Research Article

Split Viewer

J Plant Biotechnol 2016; 43(2): 204-212

Published online June 30, 2016

https://doi.org/10.5010/JPB.2016.43.2.204

© The Korean Society of Plant Biotechnology

영하의 저온에 노출된 ‘Campbell Early’와 ‘Muscat Bailey A’ 포도나무 신초의 전사체 비교

김선애, 윤해근*

영남대학교 원예생명과학과

Received: 16 March 2016; Revised: 4 April 2016; Accepted: 4 April 2016

Transcriptomic analysis of ‘Campbell Early’ and ‘Muscat Bailey A’ grapevine shoots exposed to freezing cold stress

Seon Ae Kim, and Hae Keun Yun*

Department of Horticulture and Life Science, Yeungnam University, Gyeongsan 38541, Korea

Correspondence to : e-mail: haekeun@ynu.ac.kr

Received: 16 March 2016; Revised: 4 April 2016; Accepted: 4 April 2016

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

To understand the responses of grapevines in response to cold stress causing the limited growth and development, differentially expressed genes (DEGs) were screened through transcriptome analysis of shoots from 2 grapevine cultivars (‘Campbell Early’ and ‘Muscat Baily A’) kept at -2°C for 4 days. In gene ontology analysis of DEGs from ‘Campbell Early’, there were 17,424 clones related with biological process, 28,954 with cellular component, and 6,972 with molecular function genes in response to freezing temperature. The major induced genes included dehydrin xero 1, K-box region and MADS-box transcription factor family protein, and MYB domain protein 36, and inhibited genes included light-harvesting chlorophyll B-binding protein 3, FASCICLIN-like arabinoogalactan 9, and pectin methylesterase 61 in ‘Campbell Early’ grapevines. In gene ontology analysis of DEGs from ‘Muscat Baily A’, there were 1,157 clones related with biological process, 1,350 with cellular component, and 431 with molecular function gene. The major induced genes of ‘Muscat Baily A’ included NB-ARC domain-containing disease resistance protein, fatty acid hydrozylase superfamily, and isopentenyltransferase 3, and inhibited genes included binding, IAP-like protein 1, and pentatricopeptide repeat superfamily protein. All major DEGs were shown to be expressed differentially by freezing temperature in real time-PCR analysis. Protein domain analysis using InterPro Scan revealed that ubiquitin-protein ligase was redundant in both tested grapevines. Transcriptome profile of shoots exposed to cold can provide new insights into the molecular basis of tolerance to low-temperature in grapevines, and can be used as resources for development new grapevines tolerant to coldness.

Keywords Differentially expressed genes, Gene expression, Gene ontology, Tolerance to cold

저온은 중요한 환경스트레스 중 하나로 지구상에서 식물의 생육과정에서 발육을 저해 위험요소이다. 식물이 저온 스트레스를 받게 되면 조직의 괴사, 백화 현상, 발아율 저하 및 잎의 시듦 등을 초래하여 직접적인 악영향을 끼친다(Sanghera et al. 2011). 세계적으로도 많이 생산하는 과수 중의 하나인 포도나무가 저온에 노출되면 생육과 광합성이 감소하고, 심각한 문제와 고사에 이를 수 있다(Fuller and Telli 1999; Mahajan and Tuteja 2005).

저온 및 냉해저항성과 같은 유용한 특성을 지닌 유전자들에 의해 조절되는 유전자를 활용하여 넓은 범위의 온도에 적응할 수 있는 포도의 육종프로그램에 이용할 수 있을 것이다(Hemstad and Luby 2000; Luby et al. 2003). 저온에 대한 포도나무의 생리, 생화학적 반응을 분석한 결과, 내한성이 강한 포도 품종이 감수성 품종에 저온스트레스에 대해 높은 반응활성을 나타내는 것으로 보고되었다(Kim et al. 2013; Ma et al. 2010). 저온에 의한 스트레스와 관련된 유전자조절은 밀, 보리, 호밀, 수세미 등과 같은 다양한 온대작물에서 보고되어 있다(Chiang et al. 2014; Chinnusamy et al. 2007). 애기장대가 복잡한 환경조건에 적응하는 기작을 분자생물학 수준에서 이해함으로써 최근의 식물학에서 활용이 가능한 유용 유전자를 선발하고 그 특성을 구명하게 되었다(Alonso-Blanco and Koornneef 2000).

차세대염기서열분석(next generation sequencing, NGS) 기술은 최근에 짧은 기간 동안 염기서열의 대량분석을 통한 생물체의 유전체와 전사체의 연구에 매우 큰 발전을 가져왔다(Huang et al. 2012; Hur et al. 2015; Xu 2014). 포도나무에서도 노균병(Wu et al. 2010), 수분 및 염분 스트레스(Cramer et al. 2007), 고온(Liu et al. 2012) 등 생물적 또는 비생물적 스트레스와 관련하여 다양한 전사체 분석연구가 수행되었다.

최근 저온 스트레스와 관련하여 애기장대(Barah et al. 2013), 꽃다지종(Zhou et al. 2009), 벼(Cho et al. 2012) 및 배추(Lee et al. 2015) 등의 식물체에서 발현 유전자 네트워크 분석, 전사인자 분석을 바탕으로 저온 저항성 관련 유전자 발굴 및 발현기작의 분석 등의 연구가 이루어지고 있다. 또한 Vitis amurensisV. vinifera에 속하는 두 종류의 포도나무를 대상으로 저온(4°C)에 반응하여 발현된 유전체를 분석하였다(Xin et al. 2013). Microarray분석을 통해 냉해(-5°C)에 노출된 유럽종 포도품종인 ‘Cabernet Sauvignon’ 수체 신초 선단의 유전자 발현의 변화를 비교한 연구에서 칼슘신호전달과 관련된 유전자의 발현이 크게 변화한다고 보고되었다(Tattersall et al. 2007).

근대적인 기상관측이 시작된 1904년부터 2000년까지 우리나라는 약 100년동안 평균기온이 약 1.5°C 상승하는 온난화 추세를 보였으며(Kwon et al. 2007), 지구온난화로 인해 온대과수의 저온요구도를 충족시키지 못해 수확량 감소를 유발할 수 있다는 주장이 제기되었다(Luedeling et al. 2011). 그러나 최근의 기후변화는 기온의 상승뿐만 아니라 태풍, 폭설, 강풍, 폭우와 같은 이상기상의 발생을 야기시켜 농작물에 직접적인 피해뿐만 아니라 시설재배 농가의 피해를 증가시키고 있다(Yoon et al. 2013). 또한 봄철의 잦은 강우와 갑작스런 기온 하강은 개화기에 수분 수정에 영향을 주어 착과율을 떨어뜨리고, 겨울철의 극저온으로 인해 빈번한 동해의 발생으로 과수 식물체의 발육불량을 유발하게 한다(Seo and Park 2003).

따라서 본 연구는 ‘Campbell Early’와 ‘Muscat Baily A’를 대상으로 영하의 저온처리에 따른 유전자들의 발현양상을 전사체 수준에서 분석하고 저온 스트레스에 대한 반응 기작을 이해함으로써 최근의 기후변화로 인해 나타나는 저온 장해를 극복할 수 있는 방안을 분자생물학적 수준에서 모색하고 내한성 포도 품종육성에 필요한 기초 자료로 제공하고자 수행하였다.

식물재료 및 온도처리

영남대학교 부속농장 유리온실에서 재배하던 ‘Campbell Early’와 ‘Muscat Baily A’ 포도 품종의 포트묘를 이용하여 본 연구를 수행하였다. 광이 주야 16:8시간으로 조사되는 -2°C의 생장상에서 포도나무를 유지한 후 4일이 경과한 식물체의 잎을 채취하여 액체질소에서 동결시킨 후 -80°C에서 보관하면서 이후의 실험에 사용하였다. 대조식물체로는 저온에 처리하기 전의 식물체로부터 잎을 채취하여 사용하였다.

RNA추출 및 cDNA합성

액체질소로 동결시킨 포도나무 잎을 Chang et al. (1993)의 방법을 일부 변형하여 RNA를 분리하였다. 분리한 RNA는 Nano Drop spectrophotometer(ND-1000, Technologies Inc., USA)를 이용하여 농도를 측정하고, 1% agarose gel에서 전기영동하여 확인하였다. 분리한 RNA(500ng/?L)로부터 PrimeScript™ 1st strand cDNA synthesis kit(TaKaRa Bio Inc., Japan)를 이용하여 cDNA를 합성하고 real-time PCR 반응을 위한 주형으로 사용하였다.

전사체 분석

cDNA library는 TruSeq SBS v5 protocol을 이용하여 제작하였고, Illumina HiSeq 2000 (Illumina, San Diego, CA)을 이용하여 sequencing paired-end reads를 생성하였다. Sequence는 국립농업생명공학정보센터(NABIC, 농촌진흥청) 데이터베이스(NN-1749-000001, NN-1753-000001, NN-1754-000001 and NN-1755-000001)에 등록하였다. SolexaQA package를 이용하여 Short read base의 quality가 20미만인 sequence와 read length가 25 bp 이하인 read는 제거하였다(Cox et al. 2010).

유전자 발현은 short read수, 특이발현유전자(differentially expressed genes, DEGs), clustering, annotation을 이용하여 분석하였다. DEG 추출은 DESeq Bioconductor package (version 1.6.0)(Anders and Huber 2010)를 이용하였고, 2-fold change방법과 q-value (FDR, false discovery rate) 유의수준 0.01이하의 Benjamini-Hochberg multiple test방법을 사용하였다. Pearson’s correlation hierarchical clustering을 이용하여 유전자 발현 패턴을 분석하였다. 발현된 유전자는 V. viniferaArabidopsis에 대해 각각 BLASTN과 BLASTX를 이용하여 annotation하였다. DEG와 clustering분석에 사용된 유전자는 Database for Annotation, Visualization and Integrated Discovery (DAVID)를 이용하여 Gene Ontology (GO)정보에 따라 기능을 분류하였다(Huang et al. 2009).

Real-time PCR 분석

Real-time PCR의 조건은 다음과 같다: initial denaturation, 95°C-30초; denaturation, 95°C-5초; annealing, 60°C-30초; 40 cycle 반복. Internal standard로는 actin 유전자를 표준시료로는 무처리 과실을 이용하였다. 각 유전자의 발현은 표준시료와 비교하였으며 최종 결과 값은 log2값으로 나타내었다. 유전자 특이적인 primer는 Primer3 (http://frodo.wi.mit.edu/primer3)를 이용하여 제작하였고 염기서열은 Table 3과 같다.

