Sitemap
JPB 로고The Korean Society of Plant Biotechnology｜Contact Us
닫기
Search
Advanced Search +
닫기
Quick links
Most Cited Most Read Archives Go to e-Submission

Research Article

Split Viewer

J Plant Biotechnol 2022; 49(3): 178-186

Published online September 30, 2022

https://doi.org/10.5010/JPB.2022.49.3.178

© The Korean Society of Plant Biotechnology

Solanum acaule 색소체 유전자형 선발을 위한 특이적 분자마커 개발

박태호

대구대학교 원예학과

Received: 13 September 2022; Revised: 26 September 2022; Accepted: 26 September 2022

PCR-based markers to select plastid genotypes of Solanum acaule

Tae-Ho Park

Author Info. +

(Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea)

Correspondence to : e-mail: thzoo@daegu.ac.kr

Received: 13 September 2022; Revised: 26 September 2022; Accepted: 26 September 2022

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Go to

The tetraploid Solanum acaule is a wild potato species from Bolivia widely used for potato breeding because of its diverse attractive traits, including resistance to frost, late blight, potato virus X, potato virus Y, potato leafroll virus, potato spindle tuber viroid, and cyst nematode. However, the introgression of useful traits into cultivated potatoes via crossing has been limited by differences in endosperm balance number between species. Somatic fusion could be used to overcome sexual reproduction barriers and the development of molecular markers is essential to select proper fusion products. The chloroplast genome of S. acaule was sequenced using next-generation sequencing technology and specific markers for S. acaule were developed by comparing the obtained sequence with those of seven other Solanum species. The total length of the chloroplast genome is 155,570 bp, and 158 genes were annotated. Structure and gene content were very similar to other Solanum species and maximum likelihood phylogenetic analysis with 12 other species belonging to the Solanaceae family revealed that S. acaule is very closely related to other Solanum species. Sequence alignment with the chloroplast genome of seven other Solanum species revealed four InDels and 79 SNPs specific to S. acaule. Based on these InDel and SNP regions, one SCAR marker and one CAPS marker were developed to discriminate S. acaule from other Solanum species. These results will aid in exploring evolutionary aspects of Solanum species and accelerating potato breeding using S. acaule.

Keywords cpDNA, InDels, PCR-based marker, Potato, SNPs, Solanum acaule

서 론

Go to

볼리비아에 자생하는 Solanum acaule는 감자(Solanum tuberosum L.)와 같이 괴경을 형성하는 4배체이며, 재배종 감자의 야생종 중의 하나이다(Bitter 1912; Dvořák 1983; Hawkes 1990). S. acaule는 Phytophthora infestans에 의해 유발되는 감자역병, 감자잎말림바이러스(PLRV), 감자바이러스X (PVX), 감자바이러스Y (PVY), Potato spindle tuber viroid (PSTV)에 의한 감자걀쭉병, 감자시스트선충 등과 같은 생물학적 요인 및 서리와 같은 비생물학적 요인에 대한 저항성을 가지고 있어 감자의 신품종 육성에 중요한 재료로 인식되고 있다(Chávez et al. 1988; Chen and Li 1980; Chen et al. 1977; Estrada 1980; Ross 1986; Watanabe et al. 1994; Zoteeva et al. 2000). 이러한 유용 형질을 재배종 감자에 도입하기 위해서는 전통적인 육종법인 교배를 통한 방법을 이용하는 것이 보편적이나 본 연구에 사용된 야생종인 S. acaule는 EBN (Endosperm Balanced Number)이 2로 재배종 감자의 EBN 4와의 차이로 인해 발생하는 생리적인 불화합성으로 직접적인 교배로 품종을 육성하는 것이 불가능하다(Cho et al. 1997; Hawkes 1990; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014). 따라서, 야생종과 재배종 감자의 원형질체를 분리하고 이를 융합하는 방법으로 종간의 생리적 장벽을 극복하는 방법이 이용될 수 있다(Bidani et al. 2007; Nouri-Ellouz et al. 2016). 이러한 체세포잡종의 육성은 S. acaule와 S. tuberosum 간에 성공적으로 이루어진 것을 포함하여(Rokka et al. 1998; Yamada et al. 1998), S. brevidens, S. commersonii, S. nigrum, S. phureja 등 다양한 야생종을 대상으로 재배종 감자와의 체세포융합이 이루어진 바가 있다(Barsby et al. 1984; Binding et al. 1982; Kim-Lee et al. 2005; Puite et al. 1986). 따라서, S. acaule를 이용한 체세포잡종을 육성하는 연구가 진행중에 있으며, 향후 체세포융합을 통한 체세포잡종을 확보하였을 때 재배종 감자 및 S. acaule의 핵내 혹은 세포질 DNA가 체세포잡종에 어떻게 전달이 되는지를 확인하기 위해, 본 연구에서는 그 중 엽록체 DNA의 구성을 확인할 수 있도록 엽록체 유전체 정보를 활용하여 S. acaule와 S. tuberosum을 구분할 수 있는 분자마커를 개발하고자 하였다.

엽록체의 유전체는 원형 이중가닥의 분자구조를 가지고 있으며, 속씨식물의 경우 약 115-165 kb의 크기로 두 개의 inverted repeats (IRs), 하나의 large single copy (LSC), 하나의 small single copy (SSC)를 포함하는 전형적인 4분할 구조로 되어 있다(Yurina and Odintosova 1998). Table 1에 제시한 바와 같이, 이미 감자뿐만 아니라 다양한 감자의 근연야생종을 대상으로 한 엽록체 유전체 연구가 진행되어 그 결과가 보고되었으며, Solanum 속에 포함되어 있는 이들 엽록체 유전체 모두가 앞서 알려진 바와 같이 크기, 유전자 구성, 구조 등이 매우 유사한 것으로 확인되었다(Palmer 1991; Raubeson and Jansen 2005; Saski et al. 2005; Sugiura et al. 1998). 그럼에도 불구하고 이러한 식물의 종간 엽록체 유전체 전체를 비교를 통해 InDel이나 SNP와 같은 영역을 확인할 수 있으며, 이는 많은 식물의 엽록체 유전체에서 유전자의 재배열이나 역위 등과 같은 염기서열에서의 구조적 변화에 의해 변이가 발생하기 때문이다(Calsa Junior et al. 2004; Cho et al. 2015; Jheng et al. 2012; Kim et al. 2005; Kim and Park 2019, 2020a, 2020b; Park 2021b, 2022; Saski et al. 2005). 이에 본 연구에서는 Park (2021a)이 보고한 S. acaule의 엽록체 전장유전체에 대한 세부 정보를 제공하고, 이 정보를 이용한 S. acaule 특이적 분자마커 개발의 결과를 제공하고자 한다.

Table 1 . Comparison of the chloroplast genome sequence of S. acaule with those of ten other Solanaceae species

SpeciesAccession no.Total Length (bp)GC content (%)Total No. of genesNo. of tRNANo. of rRNAReference
S. acauleMK036506155,57037.84135364this study
S. brevicauleMK036507155,53137.87135364Park (2022)
S. demissumMK036508155,55837.87135364Cho et al. (2019)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

재료 및 방법

Go to

식물재료

S. acaule 특이적 분자마커 개발을 위해 엽록체 전장 유전체 분석에 이용된 S. acaule 계통 중 하나인 SA11 (Park 2021a)과 더불어 S. acaule 계통 하나 SA10이 추가되었으며, 재배종 감자 품종인 ‘서홍’(SH), ‘하령’(HR), 감자품종 육성을 위한 계통 PT56, 그리고 총 16개 계통의 야생종, SD (S. demissum, PI218047), SB2 (S. brevicaule, PI205394), SC4 (S. candolleanum, PI210035), SC1 (S. cardiophyllum, PI341233), SC2 (S. commersonii, PI558050), SH1 (S. hjertingii, PI186559), SH2 (S. hougasii, PI161174), SI (S. iopetalum, PI230459), SK (S. kurtzianum, PI578236), SJ (S. jamesii, PI578326), SM2 (S. microdontum, PI310979), SM1 (S. mochiquense, PI338616), SP(S. pinnatisectum, PI190115), SS (S. stoloniferum, PI160224), SV2 (S. vernei, PI230468), SV1 (S. verrucosum, PI160228)이 이용되었다. 모든 식물 재료는 국립식량과학원 고령지농업연구소로부터 분양받아 기내식물체로 유지, 증식되었다.

DNA 분리

모든 식물재료를 대상으로 기내에서 증식된 약 100 mg의 유식물체를 채취하여 Genomic DNA Extraction kit (Plants)(RBC, New Taipei City, Taiwan)를 이용하여 DNA를 추출하였다.

S. acaule 엽록체 전장유전체의 완성 및 분석

S. acaule의 전장 유전체 분석을 위해 S. acaule 계통 중 하나인 SA11의 전체 DNA를 추출하고 Macrogen (Macrogen, Seoul, South Korea)의 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA)의 플랫폼을 이용하여 전체 염기서열을 획득하였다. 이 전체 염기서열(raw data) 정보는 파이젠의 생물정보학 파이프라인(http://phyzen.com)의 de novo assembly에 의해 분석되어 조립되었다(Cho et al. 2015). 우선 CLC assembly cell package version 4.2.1 내의 CLC quality trim 프로그램을 이용하여 trimming 과정을 거처, high-quality (Phred score 20 이상) 염기서열 만을 추출하여 분석에 이용하였다. 확보된 염기서열은 CLC assembly cell package version 4.2.1 내의 CLC de novo assemble 프로그램을 이용한 dnaLCW 방법으로 조립하고, 그중 엽록체 유래의 contig 만을 선별하여 contig를 확장하고 통합한 후 gap-filling 함으로써 완전장 엽록체 유전체를 완성하였다. 완성된 엽록체 염기서열에 trimmed read를 mapping 하여 각 위치의 mapped read depth를 계산하였으며, 완성된 엽록체 유전체의 구조 및 염기서열을 레퍼런스 종과 비교하였다. BLASTN을 실시하고 homology가 높은 종 중 하나인 S. berthaultii의 엽록체 전장 유전체(KY419708, Kim et al. 2018; Park 2017)와 BLASTZ (Schwartz et al. 2003) 분석을 시행하였다.

