTACTTCCTCCAC	Identification of ZjWRKY10
BAR-F BAR-R	Forward AAGTCCAGCTGCCAGAAACCCAC Reverse GTCTGCACCATCGTCAACCACTA	Identification of BAR
FT-F FT-R	Forward GCTACAACTGGAACAACCTTTGGC Reverse TGAATTCCTGCAGTG GGACTTGG	qRT-PCR of FLOWERING LOCUS T (FT)
18S rRNA-F 18S rRNA-R	Forward ATGATAACTCGACGGATCGC Reverse CCTCCAATGGATCCTCGTTA	A control of qRT-PCR
ZjACT-F ZjACT-R	Forward AAGGCCAACAGGGAGAAAAT Reverse GATAGCATGGGGAAGTGCAT	A control of qRT-PCR

Binary vector construction and generation of transgenic Arabidopsis

A full-length cDNA of ZjWRKY10 with Hind III (Takara, AJE1231A, Japan) and PvuⅠ (Takara, ALF0493A, Japan) restriction sites at both ends of the cDNA was inserted in a modified pCAMBIA0380 vector (Zuo et al. 2021). The constructed pCAMBIA0380-ZjWRKY10 vector was transformed into the competent cells of Agrobacterium tumefaciens GV3101 (Hood et al. 1993) by the freeze-thaw method (Holsters et al. 1978). To generate a transgenic Arabidopsis, the A. tumefaciencs GV3101 carrying pCAMBIA0380-ZjWRKY10 was infected in the flower of A. thaliana (Col-0) by floral dip method (Clough and Bent 1998). The transgenic Arabidopsis was selected by phosphinothricin (PPT) and identified by PCR (Table 1). T₄ generations of homozygous transgenic plants that single T-DNA was inserted were used as experimental material.

Treatment of abiotic stresses and quantitative real-time PCR analysis

The middle parts of leaves at day after emergence (DAE) 21 were used for abiotic stress treatment. For dark, leaves of Z. japonica were floating on the surface of 3 mM MES buffer (pH 5.8) in 12-well plates and completely covered in aluminum foil. For cold response, the leaves were treated under condition of 16 h light and 8h dark and 4°C. For salt and dehydration responses, the leaves were treated in 3 mM MES buffer containing 150 mM NaCl and 20% polyethylene glycol 6000 (PEG) respectively under 16h light and 8h dark. At least nine leaves in each treatment were collected and three biological repeats were measured. Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) with thermal cycler dice real-time system (TAKARA). The 2^-ΔΔct method was applied to calculate the relative transcript accumulations of the gene. Three replicate PCR amplifications were performed for each sample. β-Actin (GU290545) of Z. japonica was used as an internal control (Table 1). Flowering times and rosette leaves were recorded when the primary inflorescence of Arabidopsis reaches 0.5 cm. At least 25 plants were measured for each wild type and transgenic line. Primers for qRT-PCR of FLOWERING LOCUS T (FT) are listed in Table 1.

Dark treatment and chlorophyll content measurement

For transgenic Arabidopsis, the fifth and sixth leaves detached from 4-week-old plants were placed on the surface of 3 mM MES buffer (pH 5.8) in 12-well plates, absolutely wrapped with double aluminum foil (Sakuraba et al. 2012). The chlorophyll content of leaves was measured with at least six leaves by a handheld meter (SPAD-502 Plus) as described by (Zhao et al. 2018). For the whole plant senescence experiment, four-week-old plants were grown in complete darkness for 14 days and then recovered for 8 days with 16 h of light and 8 h of dark conditions.

Statistical analysis

The statistical analysis of the data was conducted using the IBM SPSS Statistics 26. One-way Analysis of Variance (ANOVA) was performed to compare the statistical differences based on the t-test significance levels of p-values of < 0.05 (*), < 0.01 (**), and < 0.001 (***). All assays were repeated three or more times to ensure the reliability and consistency of the results. The data are presented as means ± standard errors (SE).