Table 1 . Statistical data of trimmed reads

PairNo. of readsLength average (bp)Sum (bp)Average sum (bp)
‘Campbell Early’-control28,557,44185.212,433,447,74076.69%
‘Campbell Early’-treated25,903,00489.922,329,203,26380.00%
‘MBA’-control27,553,48490.122,483,252,35781.08%
‘MBA’-treated32,101,86689.612,876,749,30681.07%

Treated, grapevines were kept at -2°C for 4 days; MBA, ‘Muscat Baily A’


Table 2 . Up- and down-regulated DEGs related to enzymes identified by UniprotKB in low temperature-treated grapevines

GrapevineUp-regulatedDown-regulated

EC??EnzymeNo. of DEGsEC??EnzymeNo. of DEGs
Campbell6.3.2.19Ubiquitin---protein ligase152.7.11.1Non-specific serine/threonine protein kinase16
Early 2.7.11.1Non-specific serine/threonine protein kinase126.3.2.19Ubiquitin---protein ligase13
2.7.7.6DNA-directed RNA polymerase111.11.1.7Peroxidase12
3.6.4.12DNA helicase82.4.1.207Xyloglucan:xyloglucosyl transferase11
3.6.4.13RNA helicase73.6.3.14H+-transporting two-sector ATPase9
3.1.2.15Ubiquitin thiolesterase73.5.5.1Nitrilase8
3.6.3.14H+-transporting two-sector ATPase63.5.5.4Cyanoalanine nitrilase8
2.7.1.40Pyruvate kinase61.6.99.3NADH dehydrogenase7
3.1.3.16Protein-serine/threonine phosphatase53.2.1.21Beta-glucosidase7
2.7.7.7DNA-directed DNA polymerase51.6.5.3NADH:ubiquinone reductase (H+-translocating)6

MBA 6.3.2.19Ubiquitin---protein ligase13.1.2.15Ubiquitin thiolesterase3
2.7.7.6DNA-directed RNA polymerase16.3.2.19Ubiquitin---protein ligase1
3.6.4.13RNA helicase12.7.7.6DNA-directed RNA polymerase1
3.6.3.14H+-transporting two-sector ATPase13.6.4.13RNA helicase1
2.7.11.1Non-specific serine/threonine protein kinase13.6.3.14H+-transporting two-sector ATPase1

MBA, 'Muscat Baily A'


Table 3 . The 8 genes highly induced and inhibited in ‘Campbell Early’ and ‘Muscat Baily A’ grapevines exposed to chilling- temperature for 4 days

Campbell EarlyMuscat Baily A

GeneFold ChangeGeneFold Change
InducedDehydrin xero 1 (U1)14.64NB-ARC domain-containing disease resistance protein (U1)2.85
K-box region and MADS-box transcription factor family protein (U2)11.60Fatty acid hydroxylase superfamily (U2)2.73
MYB domain protein 36 (U3)11.39Isopentenyltransferase 3 (U3)2.31
AWPM-19-like family protein (U4)11.00Cytochrome P450 superfamily protein (U4)2.01
Leucine-rich repeat protein kinase family protein (U5)10.85DNA glycosylase superfamily protein (U5)1.94
Late embryogenesis abundant protein (LEA) family protein (U6)10.64Plant invertase/pectin methylesterase inhibitor superfamily (U6)1.82
PEBP (phosphatidylethanolamine-binding protein) family protein (U7)10.52Cytochrome P450, family 76, subfamily C, polypeptide 5 (U7)1.79
Alternative NAD(P)H dehydrogenase 2 (U8)10.48Integrase-type DNA-binding superfamily protein (U8)1.08

InhibitedLight-harvesting chlorophyll B-binding protein 3 (D1)-13.63Binding (D1)-3.51
FASCICLIN-like arabinoogalactan 9 (D2)-12.58IAP-like protein 1 (D2)-2.92
Pectin methylesterase 61 (D3)-12.27Pentatricopeptide repeat (PPR) superfamily protein (D3)-2.88
Alpha carbonic anhydrase 1 (D4)-12.18Protein of unknown function (DUF506) (D4)-3.41
Photosystem I light harvesting complex gene 1 (D5)-12.03Zinc-finger protein 1 (D5)-3.24
Expansin A8 (D6)-11.85UDP-Glycosyltransferase superfamily protein (D6)-1.50
GDSL-like Lipase/Acylhydrolase superfamily protein (D7)-11.52Heat shock protein 18.2 (D7)-1.72
Bifunctional inhibitor/lipid-transfer protein (D8)-9.9017.6kDa class Ⅱ heat shock protein (D8)-1.10

-2°C에서 4일 동안 저온처리한 ‘Campbell Early’와 ‘Muscat Baily A’ 포도나무 잎을 RNA sequencing을 통해 전사체를 분석하였고 DEG를 선발하였다. Transcripts의 평균길이는 85.21 ~ 90.12 bp였으며, 두 품종 모두에서 raw data의 76 ~ 81%가 기존의 data와 비교 가능하였으며 약 2.3 ~ 2.8 Gb의 길이를 분석하였다(Table 1).

DEG는 p-value ≤ 0.01%와 fold change ≥2 이상으로 선발하였으며, Figure 1의 벤다이어그램은 영하의 저온에 반응하여 ‘Campbell Early’와 ‘Muscat Baily A’ 품종에서 공통적으로 또는 특이적으로 annotation된 유전자의 수를 나타내었다. 발현이 2배 이상 유도된 유전자의 수는 ‘Campbell Early’와 ‘Muscat Baily A’에서 5,583개와 419개였으며, 발현이 억제된 유전자의 수는 각각 6,602개와 646개였다. 공통적으로 발현이 유도된 유전자는 250개 억제된 유전자는 65개였으며, 유도된 대표 유전자는 12-oxophytodienoate reductase 2, alpha/beta-hydrolases superfamily protein, cytochrome P450, jasmonate-zim-domain protein 8과 myb domain protein 등이 있으며, 억제된 유전자로는 disease resistance protein, NB-ARC domain-containing disease resistance protein과 tetratricopeptide repeat-like superfamily protein 등이 있다(data not shown). 공통적으로 발현이 5배이상 유도되는 유전자는 9개, 10배이상 발현이 유도되는 유전자 3개이었으나 발현이 억제되는 유전자에서는 공통적으로 나타나는 유전자가 검출되지 않았다.

Fig. 1.

Distribution of the genes commonly and specifically expressed in shoots of ‘Campbell Early (CE)’ and ‘Muscat Baily A (MBA)’ grapevines exposed to freezing temperature (-2°C) for 4 days. A, Up-regulated genes; B, Down-regulated genes; C, Statistics of differentially expressed genes


선발한 DEG를 바탕으로 TGICL (TIGR Gene Indices Clustering Tools)을 이용하여 GO를 분석하였다. 유전자는 기능별로 분류하여 3가지 범주(biological process, cellular component, molecular function)로 구분할 수 있었으며 3단계의 수준에서 GO term을 확인하였다(Fig. 2, 3). 영하에서 저온처리 한 ‘Campbell Early’ 품종의 잎에서 발현이 유도되는 유전자군은 biological process에서는 세포 물질대사과정에 관여하는 유전자, cellular component에서는 세포막 또는 세포소기관에 관여하는 유전자가, molecular function에서는 퓨린염기 또는 뉴클레오티드결합에 관여하는 유전자가 가장 풍부하였다. 발현이 억제되는 유전자군을 annotation한 결과 biological process에서는 인, 탄수화물, 지질 대사과정에 관여하는 유전자가, cellular component와 molecular function에서는 발현이 유도되는 유전자와 비슷한 경향을 보였다. ‘Muscat Baily A’ 품종에서도 발현이 유도되는 유전자군을 annotation한 결과 biological process에서는 세포대사의 조절, 신호전달, 지질 대사과정에 관여하는 유전자가, cellular component에서는 막, 세포막에 관여하는 유전자가, molecular function에서는 막간수송활동 관련 유전자가 가장 많았다. 발현이 억제되는 유전자군을 annotation한 결과 biological process에서는 세포 대사과정 관련 유전자가 cellular component에서는 세포막 또는 세포소기관에 관여하는 유전자가, molecular function에서는 퓨린 또는 뉴클레오티드결합에 관여하는 유전자가 가장 많았다. 내한성이 강한 ‘Campbell Early’ 품종과 내한성이 약한 ‘Muscat Bailey A’ 품종간에는 영하의 저온처리에 반응하여 발현되는 유전자군에도 차이를 나타내며 이들이 형질발현과 연관이 있을 것으로 여겨진다.

Fig. 2.

GO enrichment of DEGs induced and inhibited 10-fold or more by freezing-treatment in ‘Campbell Early’ grapevines (A; induced genes, B; inhibited genes)


Fig. 3.

GO enrichment of DEGs induced and inhibited 10-fold or more by freezing-treatment in ‘Muscat Baily A’ grapevines (A; induced genes, B; inhibited genes)


InterPro Scan을 이용하여 단백질 domain을 분석하였다(Table 2). 두 품종 모두에서 공통적으로 발현이 유도되는 유전자와 일치하는 enzyme은 ubiquitin---protein ligase, non- specific serine/threonine protein kinase, DNA-directed RNA polymerase, DNA helicase가 있으며, 발현이 억제되는 유전자와 일치하는 enzyme은 ubiquitin---protein ligase와 H+- transporting two-sector ATPase가 있었다. 그 중에서 ubiquitin--- protein ligase는 두 품종 모두에서 발현이 유도 또는 억제되는 유전자와 관련이 있었다.

대조구에 비해 영하의 저온 처리구에서 발현이 유도 또는 억제되는 유전자 8개를 선발하였다(Table 3). ‘Campbell Early’에서 발현이 유도되는 유전자는 dehydrin xero 1, K-box region and MADS-box transcription factor family protein, myb domain protein 36 등이 있으며 발현이 억제되는 유전자는 light-harvesting chlorophyll B-binding protein 3, FASCICLIN- like arabinoogalactan 9, pectin methylesterase 61 등이 있었다. 반면 ‘MBA’에서 발현이 유도되는 유전자는 NB-ARC domain-containing disease resistance protein, fatty acid hydroxylase superfamily, isopentenyltransferase 3 등이 있으며 억제되는 유전자는 binding, IAP-like protein 1, Pentatricopeptide repeat (PPR) superfamily protein 등이 있었다.

전사체 분석에서 검출된 DEG 중에서 발현량의 큰 차이를 나타내는 유전자의 발현양상을 확인하기 위하여 전사체에서 얻은 염기서열을 바탕으로 각각의 유전자에 특이적인 프라이머를 제작하였다(Table 4). 유전자 특이적인 프라이머를 이용하여 real-time PCR을 수행한 결과, 전사체 분석과 동일한 양상의 발현을 확인하였다(Fig. 4).