완성된 S. acaule 엽록체 유전체 서열의 유전자 부위를 결정하기 위해 Geseq 프로그램을 통해 유전자 부위를 확인하였으며(Tillich et al. 2017), BLAST search를 기반으로 manual curation을 진행하여 최종 유전자 부위를 확인하였다. 확인된 엽록체 유전체의 유전자 부위는 OGDraw (Organellar GenomeDRAW; Lohse et al. 2013) 프로그램을 통해 원형의 유전자지도에 표시하였다.

엽록체 전장유전체의 비교 및 PCR 기반의 분자마커 개발

S. acaule의 계통발생학적 유연 관계는 S. acaule 엽록체 전장 유전체 염기서열과 NCBI (the National Center for Biotechnology Information)로부터 얻은 재배종 감자 S. tuberosum (KM489056 및 NC008096)을 포함하는 가지과 총 12종 S. berthaultii (KY419708), S. demissum (MK036508), S. hougasii (MF471372), S. stoloniferum (MF471373), S. brevicaule (MK036507), S. commersonii (KM489054), S. chacoense (MF471371), S. bulbocastanum (DQ347958), S. lycopersicum (NC007898), S. nigrum (KM489055), Capsicum annuum (JX270811) 엽록체 전장 유전체 염기서열에서 확인된 엽록체 코딩 서열을 기반으로 1,000번의 Bootstrap 옵션을 적용한 MEGA6.0 프로그램으로 분석되었다(Tamura et al. 2013). 여기에는 Kimura 2-parameter 모델을 적용한 Maximum likelihood 방법이 이용되었다.

S. acaule 특이적 분자마커 개발을 위해 S. acaule 엽록체 전장 유전체 염기서열은 NCBI로부터 얻은 S. brevicaule (MK036507), S. demissum (MK036508), S. tuberosum (KM489056), S. commersonii (KM489054), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. stolonioferum (MF471373)의 엽록체 전장 유전체 염기서열과 EMBL (http://www.ebi.ac.uk/Tools/ msa/clustalw2)의 ClustalW2에 의해 다중 정렬하여 염기서열을 비교 분석하여 S. acaule 특이적 영역대를 구명하였다. S. acaule를 포함한 총 8종의 엽록체 전장 유전체 염기서열을 대상으로 한 다중 정렬의 결과로 구명된 S. acaule 특이적 InDel 및 SNP를 대상으로 S. acaule 특이성 검증이 수행되었다. InDel의 경우에는 InDel이 있는 영역에서 primer를 디자인하여 allele 특이적 분자마커를 개발하고자 하였으며, SNP를 대상으로는 우선 dCAPS Finder 2.0 (http://helix.wustl.edu/ dcaps/dcaps.html)을 이용하여 S. acaule 특이적으로 작용하거나 S. acaule를 제외한 다른 Solanum 종들에 특이적으로 작용하는 제한효소를 확인한 후, SNP 영역을 포함하는 primer를 디자인하여, S. acaule와 S. tuberosum을 포함하여 총 21개의 유전자 계통, S. acaule (SA11 및 SA10), S. tuberosum (감자품종 ‘서홍(Seohong)’, ‘하령(Haryeong)’, 및 감자품종 육성계통 PT56), S. demissum (SD), S. brevicaule (SB2), S. candolleanum (SC4), S. cardiophyllum (SC1), S. commersonii (SC2), S. hjertingii (SH1), S. hougasii (SH2), S. iopetalum (SI), S. kurtzianum (SK), S. jamesii (SJ), S. microdontum (SM2), S. mochiquense (SM1), S. pinnatisectum (SP), S. stoloniferum (SS), S. vernei (SV2) and S. verrucosum (SV1)을 대상으로 총 25 ul 볼륨(약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany)를 이용하여 PCR을 수행하였다. PCR의 결과는 핵산 염색용액인 RedSafe (Intron Biotechnology, Seongnam, South Korea)를 이용하여 1% agarose gel에서 확인하였으며, PCR 결과물을 대상으로 제한효소를 처리한 후, 동일한 방법으로 agarose gel에서 확인하여 PCR 기반의 S. acaule 특이적 분자마커 개발을 진행하였다.

결과 및 고찰

Go to

감자 야생종 S. acaule의 엽록체 전장 유전체

S. acaule 엽록체 전장 유전체는 NGS (Next-Generation Sequencing) 기술에 의해 완성되었으며 Park (2021a)에 의해 보고된 바 있다. 이에 더해, S. acaule의 엽록체 전장 유전체를 완성한 과정과 그 결과를 세부적으로 기술하면, NGS 데이터 총 염기서열은 7,807,842 read를 통해 약 2.3 Gbp를 생산하였으며 평균 길이는 293.8 bp였다. 전체 염기서열에서 high-quality 서열을 얻기 위해 전체 read의 약 85.2%를 사용하여 CLC quality trim 프로그램을 이용하여 전처리 과정을 거치고 Phred score 20 이상을 추출하여 평균 길이 257.3 bp인 염기서열 정보 약 1.7 Gbp를 얻었다. 이는 전체 raw data의 약 74.6%로, 앞서 보고된 S. breviaule와 S. demission의 전장 유전체와 비교하였을 때 사용된 총 염기서열이 약 0.7-0.8 Gbp 적고, raw data 대비 최종 추출 염기서열의 비율 또한 약 3% 정도 적은 수준이나(Park 2021b, 2022), 이를 이용한 de novo assembly와 이후 엽록체 유래의 contig 선발과 확장 및 통합, 그리고 gap-filling 과정을 거쳐 완성된 엽록체 전장 유전체의 결과를 고려할 때, 총 염기서열은 155,570 bp (MK036506), aligned read 수는 약 55만 4천개, 엽록체 유전체 평균 coverage는 약 893.8x, 전체 trimmed read를 완성된 유전체 서열에 mapping하여 확인한 read depth는 최소 400 이상으로 크게 다르지 않은 결과를 보여주었다. 그 구조 또한 다른 식물의 엽록체 전장 유전체와 동일한 형태의 원형 이중가닥 분자로 86,020 bp의 LSC (Large Single Copy), 18,364 bp의 SSC (Small Single Copy), 그리고 한 쌍의 25,593 bp IRa/IRb (Inverted Repeat a/b)로 이루어져 있었으며, 보고된 S. berthaultii 엽록체 전장 유전체 염기서열(KY419708, Kim et al. 2018; Park 2017)과 비교와 BLASTZ 분석(Schwartz et al. 2003) 결과로도 그 유사성을 확인할 수 있었다(Fig. 1). S. acaule의 엽록체 전장 유전체 전체 염기서열을 NCBI에서 Blastn 분석을 한 결과 Solanum x juzepczukii (NC050208), S. megistacrolobum (MH021518)과 각각 99.90%, 99.89%의 높은 유사도를 보였으며, GC 비율도 37.84%로 거의 비슷하게 나타났다(Table 1).

Fig. 1. Complete chloroplast genome assembly of S. acaule (MK036506). The four representative contigs for the chloroplast genome of S. acaule and the comparison with the corresponding regions of the S. berthaultii chloroplast genome (KY419708; Kim et al. 2018) are presented. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientation, respectively

S. acaule 엽록체 전장 유전체에는 총 158개의 유전자가 분포하고 있었는데, 여기에는 105개의 단백질 코딩, 45개의 tRNA, 8개의 rRNA를 포함하고 있으며, 이중 11개의 단백질 코딩 유전자, 9개의 tRNA, 4개의 rRNA가 한 쌍의 IR영역 IRa 및 IRb 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 59.2%가 코딩 영역으로 158개의 유전자 평균 길이가 약 583.1 bp로, 이 중 단백질 코딩 유전자, tRNA, rRNA가 각각 평균 764.6 bp, 62.3 bp, 1130.8 bp의 크기로 51.6%, 1.8%, 5.8%의 비율로 분포되어 있었으며, Solanum 속의 다른 종들과 비교해 보면 유전자, tRNA, rRNA 등의 개수, 순서 등이 모두 유사한 것으로 나타났다(Table 1)(Cho et al. 2016, 2019; Cho and Park 2016; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021b, 2022).

Fig. 2. Gene map of the S. acaule chloroplast genome. Genes on the outside and inside of the map are transcribed in the clockwise and counterclockwise directions, respectively

엽록체 전장유전체 비교 및 계통수

S. acaule의 엽록체 전장 유전체와 가지과에 속하는 다른 12종의 엽록체 전장 유전체의 코딩 서열을 비교하여 계통수를 작성하였다(Fig. 3). S. acaule는 계통수에서 재배종 감자인 S. tuberosum을 포함하는 다수의 가지속에 포함되어 있는 종들과 매우 근접하여 같은 그룹에 위치해 있음을 확인하였으며, 고추(Capsicum annuum), 까마중(S. nigrum), 토마토(S. lycopersicum)와는 상대적으로 유연관계가 먼 것을 확인하였다. 또한, S. acaule의 엽록체 전장 유전체 전체 염기서열을 재배종 감자와 6종의 감자 근연야생종의 엽록체 전장 유전체 전체 염기서열을 EMBL의 ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 다중 정렬을 수행한 결과 S. acaule 특이적 분자마커 개발이 가능한 다수의 S. acaule 특이적 InDel과 SNP 영역을 확인할 수 있었다(Fig. 4). 이는 앞서 보고된 것과 같이, 가지속에 속한 다수의 감자 근연야생종들의 엽록체 전장 유전체가 동일한 구조와 크기 및 높은 염기서열의 유사성에도 불구하고, 다양한 유전적 요인에 의한 변이로 특정 근연야생종 특이적인 InDel과 SNP가 존재하는 것으로 확인된 것이다(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021b, 2022). 결과적으로, S. acaule를 포함한 총 8종의 비교를 통해 S. acaule 특이적인 InDel과 SNP 영역은 각각 4와 79개였으며, 앞서 보고된 바와 유사하게 4개의 InDel은 모두 유전자간 영역에 분포하고 있었으며, SNP의 경우 79개 중 49개는 유전자간 영역에 그리고 30개는 유전자 영역에 분포하고 있었다.