Cloning and phylogenetic analysis of ZjWRKY10

A WRKY gene designated ZjWRKY10 was cloned through the process of reverse transcription-PCR (RT-PCR) from the seedling leaf of Z. japonica. ZjWRKY10 contained the complete open reading frame (ORF) of 636 bp, which encoded 211 amino acids. The protein deduced from ZjWRKY10 shared a high similarity to TaWRKY10 of Triticum aestivum (wheat) and OsWRKY10 of Oryza sativa (rice). ZjWRKY10 had single WRKY DNA-binding domain (WRKYGKK) and the C2H2 zinc-finger motif (C-X4-C-X23-H-X1-H) (Fig. 1A). In addition, the phylogenetic analysis revealed that ZjWRKY10 was classified within the IIc WRKY superfamily (Fig. 1B).

Figure 1. Analysis of the deduced amino acid sequence of ZjWRKY10. (A) Multiple alignments of ZjWRKY10 with other WRKY proteins from different species, including TaWRKY10 (ADY80578) of wheat, OsWRKY10 (DAA05075) of rice, and AtWRKY75 (AED91848) and AtWRKY71 (AEE31143) of Arabidopsis. The strong shading represents identical amino acids, while the light shading represents similar amino acids. The conserved WRKY and zinc-finger motifs are marked by black lines. (B) Phylogenetic analysis of the WRKY proteins from different species. The numbers above the branches represent the bootstrap values. The GenBank accession numbers are indicated in parentheses

Expression analysis of ZjWRKY10

Transcription of ZjWRKY10 was measured using qRT-PCR under various abiotic stresses. The mRNA levels of ZjWRKY10 exhibited a slight increase under cold and PEG treatment, with an approximately 4-fold increase at 6 days after NaCl treatment compared to the levels observed before treatment. However, under dark treatment, ZjWRKY10 exhibited a rapid and significant increase, reaching a level over 40-fold higher than before treatment after 6 days.

Overexpression of ZjWRKY10 in Arabidopsis

Twenty-eight transgenic lines were identified in the T₁ generation through PCR using both bar and ZjWRKY10 primer sets. From these lines, 7 lines were selected in the T₂ generation based on their status as single copy-inserted lines and exhibiting Mendelian ratio of 3:1 through phosphinothricin (PPT) selection in the T₂ generation (Table 2). The experiments in the transgenic plants were conducted using T₄ plants of OE15, OE26, and OE30 that were grown from the seeds of homozygotes. The analysis of a leaf senescence under dark treatment was performed using leaves that were cut from 4-week-old Arabidopsis plants. There were no noticeable difference observed within 4 days after treatment. However, in the transgenic lines, the leaves exhibit a slight yellowing earlier than the leaves of the wild type plants by the 6th day after treatment (Fig. 3A). The chlorophyll content data also supported the findings of the visual observation (Fig. 3B).

Table 2 . The polymerase chain reaction (PCR) primers used in this study.

Line	No. of seeds tested	No. of PPT-resistant	No. of PPT-sensitive	X2 (3:1)	Fitness
OE1	109	83	26	0.076	H0
OE3	102	78	24	0.117	H0
OE10	103	60	43	15.408	HA
OE11	104	80	24	0.205	H0
OE15	105	79	26	0.003	H0
OE17	102	77	25	0.013	H0
OE26	106	80	26	0.012	H0
OE30	109	82	27	0.003	H0
Wild-type	100	0	100	-	-

The segregation ratio was calculated according to the formula: X² = ∑(O - E)2/E, where O is the observed and E is the expected values, df = 1, α = 0.05, and X² (0.05 = 1).