Table 4 . Sequence of primers used for real-time PCR analysis in this study

NamePrimer sequencesNamePrimer sequences
CE-U1ACATCCTTACCATCCGGAGTCAMBA-U1CAAATAATCCTCAGCGGTGTCC
GCTCGTACCACGTAAAGGATGGGGATGGCAGAGGGTTTTATTCC
CE-U2CCATCCCAAAATGACAATGGATMBA-U2GGATGGGAGCAGCTTAGCAGTA
AAGCTGAAAGGCATTTCGTGAGTGGTTCCTTTTGGAATGCTGTT
CE-U3TTTCACCCTCATAGCAGCAACAMBA-U3TGAGAAACCATGGGAAAAGGAA
TTTCTTGACGTTGGCTTTGTCAATGAAACATCCAAAGCGTCCAT
CE-U4TGTAACCCGGACCATACTTGCTMBA-U4TCCGGATTTTCCTTCCACCTAT
CCCAACTGCTCTACCTCATGCTAAAGAAATCGCTGGTGAAGCTG
CE-U5ATTTGCTCAGCTGGGTGAACTCMBA-U5TGAAACTGCGCTGTTCAGACTC
ACACCTCACCAGTCCACTCCTCGAAAGAAACCTCGAAACGCAGA
CE-U6TTCCTCTGCTGCATTTCTACCCMBA-U6CGGACCGTCTTCCTAAAGACCT
CCTGCGCTTCTGTCATTGTTTACGGGGCCTGTATTCATGTACTC
CE-U7GCTTTGTTCTTCTCCGTTGGAAMBA-U7CTTAGATGGATGGACCCACAGG
GAAGACAGCAGCCAAACATGAAAGCGATTTTCATGGCTATTCCA
CE-U8CACTTGCTTTCCTGTCTGCTCAMBA-U8ATATTCTTTCCCGTGCCACCTT
GGATTGGTGTGGATGAATGGTTGCGGCTCCCATACTTTCTGATA

CE-D1CTTTGTCCAAGCCATCGTTACCMBA-D1AGACGAAGAATTGCCTTTGCAG
AATGGGAATGAAGGGGAAATGTCTTGGGATTGATGACCTTCTGG
CE-D2TCATTCGCCTCCTCGCTACTACMBA-D2TCTCTGAGCACAAGCCAATGAG
TGAGAGGGCATTCAGTGTACCAATTGGTTTGGAAAGCCAAAGGT
CE-D3GCCAGTCAGCTCTCCTCTCATCMBA-D3GGGGAGCTCAAAAACCTCACTT
TGAGGCTGAACTGCACTGAAAGTTCATCATACCCCCGTCATTTC
CE-D4GCAGAGCTGCATCTAGTCCACAMBA-D4GCGGACCACAGCTTTGAGTAGT
GCTCATTGCTTGCACAAACATCGCTGTGGCTCTGAACTCGGTAT
CE-D5GTTTCATGCGAAAACCCAAACTMBA-D5TGTCCTCCCTGTCCCTACAAAA
TCTTGCGTCCATTTTCTCAACATAGTGTCTTGATGCGGCCTACA
CE-D6AAATTTGGACCCCACAGGAAGTMBA-D6ATTCGACATGGAACATCGGTCT
GAAAGTTGCCTCCCAGAGGATTGAAAGAAGTTCGGCGAGTTTGA
CE-D7ATGGCCTCAACATTCCAGACATMBA-D7TGCGAAGATGGATCAAGTCAAA
CCAATTCCAGCAGAAGCAAAGTATGGCCGTCAACCTTCTAATGA
CE-D8GGCAATTACTGCACCCAAATTCMBA-D8AAACCCAACATGGATTTGAGGA
GAAGTCCCATGCCTTTTCAATGGGCAGAGAAGAGTGGAGAATCG

CE, ‘Campbell Early’; MBA, ‘Muscat Baily A’. U, up-regulation; D, down-regulation, Genes amplified by each primer set are listed in Table 3


Fig. 4.

Verification of gene transcripts up-regulated (left) and down-regulated (right) in response to cold treatment in ‘Campbell Early’ (CE) and ‘Muscat Baily A’ (MBA) grapevines by quantitative real-time PCR analysis. Genes amplified by each primer set are listed in Table 3. Each vertical bar indicates the SEs (n = 3)


온도는 식물의 생장과 발달을 제한 할 수 있는 환경요인이며, 저온과 동결온도는 원예작물의 생장에 적합한 지리적 요건을 제한할 뿐만 아니라 생산성에도 영향을 미친다(Thomashow 1999). 포도 재배에서도 저온스트레스는 환경제한 요인이며, 점차적인 기온 감소에는 순응을 하여 겨울철 -15°C의 낮은 온도에도 견딜 수 있지만 급작스런 기온 저하나 내한성 온도 이하로 낮아질 경우에는 눈이나 뿌리조직에 심각한 문제를 발생시킬 수 있다(Fennell 2004; Tillett et al. 2012). 토마토에서도 냉해는 기공 전도도, 생리적반응, 틸라코이드막 지방산 조성, 광합성 속도 등 다양한 기작에서 생리학적 변화를 야기한다(Walker et al. 1991). 또한, 봄보리(Hordeum vulgare), 메도우페스큐(Festuca pratensis), 겨울유채(Brassica napus var. oleifea) 등에 저온 처리를 하면 특정 병원균에 대한 저항성을 유도한다고 보고되었다(Plazek and Zur 2003).

본 연구에서는 ‘Campbell Early’와 ‘Muscat Baily A’ 포도를 영하의 저온에 노출하였을 때 전사체 분석을 통해 DEG를 조사하였다. 영하의 저온에 노출된 ‘Campbell Early’에서 5,583개의 유전자가 발현이 유도되고, 6,602개의 유전자가 억제되었으며, ‘Muscat Baily A’에서는 419개의 유전자가 유도되고, 646개 유전자가 억제되었다. ‘Cabernet Sauvignon’ (V. vinifera) 포도나무는 냉해스트레스에는 2,917개, 염분스트레스에는 1,926개, 수분스트레스에는 2,301개의 유전자가 발현에 큰 변화를 가져왔다(Tattersall et al. 2007). Oono et al. (2006)는 microarray분석을 통해 애기장대에서 저온순화에 의해 445개 유전자발현이 유도되고 341개의 유전자발현이 억제되는 것을 확인하였고, 염분이나 수분부족스트레스보다 냉해에 반응하여 신호전달과 세포이동과 관련이 있는 유전자의 발현이 급변하는 것으로 보고하였다. V. amurensis가 저온에 반응하여 나타낸 DEG를 기능별로 분류하여 물질대사, 수송, 신호전달 및 전사와 관련된 유전자의 발현 비중이 높은 것으로 나타났으며(Xin et al. 2013), ‘Cabernet Sauvignon’에서는 대사, 단백질대사 및 신호전달과 관련된 유전자 발현의 비중이 높았다(Tattersall et al. 2007). 본 연구에서는 두 품종 모두에서 3가지 범주 중 세포구성에서 막과 세포소기관에 관여하는 유전자가 가장 많이 나타났다.

영하의 저온에 특이적인 DEG를 바탕으로 효소를 분석한 결과 유전자의 발현이 유도 또는 억제되는 두 품종 모두에서 ubiquitin-protein ligase와 관련이 있었다. Ubiquitin ligase는 유비퀴틴화와 26S 프로테아좀 경로에 의한 단백질분해에 대한 기질 특이성을 가지는 것으로 알려져 있으며, 애기장대에서 저온 순화하는 동안 ubiquitin ligase에 의해 microRNA393의 발현이 증가하는 것으로 나타났으며 내한성에 대해 긍정적인 조절을 한다는 것을 알 수 있었다(Chinnusamy et al. 2007). Serine/threonine protein kinases는 거대 단백질군으로 세포의 증식, 분화, 생존과 세포반응에 관여하는 것으로 알려져 있으며, 애기장대에서 57개의 유전자군을 확인하였으며 그 중 23개의 유전자군이 저온, 고온 스트레스, 아브시스산, 살리실산 및 높은 삼투압 등의 스트레스에 연관되어 있다고 보고되어 있다(Rudrabhatla et al. 2006). 항산화효소인 peroxidase는 스트레스 반응과 같은 생물학적 기능과 관련이 있으며, 스트레스에 의해 발현이 증가하였으며 형질전환체에서 높은 수준의 내한성을 나타내었다(Koussevitzky et al. 2008).

애기장대에서 저온스트레스에 반응하여 MYB, galactinol, UDP-glucosyl, chalcone과 같은 다양한 유전자들의 발현이 조절되며(Oono et al. 2006), late embryogenesis abundant protein(LEA)은 주로 식물의 배발생 과정에서 건조스트레스 내성을 부여하기 위해 발생되지만 저온순화과정에서도 발현이 유도되는 것으로 알려져 있으며 생체막을 보호하는 기능과 연관되어 있는 것으로 여겨진다(Close 1997). 온주밀감에 저온을 처리하였을 때 저온 스트레스를 받는 동안 nitrate transporter, auxin responsive GH3, UDP- glycosyltransferase (UGT)와 chalcone-flavanone isomerase 등의 유전자 발현이 변화하였다(Huang et al. 2011). Xin et al. (2013)은 저온에 반응하는 V. amurensis에서 발현이 크게 변화하는 유전자군을 확인하였다. 본 연구에서 사용한 두 품종의 포도나무 식물체가 영하의 저온에 노출되었을 때 광합성과 관련된 탄수화물 대사, 방어기작, 전사인자 및 세포벽 관련 유전자가 유도 또는 억제되었는데, 이러한 결과는 다른 식물체에서 저온 스트레스를 처리하였을 때 발현되는 전사체 및 단백질의 정보와 동일하였다.

본 연구에서는 영하의 저온에 대응한 ‘Campbell Early’와 ‘Muscat Bailey A’ 포도나무의 전사체 분석을 통해 저온스트레스와 관련된 특이 유전자를 선발하고 GO를 통해 기능에 따라 분류하였으며, 저온에 대응해 유도 또는 억제되는 유전자를 확인할 수 있었다. 저온 스트레스를 받은 포도 잎의 유전자 발현을 통해 저온 저항성에 대한 기작을 구명하는데 기여하고 유용유전자의 대량 발굴을 통해 내한성 포도 품종의 개발에 이용될 수 있을 것이다.

환경스트레스 중의 하나인 저온에 대한 생육기의 포도나무의 반응을 분석하고자 -2°C에서 4일 동안 저온처리 한 두 품종(‘Campbell Early’와 ‘Muscat Baily A’)의 포도나무 잎을 이용하여 전사체를 분석하였고 특이발현유전자(differentially expressed genes, DEGs)를 검색하였다. 영하의 저온에 반응한 ‘Campbell Early’의 DEG를 기능별로 분석한 결과 생물대사에서 17,424개, 세포구성에서 28,954개, 분자기능에서는 6,972개의 유전자와 관련이 있었다. 발현이 유도되는 유전자로는 dehydrin xero 1, K-box region and MADS-box transcription factor family protein과 MYB domain protein 36이 있으며, 억제되는 유전자로는 light-harvesting chlorophyll B-binding protein 3, FASCICLIN-like arabinoogalactan 9와 pectin methylesterase 61 등이 있었다. ‘Muscat Baily A’ 의 DEG는 생물대사에서 1,157개, 세포구성에서 1,350개, 분자기능에서는 431개의 유전자와 관련이 있었다. 발현이 유도되는 유전자로는 NB-ARC domain-containing disease resistance protein, fatty acid hydrozylase syperfamily와 isopentenyltransferase 3이 있으며, 억제되는 유전자로는 binding, IAP-like protein 1과 pentatricopeptide repeat superfamily protein 등이 있었다. Real-time PCR을 이용하여 영하의 저온에서 특이적으로 발현하는 유전자들을 검정하였으며, InterPro Scan을 통해 단백질 도메인을 분석한 결과 두 품종 모두에서 ubiquitin-protein ligase가 가장 많았다. 영하의 저온에 노출된 신초의 전사체 정보를 바탕으로 포도나무에서 저온 내성을 발현하는 기작을 연하는 데에 분자수준의 정보를 제공하고, 내한성 포도를 육종하는데 이용될 수 있을 것이다.