Fig. 3. Maximum likelihood phylogenetic tree of S. acaule with 12 species belonging to the Solanaceae family, based on chloroplast protein-coding sequences. The numbers on each node indicate the bootstrap values from 1,000 replicates. The figure has been partially adopted from Park (2021)

Fig. 4. Multiple alignment of the sequences containing InDel and SNP used to develop the PCR-based markers. Sequences of S. acaule (SA11; MK036506; this study), S. brevicaule (SB2-1; MK036507; Park 2022), S. demissum (SD9; MK036508; Cho et al. 2019), S. tuberosum (Stub; KM489056; Cho et al. 2016), S. commersonii (Scmr; KM489054; Cho et al. 2016), S. bulbocastanum (Sblb; DQ347958; Daniell et al. 2006), S. chacoense (Scha MF471371; Kim and Park 2019), and S. stoloniferum (Ssto; MF471373; Kim and Park 2020a) were used and listed from top to bottom for each InDel and SNP region. The InDel and SNP regions detected on the S. acaule regions are highlighted and underlined, and the restriction site is indicated by red color and bold text

S. acaule 특이적 분자마커 개발

S. acaule를 포함하여 감자와 근연야생종 총 8종의 엽록체 전장 유전체 전체 염기서열의 다중 정렬로 확인한 S. acaule 특이적 InDel과 SNP는 S. acaule 특이적인 분자마커 개발을 위해 활용되었다. InDel 영역을 활용하는 경우 InDel 영역에서 특이적인 primer를 제작하여 PCR을 통해 InDel 영역의 염기서열 차이로 나타나는 다형성의 차이로 S. acaule 특이적인 하나의 SCAR (Sequence Characterized Amplified Region) 마커의 개발이 가능하였다(Cho et al. 2015; Garcia-Lor et al. 2013; Yamaki et al. 2013)(Table 2, Fig. 5A). 나머지 3개의 InDel 영역에서도 PCR 기반의 분자마커의 개발을 시도하였으나, InDel의 크기가 InDel 특이적인 PCR 결과를 얻기에는 다소 작고 InDel 영역과 인근 영역에서의 반복서열의 존재로 인해 SCAR 마커 개발에 어려움이 있었다(Kim and Park 2020b). SNP 영역의 경우에는 총 79개 영역 중 일부를 대상으로 S. acaule 특이적 SNP를 대상으로 적용가능 한 제한효소의 유무를 확인한 후 SNP 영역을 포함하여 PCR 결과를 얻을 수 있도록 primer를 제작하고 PCR의 결과로 얻은 DNA 단편에 제한효소를 처리하여 하나의 S. acaule 특이적인 CAPS (Cleaved Amplified Polymorphism Sequence; Konieczny and Ausubel 1993) 마커를 얻을 수 있었다(Table 2, Fig. 5B). 이러한 CAPS 마커는 같은 종 내에서의 유전자형을 구분하거나 종간 특이적으로 작용하여 선발에 활용되는 등 다양한 작물들을 대상으로 활용되고 있다(Caranta et al. 1999; Konovalov et al. 2005; Lee et al. 2008; Pettenkofer et al. 2020; Smilde et al. 2005; Uncu et al. 2015; van der Voort et al. 1999). 결과적으로 본 연구에서는 최종 InDel 및 SNP 기반의 S. acaule 특이적인 PCR 기반의 분자마커를 각각 하나씩 개발하였으며, InDel 기반의 분자마커 SA_InDel_3 (Fig. 4, Fig. 5A)은 trnG와 rnfM 유전자 사이에 존재하는 SCAR 마커로 개발되었으며, SNP 기반의 분자마커 SA_SNP_7 (Fig. 4, Fig. 5B)은 ccsA 유전자 내에 존재하는 SNP가 제한효소 HaeIII에 의해 S. acaule 만은 특이적으로 절단하여 S. acaule 특이적인 CAPS 마커로 개발되었다.

Table 2 . Information on primers and restriction enzymes used to generate S. acaule specific markers

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SA_InDel_3trnG-rnfM(Intergenic)FTCAATGGATTCATGATAAAG742as
RTTTATGAAATTCAATAATAAAGC
SA_SNP_7ccsA(Intragenic)FATTTCCTTTTCGATCGTTTC588HaeIII
RTTGAATCAATTGGGACCTG

aF and R indicate forward and reverse strand of primers.

bThe expected sizes of PCR fragments are measured based on the sequence of S. acaule.

cRestriction enzyme generating S. acaule-specific marker. ‘as’ indicates allele-specific marker.

Fig. 5. PCR-based markers that discriminate S. acaule from other Solanum species. A: SA_InDel_3. B: SA_SNP_7. The two markers are all positively specific to S. acaule. SA11 and SA10 indicate two different lines of S. acaule (PI310970). M, SH, HR, PT56, SD, SB2, SC4, SC1, SC2, SH1, SH2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate size marker ladders, potato varieties ‘Seohong’, ‘Haryeong’, a potato breeding line ‘PT56’, S. demissum (PI218047), S. brevicaule (PI205394), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. hjertingii (PI186559), S. hougasii (PI161174), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S. microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively

핵 내의 염색체 DNA를 대상으로 한 분자마커의 개발뿐만 아니라 엽록체의 전장유전체의 염기서열을 구명하고 엽록체 DNA를 대상으로 유전자형을 구분할 수 있는 종 특이적인 분자마커를 개발하는 것은 감자 신품종 육성에 기여할 수 있으며, 또한 유사 종의 식물들 간에 진화학적 연구에도 기여할 수 있다(Bohs and Olmstead 1997; Hosaka and Sanetomo 2012). 특히, 감자의 경우 신품종 육성에서 다양한 근연야생종의 유용형질을 감자에 도입하고자 하는 노력이 지속적으로 이루어지고 있으나, 배수성과 EBN의 차이로 인한 교배육종이 정상적으로 이루어지지 않는 여건에서 원형질체를 이용한 체세포융합에 의한 체세포잡종을 육성하고 이를 신품종 육성에 활용하고 있어, 이 과정에서 잡종의 유전자형을 확인하는 작업이 반드시 필요하다. 앞서 보고된 연구결과에 의하면, Solanum 속에 포함된 종들을 포함한 다양한 식물종에서 체세포융합과 기내 식물체 재분화 과정에서 한 쪽의 엽록체 유전체가 무작위로 배분되고 미토콘드리아 유전체의 경우 높은 빈도로 재조합이 발생하는 것으로 알려져 있다(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Xiang et al. 2004). 하지만, 엽록체 유전체의 경우에도 양친의 유전체가 모두 전달되는 경우도 있는 것으로 알려져 있어 유전자형을 확인하는 과정이 필요하다(Wang et al. 2011). 따라서, 본 연구에서 개발된 InDel 기반의 SCAR 마커 및 SNP 기반의 CAPS 마커는 S. acaule를 이용하여 체세포융합을 통한 체세포잡종을 육성하여 감자의 신품종을 육성 과정에서 S. acaule와 S. tuberosum 유래의 유전자형을 구별하는데 이용되어 S. acaule를 이용한 감자의 신품종 육성에 기여할 것이다.

적 요

Go to

볼리비아 유래의 4배체 감자 야생종 중 하나인 Solanum acaule는 서리, 감자역병, 감자바이러스X, 감자바이러스Y, 감자잎말림바이러스, 감자걀쭉병, 선충 등에 대한 저항성과 같이 감자의 신품종 육성에 매우 유용한 형질들을 가지고 있어 감자 육종에 많이 이용되고 있다. 그러나 이러한 유용 형질들을 재배종 감자에 전통적인 교잡에 의해 도입하는 것은 야생종과 재배종 간의 서로 다른 EBN에 따라 매우 제한적이다. 따라서, 이러한 생리적 장벽을 극복하기 위해서는 체세포융합을 이용할 수 있는데, 육종에 활용할 적절한 체세포융합체를 선발하기 위해서는 적절한 분자마커의 개발이 필수적이다. 이에, 본 연구에서는 앞서 차세대 유전체 기술에 의해 완성되어 보고된 S. acaule의 엽록체 전장 유전체 정보를 기반으로 이를 다른 8개의 Solanum 종의 엽록체 전장 유전체 정보와 비교를 통해 S. acaule 특이적인 분자마커를 개발하였다. S. acaule의 엽록체 전장 유전체 총 길이는 155,570 bp였으며, 총 158개의 유전자로 구성되어 있었다. 전체적인 구조와 유전자의 구성은 다른 Solanum 종들과 매우 유사하였고 12종의 다른 가지과에 속해 있는 종과의 계통수 분석에서 다른 Solanum 종과 매우 가까운 유연관계를 가지는 것을 확인하였다. S. acaule의 엽록체 전장 유전체와 다른 7개 Solanum 종의 엽록체 전장 유전체 다중 정렬의 결과로 각각 4개와 79개의 S. acaule 특이적인 InDel 및 SNP 영역이 확인되었으며, 이 정보를 이용하여 각각 1개씩의 InDel 및 SNP 영역 유래의 PCR 기반의 분자마커를 개발하였다. 본 연구의 결과는 S. acaule의 진화적 측면에서의 연구와 S. acaule를 이용한 감자품종 육성 연구에 기여를 할 수 있을 것이다.

사 사

Go to

이 성과는 정부(과학기술정보통신부)의 재원으로 한국연구재단의 지원을 받아 수행된 연구임(No. NRF-2021R1F1A1 045981).