Figure 3. Analysis of leaf senescence after dark treatment. (A) Photographs of untreated and treated leaves from transgenic (OE15, OE26, and OE30) and wild-type (WT) lines. Six or more leaves were recorded for each treatment. (B) Measurement of the chlorophyll content in Soil Plant Analysis Development (SPAD) units. This analysis was conducted from detached leaves. Data are the mean of six replicates ± SE; asterisks indicate significant differences at p < 0.05 (*), and p < 0.001 (***)

The survival rate of the transgenic plants was slightly lower than that of the wild type plants when tested during the recovery period after a dark treatment (Fig. 4). The wild type plants exhibited a 40% survival rate, whereas the survival rate of OE15, OE26, and OE30 was only 15%, 6.7%, and 25%, respectively (Fig. 4B). These measurements were taken when 4-week-old plants were transferred to dark conditions for 14 days and then subjected to 8 days of recovery under a long-day photoperiod.

Figure 4. Analysis of survival rate after dark treatment. (A) Photographs show the transgenic (OE15, OE25, and OE30) and wild-type (WT) plants before dark treatment, after 14 days of dark treatment, and after 8 days of recovery under long-day conditions. (B) Survival rates of the transgenic and wild-type plants after 8 days of recovery. Data are presented as the mean ± SE of three replicates. The asterisks indicate significant differences at p < 0.01 (**), and p < 0.001 (***)

The bolting time of the OE15, OE26, and OE30 transgenic plants was tested to investigate any other influence of ZjWKY10 overexpression in Arabidopsis. Under 16h light and 8h dark conditions, the transgenic plants were observed to bolt earlier than the wild type plants (Fig. 5A). OE15, OE26, and OE30 flowered on average 33.04, 26.2, and 27.36 days after germination, respectively, with the number of rosette leaves averaging 13.6, 10.76, and 11.64 when the height of the primary inflorescence reached 0.5 cm. In contrast, the wildtype plants flowered for an average of 35.56 days with 14.4 rosette leaves. (Fig. 5B and C). To identify the earlier flowering phenotype of the transgenic plants at the molecular level, we measured the expression of FLOWERING LOCUS T (FT) by qRT-PCR. All three OE15, OE26, and OE30 plants exhibited a higher level of transcript amplification compared to the wild type plants (Fig. 5D).

Figure 5. Identification of flowering time. (A) Photograph of 35-day-old plants of transgenic (OE15, OE25, and OE30) and wild-type (WT) plants grown under long-day conditions. (B) and (C) represent the number of rosette leaves and flowering time in transgenic and wild-type plants, respectively. The data represent the average of 25 plants. (D) Relative expression of FLOWERING LOCUS T (FT), a positive regulator of flowering, in transgenic and WT plants by quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). Leaves samples were harvested from 35-day-old plants. The values represent the mean of three biological replicates ± SE. The asterisks indicate significant differences at p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***)

In this study, we isolated the cDNA of ZjWRKY10, a novel WRKY gene from Zoysia japonica and investigated its expression patterns under environmental stress conditions including cold, salt, drought, and darkness. ZjWRKY10 consists of 636 bp open reading frame (ORF) that spans from the start codon (ATG) to the stop codon (TAA). The encoded protein contains a typical WRKY DNA-binding domain (WRKYGKK) and the C2H2 Zinc-finger motif (Fig. 1A). It is classified as a member of the group IIc WRKY subfamily (Fig. 1B), along with TaWRKY (Wang et al. 2013), OsWRKY10 (Ryu et al. 2006), and AtWRKY71 (Yu et al. 2016). WRKY TFs form a superfamily in plant, exhibiting a diverse range of functions and regulatory roles. The expression of ZjWRKY10 seemed to increase slightly in response to cold, salt, and dehydration stresses. However, under dark conditions, its expression levels showed a strong and gradual increase (Fig. 2D). These results indicate that ZjWRKY10 could play a role in the regulation of stress responses and leaf senescence in zoysiagrass, thereby contributing to the plant’s ability to cope with adverse environmental conditions. Lots of WRKY genes belonging to the group IIc subfamily have been reported to be transcriptionally regulated by various abiotic stresses, including salt, cold, and drought. (Khoso et al. 2022). The Arabidopsis WRKY22 TF mediates dark-induced leaf senescence (Zhou et al. 2011). The expression level of AtWRKY22 gradually increased as the plants were transferred from light to dark conditions. The expression of TaWRKY10 with the highest homology with ZjWRKY10 is regulated by salt, drought, cold, and hydrogen peroxide. The TaWRKY10 also functions as a positive regulator under abiotic stresses by regulating osmotic balance, scavenging reactive oxygen species (ROS), and controlling transcription of stress-related genes (Wang et al. 2013). Arabidopsis WRKY71 has been demonstrated to modulate ethylene-mediated leaf senescence (Yu et al. 2021). Furthermore, the interaction between AtWRKY75, ROS and salicylic acid (SA) stimulates leaf senescence (Guo et al. 2017).