본 연구는 농촌진흥청 공동연구사업(과제번호:PJ010174)의 지원에 의해 수행되었다.

  1. Alonso-Blanco C, and Koornneef M. (2000) Naturally occurring variation in Arabidopsis:an underexploited resource for plant genetics. Trends Plant Sci 5, 22-29.
    CrossRef
  2. Anders S, and Huber W. (2010) Differential expression analysis for sequence count data. Genome Biol 11, R106.
    CrossRef
  3. Barah P, Jayavelu ND, Rasmussen S, Nielsen HB, Mundy J, and Bones AM. (2013) Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes. BMC Genomics 14, 722.
    Pubmed KoreaMed CrossRef
  4. Chang S, Puryear J, and Cairney J. (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol 11, 113-116.
    CrossRef
  5. Chiang CM, Kuo WS, and Lin KH. (2014) Cloning and gene expression analysis of sponge gourd ascorbate peroxidase gene and winter squash superoxide dismutase gene under respective flooding and chilling stresses. Hort Environ Biotechnol 55, 129-137.
    CrossRef
  6. Chinnusamy V, Zhu J, and Zhu JK. (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci 12, 444-451.
    Pubmed CrossRef
  7. Cho HY, Hwang SG, Kim DS, and Jang CS. (2012) Genome-wide transcriptome analysis of rice genes responsive to chilling stress. Can J Plant Sci 92, 447-460.
    CrossRef
  8. Close TJ. (1997) Dehydrins:A commomnality in the response of plants to dehydration and low temperature. Physiol Plant 100, 291-296.
    CrossRef
  9. Cox MP, Peterson DA, and Biggs PJ. (2010) SolexaQA:At-a-glance quality assessment of Illumina second-generation sequencing data. BMC Bioinformatics 11, 485.
    Pubmed KoreaMed CrossRef
  10. Cramer GR, Erg?l A, Grimplet J, Tillett RL, Tattersall EA, Bohlman MC, Vincent D, Sonderegger J, Evans J, Osborne C, Quilici D, Schlauch K, Schooley D, and Cushman J. (2007) Water and salinity stress in grapevines:early and late changes in transcript and metabolite profiles. Funct Integr Genomics 7, 111-134.
    Pubmed CrossRef
  11. Fennell A. (2004) Freezing tolerance and injury in grapevines. J Crop Improvement 10, 201-235.
    CrossRef
  12. Fuller MP, and Telli G. (1999) An investigation of the frost hardiness of grapevine (Vitis vinifera) during bud break. Annu Appl Biol 135, 589-595.
    CrossRef
  13. Hemstad PR, and Luby JJ. (2000) Utilization of Vitis riparia for the development of new wine varieties with resistance to disease and extreme cold. Acta Hortic 528, 487-490.
    CrossRef
  14. Huang DW, Sherman BT, and Lempicki RA. (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57.
    Pubmed CrossRef
  15. Huang W, Li L, Myers JR, and Marth GT. (2012) ART:A next- generation sequencing read simulator. Bioinformatics 28, 593-594.
    Pubmed KoreaMed CrossRef
  16. Huang Y, Si Y, and Dane F. (2011) Impact of grafting on cold responsive gene expression in Satsuma mandarin (Citrus unshiu). Euphytica 177, 25-32.
    CrossRef
  17. Hur YY, Jung SM, and Yun HK. (2015) Current status and prospects of genomics and bioinformatics in grapes. J Plant Biotechnol 42, 298-311.
    CrossRef
  18. Kim SA, Ahn SY, Han JH, Kim SH, Noh JH, and Yun HK. (2013) Differential expression screening of defense related genes in dormant buds of cold-treated grapevines. Plant Breed Biotech 1, 14-23.
    CrossRef
  19. Koussevitzky S, Suzuki N, Huntington S, Armijo L, Sha W, Cortes D, Shulaev X, and Mittler R. (2008) Ascorbate peroxidase 1 plays a key role in the response of Arabidopsis thaliana to stress combination. J Biol Chem 283, 34197-34203.
    Pubmed KoreaMed CrossRef
  20. Kwon YA, Kwon WT, Boo KO, and Choi Y. (2007) Future projections on subtropical climate regions over south Korea using SRES A1B data. J Korean Geogr Soc 42, 355-367.
  21. Lee GH, Yu JG, and Park YD. (2015) Time-based expression networks of genes related to cold stress in Brassica rapa ssp pekinensis. Korean J Hortic Sci Technol 33, 114-123.
    CrossRef
  22. Liu GT, Wang JF, Cramer G, Dai ZW, Duan W, Xu HG, Wu BH, Fan PG, Wang LJ, and Li SH. (2012) Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress. BMC Plant Biol 12, 174.
    Pubmed KoreaMed CrossRef
  23. Luby JJ, Mansfield AK, Hemstad PR, and Beam BA. (2003) Development and evaluation of cold hardy wine grape breeding selections and cultivars in the upper Midwest. AVERN Report .
  24. Luedeling E, Girvetz EH, Semenov MA, and Brown PH. (2011) Climate change affects winter chill for temperature fruit and nut trees. PLoS ONE 6, e20155.
    Pubmed KoreaMed CrossRef
  25. Ma YY, Zhang YL, Shao H, and Lu J. (2010) Differential physio- biochemical responses to cold stress of cold-tolerant and non-tolerant grape (Vitis L.) from china. J Agron Crop Sci 196, 212-219.
    CrossRef
  26. Mahajan S, and Tuteja N. (2005) Cold, salinity and drought stresses:an overview. Arch Biochem Biophys 444, 139-158.
    Pubmed CrossRef
  27. Oono Y, Seki M, Satoum M, Iida K, Akiyama K, Sakurai T, Fujita M, Yamaguchi-Shinozaki K, and Shinozaki K. (2006) Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays. Funct Integr Genomics 6, 212-234.
    Pubmed CrossRef
  28. Plazek A, and Zur I. (2003) Cold-induced plant resistance to necrotrophic pathogens and antioxidant enzyme activities and cell membrane permeability. Plant Sci 164, 1019-1028.
    CrossRef
  29. Rudrabhatla P, Reddy MM, and Rajasekharan R. (2006) Genome-wide analysis and experimentation of plant serine/threonine/ tyrosine-specific protein kinases. Plant Mol Biol 60, 293-319.
    Pubmed CrossRef
  30. Sanghera GS, Wani SH, Hussain W, and Singh NB. (2011) Engineering cold stress tolerance in crop plants. Curr Genomics 12, 30-43.
    Pubmed KoreaMed CrossRef
  31. Seo HH, and Park HS. (2003) Fruit quality of ‘Tsugaru’ apples influenced by meteorological elements. Korean J Agric Forest Meteorol 5, 218-225.
  32. Tattersall EA, Grimplet J, DeLuc L, Wheatley MD, Vincent D, Osborne C, Ergul A, Lomen E, Blank RR, Schlauch KA, Cushman JC, and Cramer GR. (2007) Transcript abundance profiles reveal larger and more complex responses of grapevine to chilling compared to osmotic and salinity stress. Funct Integr Genomics 7, 317-333.
    Pubmed CrossRef
  33. Thomashow MF. (1999) Plant cold acclimation:Freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol 50, 571-599.
    Pubmed CrossRef
  34. Tillett RL, Wheatley MD, Tattersall EA, Schlauch KA, Cramer GR, and Cushman JC. (2012) The Vitis vinifera C-repeat binding protein 4 (VvCBF4) transcriptional factor enhances freezing tolerance in wine grape. Plant Biotechnol J 10, 105-124.
    Pubmed KoreaMed CrossRef
  35. Walker MA, McKersie BD, and Pauls KP. (1991) Effects of chilling on the biochemical and functional properties of thylakoid membranes. Plant Physiol 97, 663-669.
    Pubmed KoreaMed CrossRef
  36. Wu J, Zhang Y, Zhang H, Huang H, Folta KM, and Lu J. (2010) Whole genome wide expression profiles of Vitis amurensis grape responding to downy mildew by using Solexa sequencing technology. BMC Plant Biol 10, 234.
    Pubmed KoreaMed CrossRef
  37. Xin H, Zhu W, Wang L, Xiang Y, Fang L, Li J, Sun X, Wang N, Londo J, and Li S. (2013) Genome wide transcriptional profile analysis of Vitis amurensis and Vitis vinifera in response to cold stress. PLoS ONE 8, e58740.
    CrossRef
  38. Xu J. (2014). Next-generation sequencing:Current technologies and applications . Caister Academic Press, Ontario, Canada.
  39. Yoon ST, Lee YH, Hong SH, Kim MH, Kang KK, Na YE, and Oh YJ. (2013) Vulnerability assessment of cultivation facility by abnormal weather of climate change. Korean J Agric Forest Meteorol 15, 264-272.
    CrossRef
  40. Zhou D, Zhou J, Meng L, Wang Q, Xie H, Guan Y, Ma Z, Zhong Y, Chen F, and Liu j. (2009) Duplication and adaptive evolution of the COR15 genes within the highly cold-tolerant Draba lineage (Brassicaceae). Gene 441, 36-44.
    Pubmed CrossRef

Article

Research Article

J Plant Biotechnol 2016; 43(2): 204-212

Published online June 30, 2016 https://doi.org/10.5010/JPB.2016.43.2.204

Copyright © The Korean Society of Plant Biotechnology.

영하의 저온에 노출된 ‘Campbell Early’와 ‘Muscat Bailey A’ 포도나무 신초의 전사체 비교

김선애, 윤해근*

영남대학교 원예생명과학과

Received: 16 March 2016; Revised: 4 April 2016; Accepted: 4 April 2016

Transcriptomic analysis of ‘Campbell Early’ and ‘Muscat Bailey A’ grapevine shoots exposed to freezing cold stress

Seon Ae Kim, and Hae Keun Yun*

Department of Horticulture and Life Science, Yeungnam University, Gyeongsan 38541, Korea

Correspondence to:e-mail: haekeun@ynu.ac.kr

Received: 16 March 2016; Revised: 4 April 2016; Accepted: 4 April 2016

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

To understand the responses of grapevines in response to cold stress causing the limited growth and development, differentially expressed genes (DEGs) were screened through transcriptome analysis of shoots from 2 grapevine cultivars (‘Campbell Early’ and ‘Muscat Baily A’) kept at -2°C for 4 days. In gene ontology analysis of DEGs from ‘Campbell Early’, there were 17,424 clones related with biological process, 28,954 with cellular component, and 6,972 with molecular function genes in response to freezing temperature. The major induced genes included dehydrin xero 1, K-box region and MADS-box transcription factor family protein, and MYB domain protein 36, and inhibited genes included light-harvesting chlorophyll B-binding protein 3, FASCICLIN-like arabinoogalactan 9, and pectin methylesterase 61 in ‘Campbell Early’ grapevines. In gene ontology analysis of DEGs from ‘Muscat Baily A’, there were 1,157 clones related with biological process, 1,350 with cellular component, and 431 with molecular function gene. The major induced genes of ‘Muscat Baily A’ included NB-ARC domain-containing disease resistance protein, fatty acid hydrozylase superfamily, and isopentenyltransferase 3, and inhibited genes included binding, IAP-like protein 1, and pentatricopeptide repeat superfamily protein. All major DEGs were shown to be expressed differentially by freezing temperature in real time-PCR analysis. Protein domain analysis using InterPro Scan revealed that ubiquitin-protein ligase was redundant in both tested grapevines. Transcriptome profile of shoots exposed to cold can provide new insights into the molecular basis of tolerance to low-temperature in grapevines, and can be used as resources for development new grapevines tolerant to coldness.