REFERENCES

Go to
  1. Barsby TL, Shepard JF, Kemble RJ, Wong R (1984) Somatic hybridization in the genus Solanum: S. tuberosum and S. brevidens. Plant Cell Rep 3:165-167
    Pubmed CrossRef
  2. Bidani A, Nouri-Ellouz O, Lakhoua L, Shihachakr D, Cheniclet C, Mahjoub A, Drira N, Gargouri-Bouzid R (2007) Interspecific potato somatic hybrids between Solanum berthaultii and Solanum tubersoum L. showed recombinant plastome and improved tolerance to salinity. Plant Cell Tiss Organ Cult 91:179-189
    CrossRef
  3. Binding H, Jain SM, Finger J, Mordhorst G, Nehls R, Gressel J (1982) Somatic hybridization of an atrazine resistant biotype of Solanum nigrum with Solanum tuberosum. Theor Appl Genet 63:273-277
    Pubmed CrossRef
  4. Bitter G (1912) Solana nova vel minus cogita. Feddes Repert 11:1-393
    CrossRef
  5. Bohs L, Olmstead RG (1997) Phylogenetic relationships in Solanum (Solanaceae) based on ndhF sequences. Syst Bot 22:5-17
    CrossRef
  6. Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46:366-373
    Pubmed CrossRef
  7. Caranta C, Thabuis A, Palloix A (1999) Development of a CAPS marker for the Pvr4 locus: A tool for pyramiding potyvirus resistance genes in pepper. Genome 42:1111-1116
    Pubmed CrossRef
  8. Chávez R, Brown CR, Iwanaga M (1988) Transfer of resistance to PLRV titer buildup from Solanum etuberosum to a tuber- bearing Solanum gene pool. Theor Appl Genet 76:129-135
    Pubmed CrossRef
  9. Chen HH, Li PH (1980) Characteristics of cold acclimation and deacclimation in tuber-bearing Solanum species. Plant Physiol 65:1146-1148
    Pubmed KoreaMed CrossRef
  10. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
    Pubmed CrossRef
  11. Chen P, Li PH, Cunningham P (1977) Ultrastructural differences in leaf cells of some Solanum species in relation to their frost resistance. Bot Gaz 138:276-285
    CrossRef
  12. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29:154-161
  13. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
    Pubmed CrossRef
  14. Cho K-S, Cho J-H, Park Y-E, Park T-H (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4:1800-1802
    CrossRef
  15. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57: 69-78
    CrossRef
  16. Cho K-S, Yun B-K, Yoon Y-H, Hong S-Y, Mekapogu M, Kim K-H, Yang T-J (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
    Pubmed KoreaMed CrossRef
  17. Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25:1369-1379
    Pubmed CrossRef
  18. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112:1503-1518
    Pubmed CrossRef
  19. Dvořák J (1983) Evidence for genetic suppression of heterogenetic chromosome pairing in polyploidy species of Solanum, sect. Petota. Can J Genet Cytol. 25:530-539
    CrossRef
  20. Estrada RN (1980) Frost resistance potato hybrids via Solanum acaule, Bitt. dipolid-tetraploid crosses. Amer Potato J 57: 609-619
    CrossRef
  21. Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L and Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111:1-19
    Pubmed KoreaMed CrossRef
  22. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop, p.107.
  23. Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. Belhaven Press, London, UK
  24. Hosaka K, Sanetomo R (2012) Development of a rapid identification method for potato cytoplasm and its use for evaluating Japanese collections. Theor Appl Genet 125:1237-1251
    Pubmed CrossRef
  25. Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C (2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids. Plant Sci 190:62-73
    Pubmed CrossRef
  26. Kim KJ, Choi KS, Jansen RK (2005) Two chloroplast DNA inversion originated simultaneously during the early evolution of the sunflower family (Asteraceae). Mol Biol Evol 22: 1783-1792
    Pubmed CrossRef
  27. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
    CrossRef
  28. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46:79-87
    CrossRef
  29. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140
    CrossRef
  30. Kim S, Park T-H (2020b) Development of Solanum hougasii- specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47: 141-149
    CrossRef
  31. Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM (2005) Bacterial wilt resistance in the progenies of the fusion hybrids between haploid of potato and Solanum commersonii. Amer J Potato Res 82:129-137
    CrossRef
  32. Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4:403-410
    Pubmed CrossRef
  33. Konovalov F, Toshchakova E, Gostimsky S (2005) A CAPS marker set for mapping in linkage group III of pea (Pisum sativum L.) Cell Mol Biol Lett 10:163-171
  34. Lee J, Yoon JB, Park HG (2008) A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol Breeding 21:95-104
    CrossRef
  35. Lohse M, Drechsel O, Kahlau S, Bock R (2013) Organellar GenomeDRAW - a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41:W575-W581
    Pubmed KoreaMed CrossRef
  36. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116:221-230
    CrossRef
  37. Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17:814-818
    Pubmed CrossRef
  38. Nouri-Ellouz O, Triki MA, Jbir-Koubaa R, Louhichi A, Charfeddine S, Drira N, Gargouri-Bouzid R (2016) Somatic hybrids between potato and S. berthaultii show partial resistance to soil-borne fungi and potato virus Y. J Phythpathol 164:485-496
    CrossRef
  39. Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60:105-113
    CrossRef
  40. Palmer JD (1991) Plastid chromosomes: structure and evolution, p. 5-53. In: L. Bogorad, K. Vasil (eds.) The molecular biology of plastids. Academic Press, San Diego, USA.
    KoreaMed CrossRef
  41. Park T-H (2017) The complete chloroplast genome of Solanum berthaultii, one of the potato wild relative species. Mitochondr DNA Part B 2:88-89
    Pubmed KoreaMed CrossRef
  42. Park T-H (2021a) Complete chloroplast genome sequence of the wild diploid potato relative, Solanum acaule. Mitochondr DNA Part B 6:1189-1191
    Pubmed KoreaMed CrossRef
  43. Park T-H (2021b) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48:18-25
    CrossRef
  44. Park T-H (2022) Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 49:30-38
    CrossRef
  45. Pettenkofer T, Finkeldey R, Müller M, Krutovsky KV, Vornam B, Leinemann L, Gailing O (2020) Development of novel Quercus rubra chloroplast genome CAPS markers for haplotype indentification. Silvae Genetica 69:78-85
    CrossRef
  46. Puite KJ, Roest S, Pijnacker LP (1986) Somatic hybrid potato plants after electrofusion of diploid Solanum tuberosum and Solanum phureja. Plant Cell Rep 5:262-265
    Pubmed CrossRef
  47. Raubeson LA, Jansen RK (2005) Chloroplast genomes of plants, pp.45-68. In: H. Henry (ed.) Diversity and evolution of plants: genotypic and phenotypic variation in higher plants. CABI Publishing, Wallingford, UK
    CrossRef
  48. Rokka V-M, Tauriainen A, Pietilä L, Pehu E (1998) Interspecific somatic hybrids between wild potato Solanum acaule Bitt. and anther-derived dihaploid potato (Solanum tuberosum L.). Plant Cell Rep 18:82-88
    CrossRef
  49. Ross H (1986) Potato breeding-problems and perspectives. Verlag Paul Parey, Berlin and Hamburg, Germany
  50. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59:309-322
    Pubmed CrossRef
  51. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
    Pubmed KoreaMed CrossRef
  52. Smilde WD, Brigneti G, Jagger L, Perkins S, Jones JDG (2005) Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theor Appl Genet 110:252-258
    Pubmed CrossRef
  53. Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot Rev 80:283-383
    CrossRef
  54. Sugiura M, Hirose T, Sugita M (1998) Evolution and mechanism of translation in chloroplast. Annu Rev Genet 32:437-459
    Pubmed CrossRef
  55. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35: 1345-1358
    Pubmed KoreaMed CrossRef
  56. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30:2725-2729
    Pubmed KoreaMed CrossRef
  57. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S. (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45: W6-W11.
    Pubmed KoreaMed CrossRef
  58. Uncu AT, Celik I, Devran Z, Ozkaynak E, Frary A, Frary A, Doganlar S (2015) Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper. Euphytica 206:393-399
    CrossRef
  59. van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Klein-Lankhorst R, Stiekema W, Baulcombe D, Bakker J (1999) Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol Plant-Microb Interact 18:722-729
    CrossRef
  60. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30:1811-1821
    Pubmed CrossRef
  61. Watanabe KN, Orrillo M, Vega S, Masuelli R, Ishiki K (1994) Potato germplasm enhancement with disomic tetraploid Solanum acaule. II. Assessment of breeding value of tetraploid F1 hybrids between tetrasomic tetraploid S. tuberosum and S. acaule. Theor Appl Genet 88:135-140
    Pubmed CrossRef
  62. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688
    Pubmed CrossRef
  63. Yamada T, Hosaka K, Nakagawa K, Kaide N, Misoo S, Kamijima O (1998) Nuclear genome constitution and other characteristics of somatic hybrids between dihaploid Solanum acaule and tetraploid S. tuberosum. Euphytica 102:239-246
    CrossRef
  64. Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T, Kubo T, Kurata N and Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63:246-254
    Pubmed KoreaMed CrossRef
  65. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34:5-22
  66. Zoteeva N, Chrzanowska M, Pakosinska E, Zimnoch-Guzowska E (2000) Resistance to Phytophthora infestans and potato virus X (PVX) in wild potato species Solanum acaule Bitt. from the collection of NI Vavilov Research Institute of plant industry. Plant Breed Seed Sci 44:81-86

Article

Research Article

J Plant Biotechnol 2022; 49(3): 178-186

Published online September 30, 2022 https://doi.org/10.5010/JPB.2022.49.3.178

Copyright © The Korean Society of Plant Biotechnology.

Solanum acaule 색소체 유전자형 선발을 위한 특이적 분자마커 개발

박태호

대구대학교 원예학과

Received: 13 September 2022; Revised: 26 September 2022; Accepted: 26 September 2022

PCR-based markers to select plastid genotypes of Solanum acaule

Tae-Ho Park

(Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea)

Correspondence to:e-mail: thzoo@daegu.ac.kr

Received: 13 September 2022; Revised: 26 September 2022; Accepted: 26 September 2022

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

The tetraploid Solanum acaule is a wild potato species from Bolivia widely used for potato breeding because of its diverse attractive traits, including resistance to frost, late blight, potato virus X, potato virus Y, potato leafroll virus, potato spindle tuber viroid, and cyst nematode. However, the introgression of useful traits into cultivated potatoes via crossing has been limited by differences in endosperm balance number between species. Somatic fusion could be used to overcome sexual reproduction barriers and the development of molecular markers is essential to select proper fusion products. The chloroplast genome of S. acaule was sequenced using next-generation sequencing technology and specific markers for S. acaule were developed by comparing the obtained sequence with those of seven other Solanum species. The total length of the chloroplast genome is 155,570 bp, and 158 genes were annotated. Structure and gene content were very similar to other Solanum species and maximum likelihood phylogenetic analysis with 12 other species belonging to the Solanaceae family revealed that S. acaule is very closely related to other Solanum species. Sequence alignment with the chloroplast genome of seven other Solanum species revealed four InDels and 79 SNPs specific to S. acaule. Based on these InDel and SNP regions, one SCAR marker and one CAPS marker were developed to discriminate S. acaule from other Solanum species. These results will aid in exploring evolutionary aspects of Solanum species and accelerating potato breeding using S. acaule.