Figure 2. Expression analysis of ZjWRKY10 under abiotic stresses. Relative transcription levels under 150 mM sodium chloride (NaCl) (A), cold at 4°C (B), 20% polyethylene glycol (PEG) (C), and dark (D) conditions. β-Actin (GU290545) was used as an internal control. Data represent the mean of three biological replicates ± SE. Error bars represent standard errors. The asterisks indicate significant differences at p < 0.05 (*) and p < 0.001 (***)

We generated transgenic Arabidopsis plants overexpressing ZjWRKY10. After 6 days of dark treatment, the transgenic plants exhibited significant yellowing of leaves compared to the wild type (Fig 3A). Furthermore, the chlorophyll content in transgenic lines was also lower than that of the wild type (Fig. 3B), indicating that overexpression of ZjWRKY10 accelerated leaf senescence. The transgenic plants also exhibited lower survival rates compared to the wild type after 14 days of dark treatment and 8 days of recovery under light (Fig. 4). The results suggest that ZjWRKY10 functions as a regulator or modulator that accelerates leaf senescence. In addition, the transgenic Arabidopsis plants exhibited earlier flowering compared to the wild type, as confirmed by assessing flowering times and the number of rosette leaves (Fig. 5). This earlier flowering phenotype was supported by an increase in the expression of FLOWERING LOCUS T (FT), a floral integrator gene, in the leaves of the ZjWRKY10 overexpressing plants compared to the wild type (Fig. 5D) is expressed in the leaves of phloem and is transported to the shoot apical meristem where it initiates floral transition (Kardailsky et al. 1999; Lee and Imaizumi 2018). In addition, AtWKY71 has been implicated in flowering regulation by directly controlling the expression of FT and LFY (Yu et al. 2016). Similar to our results with ZjWRKY10, CpWRKY71, a gene from Chimonanthus praecox, belongs to the IIc subgroup and promotes flowering and leaf senescence in Arabidopsis (Huang et al. 2019).

Korean lawngrass (Zoysia japonica), a warm-season turf, lacks cold tolerance, which leads to leaf senescence during autumn and yellowing of leaves throughout the winter season. Therefore, we have interested in prolonging the green period of the turf by delaying the leaf senescence. The overexpression of ZjWRKY10 promoted both flowering and senescence in Arabidopsis. Conversely, it might be worth studying whether knocking out this gene in Z. japonica using genome editing techniques could delay leaf senescence. Leaf senescence is a finely regulated process in which plants maximize their fitness by reabsorbing nutrients from leaves. Numerous senescence-associated genes (SAGs) regulated by senescing leaves are involved in this process (Woo et al. 2010). Therefore, the functional analysis of SAGs can help us understand the regulation process of leaf senescence. As is known to all, with increasing research on WRKY transcription factors, increasing evidence has shown that it not only responds to biotic and abiotic stresses (Cai et al. 2017; Wang et al. 2014; Zhang et al. 2018b), but also plays an indispensable role in the growth (Cai et al. 2014) and development (Ding et al. 2014; Yang et al. 2016) process of plants. In conclusion, our findings will provide valuable insights into the functional characterization of WRKY transcription factors that respond to abiotic stresses or darkness. ZjWRKY10 could also be utilized in molecular breeding programs to improve stress tolerance, including techniques such as genome editing.

This work was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) of the Ministry of Education (2019R1A6A1A11052070), Republic of Korea.