Keywords: Differentially expressed genes, Gene expression, Gene ontology, Tolerance to cold

서론

저온은 중요한 환경스트레스 중 하나로 지구상에서 식물의 생육과정에서 발육을 저해 위험요소이다. 식물이 저온 스트레스를 받게 되면 조직의 괴사, 백화 현상, 발아율 저하 및 잎의 시듦 등을 초래하여 직접적인 악영향을 끼친다(Sanghera et al. 2011). 세계적으로도 많이 생산하는 과수 중의 하나인 포도나무가 저온에 노출되면 생육과 광합성이 감소하고, 심각한 문제와 고사에 이를 수 있다(Fuller and Telli 1999; Mahajan and Tuteja 2005).

저온 및 냉해저항성과 같은 유용한 특성을 지닌 유전자들에 의해 조절되는 유전자를 활용하여 넓은 범위의 온도에 적응할 수 있는 포도의 육종프로그램에 이용할 수 있을 것이다(Hemstad and Luby 2000; Luby et al. 2003). 저온에 대한 포도나무의 생리, 생화학적 반응을 분석한 결과, 내한성이 강한 포도 품종이 감수성 품종에 저온스트레스에 대해 높은 반응활성을 나타내는 것으로 보고되었다(Kim et al. 2013; Ma et al. 2010). 저온에 의한 스트레스와 관련된 유전자조절은 밀, 보리, 호밀, 수세미 등과 같은 다양한 온대작물에서 보고되어 있다(Chiang et al. 2014; Chinnusamy et al. 2007). 애기장대가 복잡한 환경조건에 적응하는 기작을 분자생물학 수준에서 이해함으로써 최근의 식물학에서 활용이 가능한 유용 유전자를 선발하고 그 특성을 구명하게 되었다(Alonso-Blanco and Koornneef 2000).

차세대염기서열분석(next generation sequencing, NGS) 기술은 최근에 짧은 기간 동안 염기서열의 대량분석을 통한 생물체의 유전체와 전사체의 연구에 매우 큰 발전을 가져왔다(Huang et al. 2012; Hur et al. 2015; Xu 2014). 포도나무에서도 노균병(Wu et al. 2010), 수분 및 염분 스트레스(Cramer et al. 2007), 고온(Liu et al. 2012) 등 생물적 또는 비생물적 스트레스와 관련하여 다양한 전사체 분석연구가 수행되었다.

최근 저온 스트레스와 관련하여 애기장대(Barah et al. 2013), 꽃다지종(Zhou et al. 2009), 벼(Cho et al. 2012) 및 배추(Lee et al. 2015) 등의 식물체에서 발현 유전자 네트워크 분석, 전사인자 분석을 바탕으로 저온 저항성 관련 유전자 발굴 및 발현기작의 분석 등의 연구가 이루어지고 있다. 또한 Vitis amurensisV. vinifera에 속하는 두 종류의 포도나무를 대상으로 저온(4°C)에 반응하여 발현된 유전체를 분석하였다(Xin et al. 2013). Microarray분석을 통해 냉해(-5°C)에 노출된 유럽종 포도품종인 ‘Cabernet Sauvignon’ 수체 신초 선단의 유전자 발현의 변화를 비교한 연구에서 칼슘신호전달과 관련된 유전자의 발현이 크게 변화한다고 보고되었다(Tattersall et al. 2007).

근대적인 기상관측이 시작된 1904년부터 2000년까지 우리나라는 약 100년동안 평균기온이 약 1.5°C 상승하는 온난화 추세를 보였으며(Kwon et al. 2007), 지구온난화로 인해 온대과수의 저온요구도를 충족시키지 못해 수확량 감소를 유발할 수 있다는 주장이 제기되었다(Luedeling et al. 2011). 그러나 최근의 기후변화는 기온의 상승뿐만 아니라 태풍, 폭설, 강풍, 폭우와 같은 이상기상의 발생을 야기시켜 농작물에 직접적인 피해뿐만 아니라 시설재배 농가의 피해를 증가시키고 있다(Yoon et al. 2013). 또한 봄철의 잦은 강우와 갑작스런 기온 하강은 개화기에 수분 수정에 영향을 주어 착과율을 떨어뜨리고, 겨울철의 극저온으로 인해 빈번한 동해의 발생으로 과수 식물체의 발육불량을 유발하게 한다(Seo and Park 2003).

따라서 본 연구는 ‘Campbell Early’와 ‘Muscat Baily A’를 대상으로 영하의 저온처리에 따른 유전자들의 발현양상을 전사체 수준에서 분석하고 저온 스트레스에 대한 반응 기작을 이해함으로써 최근의 기후변화로 인해 나타나는 저온 장해를 극복할 수 있는 방안을 분자생물학적 수준에서 모색하고 내한성 포도 품종육성에 필요한 기초 자료로 제공하고자 수행하였다.

재료 및 방법

식물재료 및 온도처리

영남대학교 부속농장 유리온실에서 재배하던 ‘Campbell Early’와 ‘Muscat Baily A’ 포도 품종의 포트묘를 이용하여 본 연구를 수행하였다. 광이 주야 16:8시간으로 조사되는 -2°C의 생장상에서 포도나무를 유지한 후 4일이 경과한 식물체의 잎을 채취하여 액체질소에서 동결시킨 후 -80°C에서 보관하면서 이후의 실험에 사용하였다. 대조식물체로는 저온에 처리하기 전의 식물체로부터 잎을 채취하여 사용하였다.

RNA추출 및 cDNA합성

액체질소로 동결시킨 포도나무 잎을 Chang et al. (1993)의 방법을 일부 변형하여 RNA를 분리하였다. 분리한 RNA는 Nano Drop spectrophotometer(ND-1000, Technologies Inc., USA)를 이용하여 농도를 측정하고, 1% agarose gel에서 전기영동하여 확인하였다. 분리한 RNA(500ng/?L)로부터 PrimeScript™ 1st strand cDNA synthesis kit(TaKaRa Bio Inc., Japan)를 이용하여 cDNA를 합성하고 real-time PCR 반응을 위한 주형으로 사용하였다.

전사체 분석

cDNA library는 TruSeq SBS v5 protocol을 이용하여 제작하였고, Illumina HiSeq 2000 (Illumina, San Diego, CA)을 이용하여 sequencing paired-end reads를 생성하였다. Sequence는 국립농업생명공학정보센터(NABIC, 농촌진흥청) 데이터베이스(NN-1749-000001, NN-1753-000001, NN-1754-000001 and NN-1755-000001)에 등록하였다. SolexaQA package를 이용하여 Short read base의 quality가 20미만인 sequence와 read length가 25 bp 이하인 read는 제거하였다(Cox et al. 2010).

유전자 발현은 short read수, 특이발현유전자(differentially expressed genes, DEGs), clustering, annotation을 이용하여 분석하였다. DEG 추출은 DESeq Bioconductor package (version 1.6.0)(Anders and Huber 2010)를 이용하였고, 2-fold change방법과 q-value (FDR, false discovery rate) 유의수준 0.01이하의 Benjamini-Hochberg multiple test방법을 사용하였다. Pearson’s correlation hierarchical clustering을 이용하여 유전자 발현 패턴을 분석하였다. 발현된 유전자는 V. viniferaArabidopsis에 대해 각각 BLASTN과 BLASTX를 이용하여 annotation하였다. DEG와 clustering분석에 사용된 유전자는 Database for Annotation, Visualization and Integrated Discovery (DAVID)를 이용하여 Gene Ontology (GO)정보에 따라 기능을 분류하였다(Huang et al. 2009).

Real-time PCR 분석

Real-time PCR의 조건은 다음과 같다: initial denaturation, 95°C-30초; denaturation, 95°C-5초; annealing, 60°C-30초; 40 cycle 반복. Internal standard로는 actin 유전자를 표준시료로는 무처리 과실을 이용하였다. 각 유전자의 발현은 표준시료와 비교하였으며 최종 결과 값은 log2값으로 나타내었다. 유전자 특이적인 primer는 Primer3 (http://frodo.wi.mit.edu/primer3)를 이용하여 제작하였고 염기서열은 Table 3과 같다.

Table 1 . Statistical data of trimmed reads.

PairNo. of readsLength average (bp)Sum (bp)Average sum (bp)
‘Campbell Early’-control28,557,44185.212,433,447,74076.69%
‘Campbell Early’-treated25,903,00489.922,329,203,26380.00%
‘MBA’-control27,553,48490.122,483,252,35781.08%
‘MBA’-treated32,101,86689.612,876,749,30681.07%

Treated, grapevines were kept at -2°C for 4 days; MBA, ‘Muscat Baily A’.


Table 2 . Up- and down-regulated DEGs related to enzymes identified by UniprotKB in low temperature-treated grapevines.

GrapevineUp-regulatedDown-regulated

EC??EnzymeNo. of DEGsEC??EnzymeNo. of DEGs
Campbell6.3.2.19Ubiquitin---protein ligase152.7.11.1Non-specific serine/threonine protein kinase16
Early 2.7.11.1Non-specific serine/threonine protein kinase126.3.2.19Ubiquitin---protein ligase13
2.7.7.6DNA-directed RNA polymerase111.11.1.7Peroxidase12
3.6.4.12DNA helicase82.4.1.207Xyloglucan:xyloglucosyl transferase11
3.6.4.13RNA helicase73.6.3.14H+-transporting two-sector ATPase9
3.1.2.15Ubiquitin thiolesterase73.5.5.1Nitrilase8
3.6.3.14H+-transporting two-sector ATPase63.5.5.4Cyanoalanine nitrilase8
2.7.1.40Pyruvate kinase61.6.99.3NADH dehydrogenase7
3.1.3.16Protein-serine/threonine phosphatase53.2.1.21Beta-glucosidase7
2.7.7.7DNA-directed DNA polymerase51.6.5.3NADH:ubiquinone reductase (H+-translocating)6

MBA 6.3.2.19Ubiquitin---protein ligase13.1.2.15Ubiquitin thiolesterase3
2.7.7.6DNA-directed RNA polymerase16.3.2.19Ubiquitin---protein ligase1
3.6.4.13RNA helicase12.7.7.6DNA-directed RNA polymerase1
3.6.3.14H+-transporting two-sector ATPase13.6.4.13RNA helicase1
2.7.11.1Non-specific serine/threonine protein kinase13.6.3.14H+-transporting two-sector ATPase1

MBA, 'Muscat Baily A'.


Table 3 . The 8 genes highly induced and inhibited in ‘Campbell Early’ and ‘Muscat Baily A’ grapevines exposed to chilling- temperature for 4 days.