Keywords: cpDNA, InDels, PCR-based marker, Potato, SNPs, Solanum acaule

서 론

볼리비아에 자생하는 Solanum acaule는 감자(Solanum tuberosum L.)와 같이 괴경을 형성하는 4배체이며, 재배종 감자의 야생종 중의 하나이다(Bitter 1912; Dvořák 1983; Hawkes 1990). S. acaule는 Phytophthora infestans에 의해 유발되는 감자역병, 감자잎말림바이러스(PLRV), 감자바이러스X (PVX), 감자바이러스Y (PVY), Potato spindle tuber viroid (PSTV)에 의한 감자걀쭉병, 감자시스트선충 등과 같은 생물학적 요인 및 서리와 같은 비생물학적 요인에 대한 저항성을 가지고 있어 감자의 신품종 육성에 중요한 재료로 인식되고 있다(Chávez et al. 1988; Chen and Li 1980; Chen et al. 1977; Estrada 1980; Ross 1986; Watanabe et al. 1994; Zoteeva et al. 2000). 이러한 유용 형질을 재배종 감자에 도입하기 위해서는 전통적인 육종법인 교배를 통한 방법을 이용하는 것이 보편적이나 본 연구에 사용된 야생종인 S. acaule는 EBN (Endosperm Balanced Number)이 2로 재배종 감자의 EBN 4와의 차이로 인해 발생하는 생리적인 불화합성으로 직접적인 교배로 품종을 육성하는 것이 불가능하다(Cho et al. 1997; Hawkes 1990; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014). 따라서, 야생종과 재배종 감자의 원형질체를 분리하고 이를 융합하는 방법으로 종간의 생리적 장벽을 극복하는 방법이 이용될 수 있다(Bidani et al. 2007; Nouri-Ellouz et al. 2016). 이러한 체세포잡종의 육성은 S. acaule와 S. tuberosum 간에 성공적으로 이루어진 것을 포함하여(Rokka et al. 1998; Yamada et al. 1998), S. brevidens, S. commersonii, S. nigrum, S. phureja 등 다양한 야생종을 대상으로 재배종 감자와의 체세포융합이 이루어진 바가 있다(Barsby et al. 1984; Binding et al. 1982; Kim-Lee et al. 2005; Puite et al. 1986). 따라서, S. acaule를 이용한 체세포잡종을 육성하는 연구가 진행중에 있으며, 향후 체세포융합을 통한 체세포잡종을 확보하였을 때 재배종 감자 및 S. acaule의 핵내 혹은 세포질 DNA가 체세포잡종에 어떻게 전달이 되는지를 확인하기 위해, 본 연구에서는 그 중 엽록체 DNA의 구성을 확인할 수 있도록 엽록체 유전체 정보를 활용하여 S. acaule와 S. tuberosum을 구분할 수 있는 분자마커를 개발하고자 하였다.

엽록체의 유전체는 원형 이중가닥의 분자구조를 가지고 있으며, 속씨식물의 경우 약 115-165 kb의 크기로 두 개의 inverted repeats (IRs), 하나의 large single copy (LSC), 하나의 small single copy (SSC)를 포함하는 전형적인 4분할 구조로 되어 있다(Yurina and Odintosova 1998). Table 1에 제시한 바와 같이, 이미 감자뿐만 아니라 다양한 감자의 근연야생종을 대상으로 한 엽록체 유전체 연구가 진행되어 그 결과가 보고되었으며, Solanum 속에 포함되어 있는 이들 엽록체 유전체 모두가 앞서 알려진 바와 같이 크기, 유전자 구성, 구조 등이 매우 유사한 것으로 확인되었다(Palmer 1991; Raubeson and Jansen 2005; Saski et al. 2005; Sugiura et al. 1998). 그럼에도 불구하고 이러한 식물의 종간 엽록체 유전체 전체를 비교를 통해 InDel이나 SNP와 같은 영역을 확인할 수 있으며, 이는 많은 식물의 엽록체 유전체에서 유전자의 재배열이나 역위 등과 같은 염기서열에서의 구조적 변화에 의해 변이가 발생하기 때문이다(Calsa Junior et al. 2004; Cho et al. 2015; Jheng et al. 2012; Kim et al. 2005; Kim and Park 2019, 2020a, 2020b; Park 2021b, 2022; Saski et al. 2005). 이에 본 연구에서는 Park (2021a)이 보고한 S. acaule의 엽록체 전장유전체에 대한 세부 정보를 제공하고, 이 정보를 이용한 S. acaule 특이적 분자마커 개발의 결과를 제공하고자 한다.

Table 1 . Comparison of the chloroplast genome sequence of S. acaule with those of ten other Solanaceae species.

SpeciesAccession no.Total Length (bp)GC content (%)Total No. of genesNo. of tRNANo. of rRNAReference
S. acauleMK036506155,57037.84135364this study
S. brevicauleMK036507155,53137.87135364Park (2022)
S. demissumMK036508155,55837.87135364Cho et al. (2019)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

재료 및 방법

식물재료

S. acaule 특이적 분자마커 개발을 위해 엽록체 전장 유전체 분석에 이용된 S. acaule 계통 중 하나인 SA11 (Park 2021a)과 더불어 S. acaule 계통 하나 SA10이 추가되었으며, 재배종 감자 품종인 ‘서홍’(SH), ‘하령’(HR), 감자품종 육성을 위한 계통 PT56, 그리고 총 16개 계통의 야생종, SD (S. demissum, PI218047), SB2 (S. brevicaule, PI205394), SC4 (S. candolleanum, PI210035), SC1 (S. cardiophyllum, PI341233), SC2 (S. commersonii, PI558050), SH1 (S. hjertingii, PI186559), SH2 (S. hougasii, PI161174), SI (S. iopetalum, PI230459), SK (S. kurtzianum, PI578236), SJ (S. jamesii, PI578326), SM2 (S. microdontum, PI310979), SM1 (S. mochiquense, PI338616), SP(S. pinnatisectum, PI190115), SS (S. stoloniferum, PI160224), SV2 (S. vernei, PI230468), SV1 (S. verrucosum, PI160228)이 이용되었다. 모든 식물 재료는 국립식량과학원 고령지농업연구소로부터 분양받아 기내식물체로 유지, 증식되었다.

DNA 분리

모든 식물재료를 대상으로 기내에서 증식된 약 100 mg의 유식물체를 채취하여 Genomic DNA Extraction kit (Plants)(RBC, New Taipei City, Taiwan)를 이용하여 DNA를 추출하였다.

S. acaule 엽록체 전장유전체의 완성 및 분석

S. acaule의 전장 유전체 분석을 위해 S. acaule 계통 중 하나인 SA11의 전체 DNA를 추출하고 Macrogen (Macrogen, Seoul, South Korea)의 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA)의 플랫폼을 이용하여 전체 염기서열을 획득하였다. 이 전체 염기서열(raw data) 정보는 파이젠의 생물정보학 파이프라인(http://phyzen.com)의 de novo assembly에 의해 분석되어 조립되었다(Cho et al. 2015). 우선 CLC assembly cell package version 4.2.1 내의 CLC quality trim 프로그램을 이용하여 trimming 과정을 거처, high-quality (Phred score 20 이상) 염기서열 만을 추출하여 분석에 이용하였다. 확보된 염기서열은 CLC assembly cell package version 4.2.1 내의 CLC de novo assemble 프로그램을 이용한 dnaLCW 방법으로 조립하고, 그중 엽록체 유래의 contig 만을 선별하여 contig를 확장하고 통합한 후 gap-filling 함으로써 완전장 엽록체 유전체를 완성하였다. 완성된 엽록체 염기서열에 trimmed read를 mapping 하여 각 위치의 mapped read depth를 계산하였으며, 완성된 엽록체 유전체의 구조 및 염기서열을 레퍼런스 종과 비교하였다. BLASTN을 실시하고 homology가 높은 종 중 하나인 S. berthaultii의 엽록체 전장 유전체(KY419708, Kim et al. 2018; Park 2017)와 BLASTZ (Schwartz et al. 2003) 분석을 시행하였다.

완성된 S. acaule 엽록체 유전체 서열의 유전자 부위를 결정하기 위해 Geseq 프로그램을 통해 유전자 부위를 확인하였으며(Tillich et al. 2017), BLAST search를 기반으로 manual curation을 진행하여 최종 유전자 부위를 확인하였다. 확인된 엽록체 유전체의 유전자 부위는 OGDraw (Organellar GenomeDRAW; Lohse et al. 2013) 프로그램을 통해 원형의 유전자지도에 표시하였다.

엽록체 전장유전체의 비교 및 PCR 기반의 분자마커 개발

S. acaule의 계통발생학적 유연 관계는 S. acaule 엽록체 전장 유전체 염기서열과 NCBI (the National Center for Biotechnology Information)로부터 얻은 재배종 감자 S. tuberosum (KM489056 및 NC008096)을 포함하는 가지과 총 12종 S. berthaultii (KY419708), S. demissum (MK036508), S. hougasii (MF471372), S. stoloniferum (MF471373), S. brevicaule (MK036507), S. commersonii (KM489054), S. chacoense (MF471371), S. bulbocastanum (DQ347958), S. lycopersicum (NC007898), S. nigrum (KM489055), Capsicum annuum (JX270811) 엽록체 전장 유전체 염기서열에서 확인된 엽록체 코딩 서열을 기반으로 1,000번의 Bootstrap 옵션을 적용한 MEGA6.0 프로그램으로 분석되었다(Tamura et al. 2013). 여기에는 Kimura 2-parameter 모델을 적용한 Maximum likelihood 방법이 이용되었다.

S. acaule 특이적 분자마커 개발을 위해 S. acaule 엽록체 전장 유전체 염기서열은 NCBI로부터 얻은 S. brevicaule (MK036507), S. demissum (MK036508), S. tuberosum (KM489056), S. commersonii (KM489054), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. stolonioferum (MF471373)의 엽록체 전장 유전체 염기서열과 EMBL (http://www.ebi.ac.uk/Tools/ msa/clustalw2)의 ClustalW2에 의해 다중 정렬하여 염기서열을 비교 분석하여 S. acaule 특이적 영역대를 구명하였다. S. acaule를 포함한 총 8종의 엽록체 전장 유전체 염기서열을 대상으로 한 다중 정렬의 결과로 구명된 S. acaule 특이적 InDel 및 SNP를 대상으로 S. acaule 특이성 검증이 수행되었다. InDel의 경우에는 InDel이 있는 영역에서 primer를 디자인하여 allele 특이적 분자마커를 개발하고자 하였으며, SNP를 대상으로는 우선 dCAPS Finder 2.0 (http://helix.wustl.edu/ dcaps/dcaps.html)을 이용하여 S. acaule 특이적으로 작용하거나 S. acaule를 제외한 다른 Solanum 종들에 특이적으로 작용하는 제한효소를 확인한 후, SNP 영역을 포함하는 primer를 디자인하여, S. acaule와 S. tuberosum을 포함하여 총 21개의 유전자 계통, S. acaule (SA11 및 SA10), S. tuberosum (감자품종 ‘서홍(Seohong)’, ‘하령(Haryeong)’, 및 감자품종 육성계통 PT56), S. demissum (SD), S. brevicaule (SB2), S. candolleanum (SC4), S. cardiophyllum (SC1), S. commersonii (SC2), S. hjertingii (SH1), S. hougasii (SH2), S. iopetalum (SI), S. kurtzianum (SK), S. jamesii (SJ), S. microdontum (SM2), S. mochiquense (SM1), S. pinnatisectum (SP), S. stoloniferum (SS), S. vernei (SV2) and S. verrucosum (SV1)을 대상으로 총 25 ul 볼륨(약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany)를 이용하여 PCR을 수행하였다. PCR의 결과는 핵산 염색용액인 RedSafe (Intron Biotechnology, Seongnam, South Korea)를 이용하여 1% agarose gel에서 확인하였으며, PCR 결과물을 대상으로 제한효소를 처리한 후, 동일한 방법으로 agarose gel에서 확인하여 PCR 기반의 S. acaule 특이적 분자마커 개발을 진행하였다.

결과 및 고찰

감자 야생종 S. acaule의 엽록체 전장 유전체

S. acaule 엽록체 전장 유전체는 NGS (Next-Generation Sequencing) 기술에 의해 완성되었으며 Park (2021a)에 의해 보고된 바 있다. 이에 더해, S. acaule의 엽록체 전장 유전체를 완성한 과정과 그 결과를 세부적으로 기술하면, NGS 데이터 총 염기서열은 7,807,842 read를 통해 약 2.3 Gbp를 생산하였으며 평균 길이는 293.8 bp였다. 전체 염기서열에서 high-quality 서열을 얻기 위해 전체 read의 약 85.2%를 사용하여 CLC quality trim 프로그램을 이용하여 전처리 과정을 거치고 Phred score 20 이상을 추출하여 평균 길이 257.3 bp인 염기서열 정보 약 1.7 Gbp를 얻었다. 이는 전체 raw data의 약 74.6%로, 앞서 보고된 S. breviaule와 S. demission의 전장 유전체와 비교하였을 때 사용된 총 염기서열이 약 0.7-0.8 Gbp 적고, raw data 대비 최종 추출 염기서열의 비율 또한 약 3% 정도 적은 수준이나(Park 2021b, 2022), 이를 이용한 de novo assembly와 이후 엽록체 유래의 contig 선발과 확장 및 통합, 그리고 gap-filling 과정을 거쳐 완성된 엽록체 전장 유전체의 결과를 고려할 때, 총 염기서열은 155,570 bp (MK036506), aligned read 수는 약 55만 4천개, 엽록체 유전체 평균 coverage는 약 893.8x, 전체 trimmed read를 완성된 유전체 서열에 mapping하여 확인한 read depth는 최소 400 이상으로 크게 다르지 않은 결과를 보여주었다. 그 구조 또한 다른 식물의 엽록체 전장 유전체와 동일한 형태의 원형 이중가닥 분자로 86,020 bp의 LSC (Large Single Copy), 18,364 bp의 SSC (Small Single Copy), 그리고 한 쌍의 25,593 bp IRa/IRb (Inverted Repeat a/b)로 이루어져 있었으며, 보고된 S. berthaultii 엽록체 전장 유전체 염기서열(KY419708, Kim et al. 2018; Park 2017)과 비교와 BLASTZ 분석(Schwartz et al. 2003) 결과로도 그 유사성을 확인할 수 있었다(Fig. 1). S. acaule의 엽록체 전장 유전체 전체 염기서열을 NCBI에서 Blastn 분석을 한 결과 Solanum x juzepczukii (NC050208), S. megistacrolobum (MH021518)과 각각 99.90%, 99.89%의 높은 유사도를 보였으며, GC 비율도 37.84%로 거의 비슷하게 나타났다(Table 1).

Figure 1. Complete chloroplast genome assembly of S. acaule (MK036506). The four representative contigs for the chloroplast genome of S. acaule and the comparison with the corresponding regions of the S. berthaultii chloroplast genome (KY419708; Kim et al. 2018) are presented. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientation, respectively

S. acaule 엽록체 전장 유전체에는 총 158개의 유전자가 분포하고 있었는데, 여기에는 105개의 단백질 코딩, 45개의 tRNA, 8개의 rRNA를 포함하고 있으며, 이중 11개의 단백질 코딩 유전자, 9개의 tRNA, 4개의 rRNA가 한 쌍의 IR영역 IRa 및 IRb 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 59.2%가 코딩 영역으로 158개의 유전자 평균 길이가 약 583.1 bp로, 이 중 단백질 코딩 유전자, tRNA, rRNA가 각각 평균 764.6 bp, 62.3 bp, 1130.8 bp의 크기로 51.6%, 1.8%, 5.8%의 비율로 분포되어 있었으며, Solanum 속의 다른 종들과 비교해 보면 유전자, tRNA, rRNA 등의 개수, 순서 등이 모두 유사한 것으로 나타났다(Table 1)(Cho et al. 2016, 2019; Cho and Park 2016; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021b, 2022).

Figure 2. Gene map of the S. acaule chloroplast genome. Genes on the outside and inside of the map are transcribed in the clockwise and counterclockwise directions, respectively

엽록체 전장유전체 비교 및 계통수

S. acaule의 엽록체 전장 유전체와 가지과에 속하는 다른 12종의 엽록체 전장 유전체의 코딩 서열을 비교하여 계통수를 작성하였다(Fig. 3). S. acaule는 계통수에서 재배종 감자인 S. tuberosum을 포함하는 다수의 가지속에 포함되어 있는 종들과 매우 근접하여 같은 그룹에 위치해 있음을 확인하였으며, 고추(Capsicum annuum), 까마중(S. nigrum), 토마토(S. lycopersicum)와는 상대적으로 유연관계가 먼 것을 확인하였다. 또한, S. acaule의 엽록체 전장 유전체 전체 염기서열을 재배종 감자와 6종의 감자 근연야생종의 엽록체 전장 유전체 전체 염기서열을 EMBL의 ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 다중 정렬을 수행한 결과 S. acaule 특이적 분자마커 개발이 가능한 다수의 S. acaule 특이적 InDel과 SNP 영역을 확인할 수 있었다(Fig. 4). 이는 앞서 보고된 것과 같이, 가지속에 속한 다수의 감자 근연야생종들의 엽록체 전장 유전체가 동일한 구조와 크기 및 높은 염기서열의 유사성에도 불구하고, 다양한 유전적 요인에 의한 변이로 특정 근연야생종 특이적인 InDel과 SNP가 존재하는 것으로 확인된 것이다(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021b, 2022). 결과적으로, S. acaule를 포함한 총 8종의 비교를 통해 S. acaule 특이적인 InDel과 SNP 영역은 각각 4와 79개였으며, 앞서 보고된 바와 유사하게 4개의 InDel은 모두 유전자간 영역에 분포하고 있었으며, SNP의 경우 79개 중 49개는 유전자간 영역에 그리고 30개는 유전자 영역에 분포하고 있었다.

Figure 3. Maximum likelihood phylogenetic tree of S. acaule with 12 species belonging to the Solanaceae family, based on chloroplast protein-coding sequences. The numbers on each node indicate the bootstrap values from 1,000 replicates. The figure has been partially adopted from Park (2021)

Figure 4. Multiple alignment of the sequences containing InDel and SNP used to develop the PCR-based markers. Sequences of S. acaule (SA11; MK036506; this study), S. brevicaule (SB2-1; MK036507; Park 2022), S. demissum (SD9; MK036508; Cho et al. 2019), S. tuberosum (Stub; KM489056; Cho et al. 2016), S. commersonii (Scmr; KM489054; Cho et al. 2016), S. bulbocastanum (Sblb; DQ347958; Daniell et al. 2006), S. chacoense (Scha MF471371; Kim and Park 2019), and S. stoloniferum (Ssto; MF471373; Kim and Park 2020a) were used and listed from top to bottom for each InDel and SNP region. The InDel and SNP regions detected on the S. acaule regions are highlighted and underlined, and the restriction site is indicated by red color and bold text