Campbell EarlyMuscat Baily A

GeneFold ChangeGeneFold Change
InducedDehydrin xero 1 (U1)14.64NB-ARC domain-containing disease resistance protein (U1)2.85
K-box region and MADS-box transcription factor family protein (U2)11.60Fatty acid hydroxylase superfamily (U2)2.73
MYB domain protein 36 (U3)11.39Isopentenyltransferase 3 (U3)2.31
AWPM-19-like family protein (U4)11.00Cytochrome P450 superfamily protein (U4)2.01
Leucine-rich repeat protein kinase family protein (U5)10.85DNA glycosylase superfamily protein (U5)1.94
Late embryogenesis abundant protein (LEA) family protein (U6)10.64Plant invertase/pectin methylesterase inhibitor superfamily (U6)1.82
PEBP (phosphatidylethanolamine-binding protein) family protein (U7)10.52Cytochrome P450, family 76, subfamily C, polypeptide 5 (U7)1.79
Alternative NAD(P)H dehydrogenase 2 (U8)10.48Integrase-type DNA-binding superfamily protein (U8)1.08

InhibitedLight-harvesting chlorophyll B-binding protein 3 (D1)-13.63Binding (D1)-3.51
FASCICLIN-like arabinoogalactan 9 (D2)-12.58IAP-like protein 1 (D2)-2.92
Pectin methylesterase 61 (D3)-12.27Pentatricopeptide repeat (PPR) superfamily protein (D3)-2.88
Alpha carbonic anhydrase 1 (D4)-12.18Protein of unknown function (DUF506) (D4)-3.41
Photosystem I light harvesting complex gene 1 (D5)-12.03Zinc-finger protein 1 (D5)-3.24
Expansin A8 (D6)-11.85UDP-Glycosyltransferase superfamily protein (D6)-1.50
GDSL-like Lipase/Acylhydrolase superfamily protein (D7)-11.52Heat shock protein 18.2 (D7)-1.72
Bifunctional inhibitor/lipid-transfer protein (D8)-9.9017.6kDa class Ⅱ heat shock protein (D8)-1.10

결과 및 고찰

-2°C에서 4일 동안 저온처리한 ‘Campbell Early’와 ‘Muscat Baily A’ 포도나무 잎을 RNA sequencing을 통해 전사체를 분석하였고 DEG를 선발하였다. Transcripts의 평균길이는 85.21 ~ 90.12 bp였으며, 두 품종 모두에서 raw data의 76 ~ 81%가 기존의 data와 비교 가능하였으며 약 2.3 ~ 2.8 Gb의 길이를 분석하였다(Table 1).

DEG는 p-value ≤ 0.01%와 fold change ≥2 이상으로 선발하였으며, Figure 1의 벤다이어그램은 영하의 저온에 반응하여 ‘Campbell Early’와 ‘Muscat Baily A’ 품종에서 공통적으로 또는 특이적으로 annotation된 유전자의 수를 나타내었다. 발현이 2배 이상 유도된 유전자의 수는 ‘Campbell Early’와 ‘Muscat Baily A’에서 5,583개와 419개였으며, 발현이 억제된 유전자의 수는 각각 6,602개와 646개였다. 공통적으로 발현이 유도된 유전자는 250개 억제된 유전자는 65개였으며, 유도된 대표 유전자는 12-oxophytodienoate reductase 2, alpha/beta-hydrolases superfamily protein, cytochrome P450, jasmonate-zim-domain protein 8과 myb domain protein 등이 있으며, 억제된 유전자로는 disease resistance protein, NB-ARC domain-containing disease resistance protein과 tetratricopeptide repeat-like superfamily protein 등이 있다(data not shown). 공통적으로 발현이 5배이상 유도되는 유전자는 9개, 10배이상 발현이 유도되는 유전자 3개이었으나 발현이 억제되는 유전자에서는 공통적으로 나타나는 유전자가 검출되지 않았다.

Figure 1.

Distribution of the genes commonly and specifically expressed in shoots of ‘Campbell Early (CE)’ and ‘Muscat Baily A (MBA)’ grapevines exposed to freezing temperature (-2°C) for 4 days. A, Up-regulated genes; B, Down-regulated genes; C, Statistics of differentially expressed genes


선발한 DEG를 바탕으로 TGICL (TIGR Gene Indices Clustering Tools)을 이용하여 GO를 분석하였다. 유전자는 기능별로 분류하여 3가지 범주(biological process, cellular component, molecular function)로 구분할 수 있었으며 3단계의 수준에서 GO term을 확인하였다(Fig. 2, 3). 영하에서 저온처리 한 ‘Campbell Early’ 품종의 잎에서 발현이 유도되는 유전자군은 biological process에서는 세포 물질대사과정에 관여하는 유전자, cellular component에서는 세포막 또는 세포소기관에 관여하는 유전자가, molecular function에서는 퓨린염기 또는 뉴클레오티드결합에 관여하는 유전자가 가장 풍부하였다. 발현이 억제되는 유전자군을 annotation한 결과 biological process에서는 인, 탄수화물, 지질 대사과정에 관여하는 유전자가, cellular component와 molecular function에서는 발현이 유도되는 유전자와 비슷한 경향을 보였다. ‘Muscat Baily A’ 품종에서도 발현이 유도되는 유전자군을 annotation한 결과 biological process에서는 세포대사의 조절, 신호전달, 지질 대사과정에 관여하는 유전자가, cellular component에서는 막, 세포막에 관여하는 유전자가, molecular function에서는 막간수송활동 관련 유전자가 가장 많았다. 발현이 억제되는 유전자군을 annotation한 결과 biological process에서는 세포 대사과정 관련 유전자가 cellular component에서는 세포막 또는 세포소기관에 관여하는 유전자가, molecular function에서는 퓨린 또는 뉴클레오티드결합에 관여하는 유전자가 가장 많았다. 내한성이 강한 ‘Campbell Early’ 품종과 내한성이 약한 ‘Muscat Bailey A’ 품종간에는 영하의 저온처리에 반응하여 발현되는 유전자군에도 차이를 나타내며 이들이 형질발현과 연관이 있을 것으로 여겨진다.

Figure 2.

GO enrichment of DEGs induced and inhibited 10-fold or more by freezing-treatment in ‘Campbell Early’ grapevines (A; induced genes, B; inhibited genes)


Figure 3.

GO enrichment of DEGs induced and inhibited 10-fold or more by freezing-treatment in ‘Muscat Baily A’ grapevines (A; induced genes, B; inhibited genes)


InterPro Scan을 이용하여 단백질 domain을 분석하였다(Table 2). 두 품종 모두에서 공통적으로 발현이 유도되는 유전자와 일치하는 enzyme은 ubiquitin---protein ligase, non- specific serine/threonine protein kinase, DNA-directed RNA polymerase, DNA helicase가 있으며, 발현이 억제되는 유전자와 일치하는 enzyme은 ubiquitin---protein ligase와 H+- transporting two-sector ATPase가 있었다. 그 중에서 ubiquitin--- protein ligase는 두 품종 모두에서 발현이 유도 또는 억제되는 유전자와 관련이 있었다.

대조구에 비해 영하의 저온 처리구에서 발현이 유도 또는 억제되는 유전자 8개를 선발하였다(Table 3). ‘Campbell Early’에서 발현이 유도되는 유전자는 dehydrin xero 1, K-box region and MADS-box transcription factor family protein, myb domain protein 36 등이 있으며 발현이 억제되는 유전자는 light-harvesting chlorophyll B-binding protein 3, FASCICLIN- like arabinoogalactan 9, pectin methylesterase 61 등이 있었다. 반면 ‘MBA’에서 발현이 유도되는 유전자는 NB-ARC domain-containing disease resistance protein, fatty acid hydroxylase superfamily, isopentenyltransferase 3 등이 있으며 억제되는 유전자는 binding, IAP-like protein 1, Pentatricopeptide repeat (PPR) superfamily protein 등이 있었다.

전사체 분석에서 검출된 DEG 중에서 발현량의 큰 차이를 나타내는 유전자의 발현양상을 확인하기 위하여 전사체에서 얻은 염기서열을 바탕으로 각각의 유전자에 특이적인 프라이머를 제작하였다(Table 4). 유전자 특이적인 프라이머를 이용하여 real-time PCR을 수행한 결과, 전사체 분석과 동일한 양상의 발현을 확인하였다(Fig. 4).

Table 4 . Sequence of primers used for real-time PCR analysis in this study.

NamePrimer sequencesNamePrimer sequences
CE-U1ACATCCTTACCATCCGGAGTCAMBA-U1CAAATAATCCTCAGCGGTGTCC
GCTCGTACCACGTAAAGGATGGGGATGGCAGAGGGTTTTATTCC
CE-U2CCATCCCAAAATGACAATGGATMBA-U2GGATGGGAGCAGCTTAGCAGTA
AAGCTGAAAGGCATTTCGTGAGTGGTTCCTTTTGGAATGCTGTT
CE-U3TTTCACCCTCATAGCAGCAACAMBA-U3TGAGAAACCATGGGAAAAGGAA
TTTCTTGACGTTGGCTTTGTCAATGAAACATCCAAAGCGTCCAT
CE-U4TGTAACCCGGACCATACTTGCTMBA-U4TCCGGATTTTCCTTCCACCTAT
CCCAACTGCTCTACCTCATGCTAAAGAAATCGCTGGTGAAGCTG
CE-U5ATTTGCTCAGCTGGGTGAACTCMBA-U5TGAAACTGCGCTGTTCAGACTC
ACACCTCACCAGTCCACTCCTCGAAAGAAACCTCGAAACGCAGA
CE-U6TTCCTCTGCTGCATTTCTACCCMBA-U6CGGACCGTCTTCCTAAAGACCT
CCTGCGCTTCTGTCATTGTTTACGGGGCCTGTATTCATGTACTC
CE-U7GCTTTGTTCTTCTCCGTTGGAAMBA-U7CTTAGATGGATGGACCCACAGG
GAAGACAGCAGCCAAACATGAAAGCGATTTTCATGGCTATTCCA
CE-U8CACTTGCTTTCCTGTCTGCTCAMBA-U8ATATTCTTTCCCGTGCCACCTT
GGATTGGTGTGGATGAATGGTTGCGGCTCCCATACTTTCTGATA

CE-D1CTTTGTCCAAGCCATCGTTACCMBA-D1AGACGAAGAATTGCCTTTGCAG
AATGGGAATGAAGGGGAAATGTCTTGGGATTGATGACCTTCTGG
CE-D2TCATTCGCCTCCTCGCTACTACMBA-D2TCTCTGAGCACAAGCCAATGAG
TGAGAGGGCATTCAGTGTACCAATTGGTTTGGAAAGCCAAAGGT
CE-D3GCCAGTCAGCTCTCCTCTCATCMBA-D3GGGGAGCTCAAAAACCTCACTT
TGAGGCTGAACTGCACTGAAAGTTCATCATACCCCCGTCATTTC
CE-D4GCAGAGCTGCATCTAGTCCACAMBA-D4GCGGACCACAGCTTTGAGTAGT
GCTCATTGCTTGCACAAACATCGCTGTGGCTCTGAACTCGGTAT
CE-D5GTTTCATGCGAAAACCCAAACTMBA-D5TGTCCTCCCTGTCCCTACAAAA
TCTTGCGTCCATTTTCTCAACATAGTGTCTTGATGCGGCCTACA
CE-D6AAATTTGGACCCCACAGGAAGTMBA-D6ATTCGACATGGAACATCGGTCT
GAAAGTTGCCTCCCAGAGGATTGAAAGAAGTTCGGCGAGTTTGA
CE-D7ATGGCCTCAACATTCCAGACATMBA-D7TGCGAAGATGGATCAAGTCAAA
CCAATTCCAGCAGAAGCAAAGTATGGCCGTCAACCTTCTAATGA
CE-D8GGCAATTACTGCACCCAAATTCMBA-D8AAACCCAACATGGATTTGAGGA
GAAGTCCCATGCCTTTTCAATGGGCAGAGAAGAGTGGAGAATCG

CE, ‘Campbell Early’; MBA, ‘Muscat Baily A’. U, up-regulation; D, down-regulation, Genes amplified by each primer set are listed in Table 3.


Figure 4.

Verification of gene transcripts up-regulated (left) and down-regulated (right) in response to cold treatment in ‘Campbell Early’ (CE) and ‘Muscat Baily A’ (MBA) grapevines by quantitative real-time PCR analysis. Genes amplified by each primer set are listed in Table 3. Each vertical bar indicates the SEs (n = 3)


온도는 식물의 생장과 발달을 제한 할 수 있는 환경요인이며, 저온과 동결온도는 원예작물의 생장에 적합한 지리적 요건을 제한할 뿐만 아니라 생산성에도 영향을 미친다(Thomashow 1999). 포도 재배에서도 저온스트레스는 환경제한 요인이며, 점차적인 기온 감소에는 순응을 하여 겨울철 -15°C의 낮은 온도에도 견딜 수 있지만 급작스런 기온 저하나 내한성 온도 이하로 낮아질 경우에는 눈이나 뿌리조직에 심각한 문제를 발생시킬 수 있다(Fennell 2004; Tillett et al. 2012). 토마토에서도 냉해는 기공 전도도, 생리적반응, 틸라코이드막 지방산 조성, 광합성 속도 등 다양한 기작에서 생리학적 변화를 야기한다(Walker et al. 1991). 또한, 봄보리(Hordeum vulgare), 메도우페스큐(Festuca pratensis), 겨울유채(Brassica napus var. oleifea) 등에 저온 처리를 하면 특정 병원균에 대한 저항성을 유도한다고 보고되었다(Plazek and Zur 2003).

본 연구에서는 ‘Campbell Early’와 ‘Muscat Baily A’ 포도를 영하의 저온에 노출하였을 때 전사체 분석을 통해 DEG를 조사하였다. 영하의 저온에 노출된 ‘Campbell Early’에서 5,583개의 유전자가 발현이 유도되고, 6,602개의 유전자가 억제되었으며, ‘Muscat Baily A’에서는 419개의 유전자가 유도되고, 646개 유전자가 억제되었다. ‘Cabernet Sauvignon’ (V. vinifera) 포도나무는 냉해스트레스에는 2,917개, 염분스트레스에는 1,926개, 수분스트레스에는 2,301개의 유전자가 발현에 큰 변화를 가져왔다(Tattersall et al. 2007). Oono et al. (2006)는 microarray분석을 통해 애기장대에서 저온순화에 의해 445개 유전자발현이 유도되고 341개의 유전자발현이 억제되는 것을 확인하였고, 염분이나 수분부족스트레스보다 냉해에 반응하여 신호전달과 세포이동과 관련이 있는 유전자의 발현이 급변하는 것으로 보고하였다. V. amurensis가 저온에 반응하여 나타낸 DEG를 기능별로 분류하여 물질대사, 수송, 신호전달 및 전사와 관련된 유전자의 발현 비중이 높은 것으로 나타났으며(Xin et al. 2013), ‘Cabernet Sauvignon’에서는 대사, 단백질대사 및 신호전달과 관련된 유전자 발현의 비중이 높았다(Tattersall et al. 2007). 본 연구에서는 두 품종 모두에서 3가지 범주 중 세포구성에서 막과 세포소기관에 관여하는 유전자가 가장 많이 나타났다.

영하의 저온에 특이적인 DEG를 바탕으로 효소를 분석한 결과 유전자의 발현이 유도 또는 억제되는 두 품종 모두에서 ubiquitin-protein ligase와 관련이 있었다. Ubiquitin ligase는 유비퀴틴화와 26S 프로테아좀 경로에 의한 단백질분해에 대한 기질 특이성을 가지는 것으로 알려져 있으며, 애기장대에서 저온 순화하는 동안 ubiquitin ligase에 의해 microRNA393의 발현이 증가하는 것으로 나타났으며 내한성에 대해 긍정적인 조절을 한다는 것을 알 수 있었다(Chinnusamy et al. 2007). Serine/threonine protein kinases는 거대 단백질군으로 세포의 증식, 분화, 생존과 세포반응에 관여하는 것으로 알려져 있으며, 애기장대에서 57개의 유전자군을 확인하였으며 그 중 23개의 유전자군이 저온, 고온 스트레스, 아브시스산, 살리실산 및 높은 삼투압 등의 스트레스에 연관되어 있다고 보고되어 있다(Rudrabhatla et al. 2006). 항산화효소인 peroxidase는 스트레스 반응과 같은 생물학적 기능과 관련이 있으며, 스트레스에 의해 발현이 증가하였으며 형질전환체에서 높은 수준의 내한성을 나타내었다(Koussevitzky et al. 2008).

애기장대에서 저온스트레스에 반응하여 MYB, galactinol, UDP-glucosyl, chalcone과 같은 다양한 유전자들의 발현이 조절되며(Oono et al. 2006), late embryogenesis abundant protein(LEA)은 주로 식물의 배발생 과정에서 건조스트레스 내성을 부여하기 위해 발생되지만 저온순화과정에서도 발현이 유도되는 것으로 알려져 있으며 생체막을 보호하는 기능과 연관되어 있는 것으로 여겨진다(Close 1997). 온주밀감에 저온을 처리하였을 때 저온 스트레스를 받는 동안 nitrate transporter, auxin responsive GH3, UDP- glycosyltransferase (UGT)와 chalcone-flavanone isomerase 등의 유전자 발현이 변화하였다(Huang et al. 2011). Xin et al. (2013)은 저온에 반응하는 V. amurensis에서 발현이 크게 변화하는 유전자군을 확인하였다. 본 연구에서 사용한 두 품종의 포도나무 식물체가 영하의 저온에 노출되었을 때 광합성과 관련된 탄수화물 대사, 방어기작, 전사인자 및 세포벽 관련 유전자가 유도 또는 억제되었는데, 이러한 결과는 다른 식물체에서 저온 스트레스를 처리하였을 때 발현되는 전사체 및 단백질의 정보와 동일하였다.

본 연구에서는 영하의 저온에 대응한 ‘Campbell Early’와 ‘Muscat Bailey A’ 포도나무의 전사체 분석을 통해 저온스트레스와 관련된 특이 유전자를 선발하고 GO를 통해 기능에 따라 분류하였으며, 저온에 대응해 유도 또는 억제되는 유전자를 확인할 수 있었다. 저온 스트레스를 받은 포도 잎의 유전자 발현을 통해 저온 저항성에 대한 기작을 구명하는데 기여하고 유용유전자의 대량 발굴을 통해 내한성 포도 품종의 개발에 이용될 수 있을 것이다.

적요

환경스트레스 중의 하나인 저온에 대한 생육기의 포도나무의 반응을 분석하고자 -2°C에서 4일 동안 저온처리 한 두 품종(‘Campbell Early’와 ‘Muscat Baily A’)의 포도나무 잎을 이용하여 전사체를 분석하였고 특이발현유전자(differentially expressed genes, DEGs)를 검색하였다. 영하의 저온에 반응한 ‘Campbell Early’의 DEG를 기능별로 분석한 결과 생물대사에서 17,424개, 세포구성에서 28,954개, 분자기능에서는 6,972개의 유전자와 관련이 있었다. 발현이 유도되는 유전자로는 dehydrin xero 1, K-box region and MADS-box transcription factor family protein과 MYB domain protein 36이 있으며, 억제되는 유전자로는 light-harvesting chlorophyll B-binding protein 3, FASCICLIN-like arabinoogalactan 9와 pectin methylesterase 61 등이 있었다. ‘Muscat Baily A’ 의 DEG는 생물대사에서 1,157개, 세포구성에서 1,350개, 분자기능에서는 431개의 유전자와 관련이 있었다. 발현이 유도되는 유전자로는 NB-ARC domain-containing disease resistance protein, fatty acid hydrozylase syperfamily와 isopentenyltransferase 3이 있으며, 억제되는 유전자로는 binding, IAP-like protein 1과 pentatricopeptide repeat superfamily protein 등이 있었다. Real-time PCR을 이용하여 영하의 저온에서 특이적으로 발현하는 유전자들을 검정하였으며, InterPro Scan을 통해 단백질 도메인을 분석한 결과 두 품종 모두에서 ubiquitin-protein ligase가 가장 많았다. 영하의 저온에 노출된 신초의 전사체 정보를 바탕으로 포도나무에서 저온 내성을 발현하는 기작을 연하는 데에 분자수준의 정보를 제공하고, 내한성 포도를 육종하는데 이용될 수 있을 것이다.

사사

본 연구는 농촌진흥청 공동연구사업(과제번호:PJ010174)의 지원에 의해 수행되었다.

Fig 1.

Figure 1.

Distribution of the genes commonly and specifically expressed in shoots of ‘Campbell Early (CE)’ and ‘Muscat Baily A (MBA)’ grapevines exposed to freezing temperature (-2°C) for 4 days. A, Up-regulated genes; B, Down-regulated genes; C, Statistics of differentially expressed genes

Journal of Plant Biotechnology 2016; 43: 204-212https://doi.org/10.5010/JPB.2016.43.2.204

Fig 2.

Figure 2.

GO enrichment of DEGs induced and inhibited 10-fold or more by freezing-treatment in ‘Campbell Early’ grapevines (A; induced genes, B; inhibited genes)

Journal of Plant Biotechnology 2016; 43: 204-212https://doi.org/10.5010/JPB.2016.43.2.204

Fig 3.

Figure 3.

GO enrichment of DEGs induced and inhibited 10-fold or more by freezing-treatment in ‘Muscat Baily A’ grapevines (A; induced genes, B; inhibited genes)

Journal of Plant Biotechnology 2016; 43: 204-212https://doi.org/10.5010/JPB.2016.43.2.204

Fig 4.

Figure 4.

Verification of gene transcripts up-regulated (left) and down-regulated (right) in response to cold treatment in ‘Campbell Early’ (CE) and ‘Muscat Baily A’ (MBA) grapevines by quantitative real-time PCR analysis. Genes amplified by each primer set are listed in Table 3. Each vertical bar indicates the SEs (n = 3)

Journal of Plant Biotechnology 2016; 43: 204-212https://doi.org/10.5010/JPB.2016.43.2.204

Table 1 . Statistical data of trimmed reads.