S. acaule 특이적 분자마커 개발

S. acaule를 포함하여 감자와 근연야생종 총 8종의 엽록체 전장 유전체 전체 염기서열의 다중 정렬로 확인한 S. acaule 특이적 InDel과 SNP는 S. acaule 특이적인 분자마커 개발을 위해 활용되었다. InDel 영역을 활용하는 경우 InDel 영역에서 특이적인 primer를 제작하여 PCR을 통해 InDel 영역의 염기서열 차이로 나타나는 다형성의 차이로 S. acaule 특이적인 하나의 SCAR (Sequence Characterized Amplified Region) 마커의 개발이 가능하였다(Cho et al. 2015; Garcia-Lor et al. 2013; Yamaki et al. 2013)(Table 2, Fig. 5A). 나머지 3개의 InDel 영역에서도 PCR 기반의 분자마커의 개발을 시도하였으나, InDel의 크기가 InDel 특이적인 PCR 결과를 얻기에는 다소 작고 InDel 영역과 인근 영역에서의 반복서열의 존재로 인해 SCAR 마커 개발에 어려움이 있었다(Kim and Park 2020b). SNP 영역의 경우에는 총 79개 영역 중 일부를 대상으로 S. acaule 특이적 SNP를 대상으로 적용가능 한 제한효소의 유무를 확인한 후 SNP 영역을 포함하여 PCR 결과를 얻을 수 있도록 primer를 제작하고 PCR의 결과로 얻은 DNA 단편에 제한효소를 처리하여 하나의 S. acaule 특이적인 CAPS (Cleaved Amplified Polymorphism Sequence; Konieczny and Ausubel 1993) 마커를 얻을 수 있었다(Table 2, Fig. 5B). 이러한 CAPS 마커는 같은 종 내에서의 유전자형을 구분하거나 종간 특이적으로 작용하여 선발에 활용되는 등 다양한 작물들을 대상으로 활용되고 있다(Caranta et al. 1999; Konovalov et al. 2005; Lee et al. 2008; Pettenkofer et al. 2020; Smilde et al. 2005; Uncu et al. 2015; van der Voort et al. 1999). 결과적으로 본 연구에서는 최종 InDel 및 SNP 기반의 S. acaule 특이적인 PCR 기반의 분자마커를 각각 하나씩 개발하였으며, InDel 기반의 분자마커 SA_InDel_3 (Fig. 4, Fig. 5A)은 trnG와 rnfM 유전자 사이에 존재하는 SCAR 마커로 개발되었으며, SNP 기반의 분자마커 SA_SNP_7 (Fig. 4, Fig. 5B)은 ccsA 유전자 내에 존재하는 SNP가 제한효소 HaeIII에 의해 S. acaule 만은 특이적으로 절단하여 S. acaule 특이적인 CAPS 마커로 개발되었다.

Table 2 . Information on primers and restriction enzymes used to generate S. acaule specific markers.

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SA_InDel_3trnG-rnfM(Intergenic)FTCAATGGATTCATGATAAAG742as
RTTTATGAAATTCAATAATAAAGC
SA_SNP_7ccsA(Intragenic)FATTTCCTTTTCGATCGTTTC588HaeIII
RTTGAATCAATTGGGACCTG

aF and R indicate forward and reverse strand of primers..

bThe expected sizes of PCR fragments are measured based on the sequence of S. acaule..

cRestriction enzyme generating S. acaule-specific marker. ‘as’ indicates allele-specific marker..

Figure 5. PCR-based markers that discriminate S. acaule from other Solanum species. A: SA_InDel_3. B: SA_SNP_7. The two markers are all positively specific to S. acaule. SA11 and SA10 indicate two different lines of S. acaule (PI310970). M, SH, HR, PT56, SD, SB2, SC4, SC1, SC2, SH1, SH2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate size marker ladders, potato varieties ‘Seohong’, ‘Haryeong’, a potato breeding line ‘PT56’, S. demissum (PI218047), S. brevicaule (PI205394), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. hjertingii (PI186559), S. hougasii (PI161174), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S. microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively

핵 내의 염색체 DNA를 대상으로 한 분자마커의 개발뿐만 아니라 엽록체의 전장유전체의 염기서열을 구명하고 엽록체 DNA를 대상으로 유전자형을 구분할 수 있는 종 특이적인 분자마커를 개발하는 것은 감자 신품종 육성에 기여할 수 있으며, 또한 유사 종의 식물들 간에 진화학적 연구에도 기여할 수 있다(Bohs and Olmstead 1997; Hosaka and Sanetomo 2012). 특히, 감자의 경우 신품종 육성에서 다양한 근연야생종의 유용형질을 감자에 도입하고자 하는 노력이 지속적으로 이루어지고 있으나, 배수성과 EBN의 차이로 인한 교배육종이 정상적으로 이루어지지 않는 여건에서 원형질체를 이용한 체세포융합에 의한 체세포잡종을 육성하고 이를 신품종 육성에 활용하고 있어, 이 과정에서 잡종의 유전자형을 확인하는 작업이 반드시 필요하다. 앞서 보고된 연구결과에 의하면, Solanum 속에 포함된 종들을 포함한 다양한 식물종에서 체세포융합과 기내 식물체 재분화 과정에서 한 쪽의 엽록체 유전체가 무작위로 배분되고 미토콘드리아 유전체의 경우 높은 빈도로 재조합이 발생하는 것으로 알려져 있다(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Xiang et al. 2004). 하지만, 엽록체 유전체의 경우에도 양친의 유전체가 모두 전달되는 경우도 있는 것으로 알려져 있어 유전자형을 확인하는 과정이 필요하다(Wang et al. 2011). 따라서, 본 연구에서 개발된 InDel 기반의 SCAR 마커 및 SNP 기반의 CAPS 마커는 S. acaule를 이용하여 체세포융합을 통한 체세포잡종을 육성하여 감자의 신품종을 육성 과정에서 S. acaule와 S. tuberosum 유래의 유전자형을 구별하는데 이용되어 S. acaule를 이용한 감자의 신품종 육성에 기여할 것이다.

적 요

볼리비아 유래의 4배체 감자 야생종 중 하나인 Solanum acaule는 서리, 감자역병, 감자바이러스X, 감자바이러스Y, 감자잎말림바이러스, 감자걀쭉병, 선충 등에 대한 저항성과 같이 감자의 신품종 육성에 매우 유용한 형질들을 가지고 있어 감자 육종에 많이 이용되고 있다. 그러나 이러한 유용 형질들을 재배종 감자에 전통적인 교잡에 의해 도입하는 것은 야생종과 재배종 간의 서로 다른 EBN에 따라 매우 제한적이다. 따라서, 이러한 생리적 장벽을 극복하기 위해서는 체세포융합을 이용할 수 있는데, 육종에 활용할 적절한 체세포융합체를 선발하기 위해서는 적절한 분자마커의 개발이 필수적이다. 이에, 본 연구에서는 앞서 차세대 유전체 기술에 의해 완성되어 보고된 S. acaule의 엽록체 전장 유전체 정보를 기반으로 이를 다른 8개의 Solanum 종의 엽록체 전장 유전체 정보와 비교를 통해 S. acaule 특이적인 분자마커를 개발하였다. S. acaule의 엽록체 전장 유전체 총 길이는 155,570 bp였으며, 총 158개의 유전자로 구성되어 있었다. 전체적인 구조와 유전자의 구성은 다른 Solanum 종들과 매우 유사하였고 12종의 다른 가지과에 속해 있는 종과의 계통수 분석에서 다른 Solanum 종과 매우 가까운 유연관계를 가지는 것을 확인하였다. S. acaule의 엽록체 전장 유전체와 다른 7개 Solanum 종의 엽록체 전장 유전체 다중 정렬의 결과로 각각 4개와 79개의 S. acaule 특이적인 InDel 및 SNP 영역이 확인되었으며, 이 정보를 이용하여 각각 1개씩의 InDel 및 SNP 영역 유래의 PCR 기반의 분자마커를 개발하였다. 본 연구의 결과는 S. acaule의 진화적 측면에서의 연구와 S. acaule를 이용한 감자품종 육성 연구에 기여를 할 수 있을 것이다.

사 사

이 성과는 정부(과학기술정보통신부)의 재원으로 한국연구재단의 지원을 받아 수행된 연구임(No. NRF-2021R1F1A1 045981).

Fig 1.

Download
Figure 1.Complete chloroplast genome assembly of S. acaule (MK036506). The four representative contigs for the chloroplast genome of S. acaule and the comparison with the corresponding regions of the S. berthaultii chloroplast genome (KY419708; Kim et al. 2018) are presented. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientation, respectively
Journal of Plant Biotechnology 2022; 49: 178-186https://doi.org/10.5010/JPB.2022.49.3.178

Fig 2.

Download
Figure 2.Gene map of the S. acaule chloroplast genome. Genes on the outside and inside of the map are transcribed in the clockwise and counterclockwise directions, respectively
Journal of Plant Biotechnology 2022; 49: 178-186https://doi.org/10.5010/JPB.2022.49.3.178

Fig 3.

Download
Figure 3.Maximum likelihood phylogenetic tree of S. acaule with 12 species belonging to the Solanaceae family, based on chloroplast protein-coding sequences. The numbers on each node indicate the bootstrap values from 1,000 replicates. The figure has been partially adopted from Park (2021)
Journal of Plant Biotechnology 2022; 49: 178-186https://doi.org/10.5010/JPB.2022.49.3.178

Fig 4.

Download
Figure 4.Multiple alignment of the sequences containing InDel and SNP used to develop the PCR-based markers. Sequences of S. acaule (SA11; MK036506; this study), S. brevicaule (SB2-1; MK036507; Park 2022), S. demissum (SD9; MK036508; Cho et al. 2019), S. tuberosum (Stub; KM489056; Cho et al. 2016), S. commersonii (Scmr; KM489054; Cho et al. 2016), S. bulbocastanum (Sblb; DQ347958; Daniell et al. 2006), S. chacoense (Scha MF471371; Kim and Park 2019), and S. stoloniferum (Ssto; MF471373; Kim and Park 2020a) were used and listed from top to bottom for each InDel and SNP region. The InDel and SNP regions detected on the S. acaule regions are highlighted and underlined, and the restriction site is indicated by red color and bold text
Journal of Plant Biotechnology 2022; 49: 178-186https://doi.org/10.5010/JPB.2022.49.3.178

Fig 5.

Download
Figure 5.PCR-based markers that discriminate S. acaule from other Solanum species. A: SA_InDel_3. B: SA_SNP_7. The two markers are all positively specific to S. acaule. SA11 and SA10 indicate two different lines of S. acaule (PI310970). M, SH, HR, PT56, SD, SB2, SC4, SC1, SC2, SH1, SH2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate size marker ladders, potato varieties ‘Seohong’, ‘Haryeong’, a potato breeding line ‘PT56’, S. demissum (PI218047), S. brevicaule (PI205394), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. hjertingii (PI186559), S. hougasii (PI161174), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S. microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively
Journal of Plant Biotechnology 2022; 49: 178-186https://doi.org/10.5010/JPB.2022.49.3.178

Table 1 . Comparison of the chloroplast genome sequence of S. acaule with those of ten other Solanaceae species.

SpeciesAccession no.Total Length (bp)GC content (%)Total No. of genesNo. of tRNANo. of rRNAReference
S. acauleMK036506155,57037.84135364this study
S. brevicauleMK036507155,53137.87135364Park (2022)
S. demissumMK036508155,55837.87135364Cho et al. (2019)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

Table 2 . Information on primers and restriction enzymes used to generate S. acaule specific markers.

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SA_InDel_3trnG-rnfM(Intergenic)FTCAATGGATTCATGATAAAG742as
RTTTATGAAATTCAATAATAAAGC
SA_SNP_7ccsA(Intragenic)FATTTCCTTTTCGATCGTTTC588HaeIII
RTTGAATCAATTGGGACCTG

aF and R indicate forward and reverse strand of primers..

bThe expected sizes of PCR fragments are measured based on the sequence of S. acaule..

cRestriction enzyme generating S. acaule-specific marker. ‘as’ indicates allele-specific marker..

References

  1. Barsby TL, Shepard JF, Kemble RJ, Wong R (1984) Somatic hybridization in the genus Solanum: S. tuberosum and S. brevidens. Plant Cell Rep 3:165-167
    Pubmed CrossRef
  2. Bidani A, Nouri-Ellouz O, Lakhoua L, Shihachakr D, Cheniclet C, Mahjoub A, Drira N, Gargouri-Bouzid R (2007) Interspecific potato somatic hybrids between Solanum berthaultii and Solanum tubersoum L. showed recombinant plastome and improved tolerance to salinity. Plant Cell Tiss Organ Cult 91:179-189
    CrossRef
  3. Binding H, Jain SM, Finger J, Mordhorst G, Nehls R, Gressel J (1982) Somatic hybridization of an atrazine resistant biotype of Solanum nigrum with Solanum tuberosum. Theor Appl Genet 63:273-277
    Pubmed CrossRef
  4. Bitter G (1912) Solana nova vel minus cogita. Feddes Repert 11:1-393
    CrossRef
  5. Bohs L, Olmstead RG (1997) Phylogenetic relationships in Solanum (Solanaceae) based on ndhF sequences. Syst Bot 22:5-17
    CrossRef
  6. Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46:366-373
    Pubmed CrossRef
  7. Caranta C, Thabuis A, Palloix A (1999) Development of a CAPS marker for the Pvr4 locus: A tool for pyramiding potyvirus resistance genes in pepper. Genome 42:1111-1116
    Pubmed CrossRef
  8. Chávez R, Brown CR, Iwanaga M (1988) Transfer of resistance to PLRV titer buildup from Solanum etuberosum to a tuber- bearing Solanum gene pool. Theor Appl Genet 76:129-135
    Pubmed CrossRef
  9. Chen HH, Li PH (1980) Characteristics of cold acclimation and deacclimation in tuber-bearing Solanum species. Plant Physiol 65:1146-1148
    Pubmed KoreaMed CrossRef
  10. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
    Pubmed CrossRef
  11. Chen P, Li PH, Cunningham P (1977) Ultrastructural differences in leaf cells of some Solanum species in relation to their frost resistance. Bot Gaz 138:276-285
    CrossRef
  12. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29:154-161
  13. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
    Pubmed CrossRef
  14. Cho K-S, Cho J-H, Park Y-E, Park T-H (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4:1800-1802
    CrossRef
  15. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57: 69-78
    CrossRef
  16. Cho K-S, Yun B-K, Yoon Y-H, Hong S-Y, Mekapogu M, Kim K-H, Yang T-J (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
    Pubmed KoreaMed CrossRef
  17. Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25:1369-1379
    Pubmed CrossRef
  18. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112:1503-1518
    Pubmed CrossRef
  19. Dvořák J (1983) Evidence for genetic suppression of heterogenetic chromosome pairing in polyploidy species of Solanum, sect. Petota. Can J Genet Cytol. 25:530-539
    CrossRef
  20. Estrada RN (1980) Frost resistance potato hybrids via Solanum acaule, Bitt. dipolid-tetraploid crosses. Amer Potato J 57: 609-619
    CrossRef
  21. Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L and Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111:1-19
    Pubmed KoreaMed CrossRef
  22. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop, p.107.
  23. Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. Belhaven Press, London, UK
  24. Hosaka K, Sanetomo R (2012) Development of a rapid identification method for potato cytoplasm and its use for evaluating Japanese collections. Theor Appl Genet 125:1237-1251
    Pubmed CrossRef
  25. Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C (2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids. Plant Sci 190:62-73
    Pubmed CrossRef
  26. Kim KJ, Choi KS, Jansen RK (2005) Two chloroplast DNA inversion originated simultaneously during the early evolution of the sunflower family (Asteraceae). Mol Biol Evol 22: 1783-1792
    Pubmed CrossRef
  27. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
    CrossRef
  28. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46:79-87
    CrossRef
  29. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140
    CrossRef
  30. Kim S, Park T-H (2020b) Development of Solanum hougasii- specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47: 141-149
    CrossRef
  31. Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM (2005) Bacterial wilt resistance in the progenies of the fusion hybrids between haploid of potato and Solanum commersonii. Amer J Potato Res 82:129-137
    CrossRef
  32. Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4:403-410
    Pubmed CrossRef
  33. Konovalov F, Toshchakova E, Gostimsky S (2005) A CAPS marker set for mapping in linkage group III of pea (Pisum sativum L.) Cell Mol Biol Lett 10:163-171
  34. Lee J, Yoon JB, Park HG (2008) A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol Breeding 21:95-104
    CrossRef
  35. Lohse M, Drechsel O, Kahlau S, Bock R (2013) Organellar GenomeDRAW - a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41:W575-W581
    Pubmed KoreaMed CrossRef
  36. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116:221-230
    CrossRef
  37. Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17:814-818
    Pubmed CrossRef
  38. Nouri-Ellouz O, Triki MA, Jbir-Koubaa R, Louhichi A, Charfeddine S, Drira N, Gargouri-Bouzid R (2016) Somatic hybrids between potato and S. berthaultii show partial resistance to soil-borne fungi and potato virus Y. J Phythpathol 164:485-496
    CrossRef
  39. Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60:105-113
    CrossRef
  40. Palmer JD (1991) Plastid chromosomes: structure and evolution, p. 5-53. In: L. Bogorad, K. Vasil (eds.) The molecular biology of plastids. Academic Press, San Diego, USA.
    KoreaMed CrossRef
  41. Park T-H (2017) The complete chloroplast genome of Solanum berthaultii, one of the potato wild relative species. Mitochondr DNA Part B 2:88-89
    Pubmed KoreaMed CrossRef
  42. Park T-H (2021a) Complete chloroplast genome sequence of the wild diploid potato relative, Solanum acaule. Mitochondr DNA Part B 6:1189-1191
    Pubmed KoreaMed CrossRef
  43. Park T-H (2021b) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48:18-25
    CrossRef
  44. Park T-H (2022) Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 49:30-38
    CrossRef
  45. Pettenkofer T, Finkeldey R, Müller M, Krutovsky KV, Vornam B, Leinemann L, Gailing O (2020) Development of novel Quercus rubra chloroplast genome CAPS markers for haplotype indentification. Silvae Genetica 69:78-85
    CrossRef
  46. Puite KJ, Roest S, Pijnacker LP (1986) Somatic hybrid potato plants after electrofusion of diploid Solanum tuberosum and Solanum phureja. Plant Cell Rep 5:262-265
    Pubmed CrossRef
  47. Raubeson LA, Jansen RK (2005) Chloroplast genomes of plants, pp.45-68. In: H. Henry (ed.) Diversity and evolution of plants: genotypic and phenotypic variation in higher plants. CABI Publishing, Wallingford, UK
    CrossRef
  48. Rokka V-M, Tauriainen A, Pietilä L, Pehu E (1998) Interspecific somatic hybrids between wild potato Solanum acaule Bitt. and anther-derived dihaploid potato (Solanum tuberosum L.). Plant Cell Rep 18:82-88
    CrossRef
  49. Ross H (1986) Potato breeding-problems and perspectives. Verlag Paul Parey, Berlin and Hamburg, Germany
  50. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59:309-322
    Pubmed CrossRef
  51. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
    Pubmed KoreaMed CrossRef
  52. Smilde WD, Brigneti G, Jagger L, Perkins S, Jones JDG (2005) Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theor Appl Genet 110:252-258
    Pubmed CrossRef
  53. Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot Rev 80:283-383
    CrossRef
  54. Sugiura M, Hirose T, Sugita M (1998) Evolution and mechanism of translation in chloroplast. Annu Rev Genet 32:437-459
    Pubmed CrossRef
  55. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35: 1345-1358
    Pubmed KoreaMed CrossRef
  56. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30:2725-2729
    Pubmed KoreaMed CrossRef
  57. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S. (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45: W6-W11.
    Pubmed KoreaMed CrossRef
  58. Uncu AT, Celik I, Devran Z, Ozkaynak E, Frary A, Frary A, Doganlar S (2015) Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper. Euphytica 206:393-399
    CrossRef
  59. van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Klein-Lankhorst R, Stiekema W, Baulcombe D, Bakker J (1999) Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol Plant-Microb Interact 18:722-729
    CrossRef
  60. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30:1811-1821
    Pubmed CrossRef
  61. Watanabe KN, Orrillo M, Vega S, Masuelli R, Ishiki K (1994) Potato germplasm enhancement with disomic tetraploid Solanum acaule. II. Assessment of breeding value of tetraploid F1 hybrids between tetrasomic tetraploid S. tuberosum and S. acaule. Theor Appl Genet 88:135-140
    Pubmed CrossRef
  62. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688
    Pubmed CrossRef
  63. Yamada T, Hosaka K, Nakagawa K, Kaide N, Misoo S, Kamijima O (1998) Nuclear genome constitution and other characteristics of somatic hybrids between dihaploid Solanum acaule and tetraploid S. tuberosum. Euphytica 102:239-246
    CrossRef
  64. Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T, Kubo T, Kurata N and Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63:246-254
    Pubmed KoreaMed CrossRef
  65. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34:5-22
  66. Zoteeva N, Chrzanowska M, Pakosinska E, Zimnoch-Guzowska E (2000) Resistance to Phytophthora infestans and potato virus X (PVX) in wild potato species Solanum acaule Bitt. from the collection of NI Vavilov Research Institute of plant industry. Plant Breed Seed Sci 44:81-86
JPB
Vol 51. 2024
Current Issue Archives

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download