PairNo. of readsLength average (bp)Sum (bp)Average sum (bp)
‘Campbell Early’-control28,557,44185.212,433,447,74076.69%
‘Campbell Early’-treated25,903,00489.922,329,203,26380.00%
‘MBA’-control27,553,48490.122,483,252,35781.08%
‘MBA’-treated32,101,86689.612,876,749,30681.07%

Treated, grapevines were kept at -2°C for 4 days; MBA, ‘Muscat Baily A’.


Table 2 . Up- and down-regulated DEGs related to enzymes identified by UniprotKB in low temperature-treated grapevines.

GrapevineUp-regulatedDown-regulated

EC??EnzymeNo. of DEGsEC??EnzymeNo. of DEGs
Campbell6.3.2.19Ubiquitin---protein ligase152.7.11.1Non-specific serine/threonine protein kinase16
Early 2.7.11.1Non-specific serine/threonine protein kinase126.3.2.19Ubiquitin---protein ligase13
2.7.7.6DNA-directed RNA polymerase111.11.1.7Peroxidase12
3.6.4.12DNA helicase82.4.1.207Xyloglucan:xyloglucosyl transferase11
3.6.4.13RNA helicase73.6.3.14H+-transporting two-sector ATPase9
3.1.2.15Ubiquitin thiolesterase73.5.5.1Nitrilase8
3.6.3.14H+-transporting two-sector ATPase63.5.5.4Cyanoalanine nitrilase8
2.7.1.40Pyruvate kinase61.6.99.3NADH dehydrogenase7
3.1.3.16Protein-serine/threonine phosphatase53.2.1.21Beta-glucosidase7
2.7.7.7DNA-directed DNA polymerase51.6.5.3NADH:ubiquinone reductase (H+-translocating)6

MBA 6.3.2.19Ubiquitin---protein ligase13.1.2.15Ubiquitin thiolesterase3
2.7.7.6DNA-directed RNA polymerase16.3.2.19Ubiquitin---protein ligase1
3.6.4.13RNA helicase12.7.7.6DNA-directed RNA polymerase1
3.6.3.14H+-transporting two-sector ATPase13.6.4.13RNA helicase1
2.7.11.1Non-specific serine/threonine protein kinase13.6.3.14H+-transporting two-sector ATPase1

MBA, 'Muscat Baily A'.


Table 3 . The 8 genes highly induced and inhibited in ‘Campbell Early’ and ‘Muscat Baily A’ grapevines exposed to chilling- temperature for 4 days.

Campbell EarlyMuscat Baily A

GeneFold ChangeGeneFold Change
InducedDehydrin xero 1 (U1)14.64NB-ARC domain-containing disease resistance protein (U1)2.85
K-box region and MADS-box transcription factor family protein (U2)11.60Fatty acid hydroxylase superfamily (U2)2.73
MYB domain protein 36 (U3)11.39Isopentenyltransferase 3 (U3)2.31
AWPM-19-like family protein (U4)11.00Cytochrome P450 superfamily protein (U4)2.01
Leucine-rich repeat protein kinase family protein (U5)10.85DNA glycosylase superfamily protein (U5)1.94
Late embryogenesis abundant protein (LEA) family protein (U6)10.64Plant invertase/pectin methylesterase inhibitor superfamily (U6)1.82
PEBP (phosphatidylethanolamine-binding protein) family protein (U7)10.52Cytochrome P450, family 76, subfamily C, polypeptide 5 (U7)1.79
Alternative NAD(P)H dehydrogenase 2 (U8)10.48Integrase-type DNA-binding superfamily protein (U8)1.08

InhibitedLight-harvesting chlorophyll B-binding protein 3 (D1)-13.63Binding (D1)-3.51
FASCICLIN-like arabinoogalactan 9 (D2)-12.58IAP-like protein 1 (D2)-2.92
Pectin methylesterase 61 (D3)-12.27Pentatricopeptide repeat (PPR) superfamily protein (D3)-2.88
Alpha carbonic anhydrase 1 (D4)-12.18Protein of unknown function (DUF506) (D4)-3.41
Photosystem I light harvesting complex gene 1 (D5)-12.03Zinc-finger protein 1 (D5)-3.24
Expansin A8 (D6)-11.85UDP-Glycosyltransferase superfamily protein (D6)-1.50
GDSL-like Lipase/Acylhydrolase superfamily protein (D7)-11.52Heat shock protein 18.2 (D7)-1.72
Bifunctional inhibitor/lipid-transfer protein (D8)-9.9017.6kDa class Ⅱ heat shock protein (D8)-1.10

Table 4 . Sequence of primers used for real-time PCR analysis in this study.

NamePrimer sequencesNamePrimer sequences
CE-U1ACATCCTTACCATCCGGAGTCAMBA-U1CAAATAATCCTCAGCGGTGTCC
GCTCGTACCACGTAAAGGATGGGGATGGCAGAGGGTTTTATTCC
CE-U2CCATCCCAAAATGACAATGGATMBA-U2GGATGGGAGCAGCTTAGCAGTA
AAGCTGAAAGGCATTTCGTGAGTGGTTCCTTTTGGAATGCTGTT
CE-U3TTTCACCCTCATAGCAGCAACAMBA-U3TGAGAAACCATGGGAAAAGGAA
TTTCTTGACGTTGGCTTTGTCAATGAAACATCCAAAGCGTCCAT
CE-U4TGTAACCCGGACCATACTTGCTMBA-U4TCCGGATTTTCCTTCCACCTAT
CCCAACTGCTCTACCTCATGCTAAAGAAATCGCTGGTGAAGCTG
CE-U5ATTTGCTCAGCTGGGTGAACTCMBA-U5TGAAACTGCGCTGTTCAGACTC
ACACCTCACCAGTCCACTCCTCGAAAGAAACCTCGAAACGCAGA
CE-U6TTCCTCTGCTGCATTTCTACCCMBA-U6CGGACCGTCTTCCTAAAGACCT
CCTGCGCTTCTGTCATTGTTTACGGGGCCTGTATTCATGTACTC
CE-U7GCTTTGTTCTTCTCCGTTGGAAMBA-U7CTTAGATGGATGGACCCACAGG
GAAGACAGCAGCCAAACATGAAAGCGATTTTCATGGCTATTCCA
CE-U8CACTTGCTTTCCTGTCTGCTCAMBA-U8ATATTCTTTCCCGTGCCACCTT
GGATTGGTGTGGATGAATGGTTGCGGCTCCCATACTTTCTGATA

CE-D1CTTTGTCCAAGCCATCGTTACCMBA-D1AGACGAAGAATTGCCTTTGCAG
AATGGGAATGAAGGGGAAATGTCTTGGGATTGATGACCTTCTGG
CE-D2TCATTCGCCTCCTCGCTACTACMBA-D2TCTCTGAGCACAAGCCAATGAG
TGAGAGGGCATTCAGTGTACCAATTGGTTTGGAAAGCCAAAGGT
CE-D3GCCAGTCAGCTCTCCTCTCATCMBA-D3GGGGAGCTCAAAAACCTCACTT
TGAGGCTGAACTGCACTGAAAGTTCATCATACCCCCGTCATTTC
CE-D4GCAGAGCTGCATCTAGTCCACAMBA-D4GCGGACCACAGCTTTGAGTAGT
GCTCATTGCTTGCACAAACATCGCTGTGGCTCTGAACTCGGTAT
CE-D5GTTTCATGCGAAAACCCAAACTMBA-D5TGTCCTCCCTGTCCCTACAAAA
TCTTGCGTCCATTTTCTCAACATAGTGTCTTGATGCGGCCTACA
CE-D6AAATTTGGACCCCACAGGAAGTMBA-D6ATTCGACATGGAACATCGGTCT
GAAAGTTGCCTCCCAGAGGATTGAAAGAAGTTCGGCGAGTTTGA
CE-D7ATGGCCTCAACATTCCAGACATMBA-D7TGCGAAGATGGATCAAGTCAAA
CCAATTCCAGCAGAAGCAAAGTATGGCCGTCAACCTTCTAATGA
CE-D8GGCAATTACTGCACCCAAATTCMBA-D8AAACCCAACATGGATTTGAGGA
GAAGTCCCATGCCTTTTCAATGGGCAGAGAAGAGTGGAGAATCG

CE, ‘Campbell Early’; MBA, ‘Muscat Baily A’. U, up-regulation; D, down-regulation, Genes amplified by each primer set are listed in Table 3.


References

  1. Alonso-Blanco C, and Koornneef M. (2000) Naturally occurring variation in Arabidopsis:an underexploited resource for plant genetics. Trends Plant Sci 5, 22-29.
    CrossRef
  2. Anders S, and Huber W. (2010) Differential expression analysis for sequence count data. Genome Biol 11, R106.
    CrossRef
  3. Barah P, Jayavelu ND, Rasmussen S, Nielsen HB, Mundy J, and Bones AM. (2013) Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes. BMC Genomics 14, 722.
    Pubmed KoreaMed CrossRef
  4. Chang S, Puryear J, and Cairney J. (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol 11, 113-116.
    CrossRef
  5. Chiang CM, Kuo WS, and Lin KH. (2014) Cloning and gene expression analysis of sponge gourd ascorbate peroxidase gene and winter squash superoxide dismutase gene under respective flooding and chilling stresses. Hort Environ Biotechnol 55, 129-137.
    CrossRef
  6. Chinnusamy V, Zhu J, and Zhu JK. (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci 12, 444-451.
    Pubmed CrossRef
  7. Cho HY, Hwang SG, Kim DS, and Jang CS. (2012) Genome-wide transcriptome analysis of rice genes responsive to chilling stress. Can J Plant Sci 92, 447-460.
    CrossRef
  8. Close TJ. (1997) Dehydrins:A commomnality in the response of plants to dehydration and low temperature. Physiol Plant 100, 291-296.
    CrossRef
  9. Cox MP, Peterson DA, and Biggs PJ. (2010) SolexaQA:At-a-glance quality assessment of Illumina second-generation sequencing data. BMC Bioinformatics 11, 485.
    Pubmed KoreaMed CrossRef
  10. Cramer GR, Erg?l A, Grimplet J, Tillett RL, Tattersall EA, Bohlman MC, Vincent D, Sonderegger J, Evans J, Osborne C, Quilici D, Schlauch K, Schooley D, and Cushman J. (2007) Water and salinity stress in grapevines:early and late changes in transcript and metabolite profiles. Funct Integr Genomics 7, 111-134.
    Pubmed CrossRef
  11. Fennell A. (2004) Freezing tolerance and injury in grapevines. J Crop Improvement 10, 201-235.
    CrossRef
  12. Fuller MP, and Telli G. (1999) An investigation of the frost hardiness of grapevine (Vitis vinifera) during bud break. Annu Appl Biol 135, 589-595.
    CrossRef
  13. Hemstad PR, and Luby JJ. (2000) Utilization of Vitis riparia for the development of new wine varieties with resistance to disease and extreme cold. Acta Hortic 528, 487-490.
    CrossRef
  14. Huang DW, Sherman BT, and Lempicki RA. (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57.
    Pubmed CrossRef
  15. Huang W, Li L, Myers JR, and Marth GT. (2012) ART:A next- generation sequencing read simulator. Bioinformatics 28, 593-594.
    Pubmed KoreaMed CrossRef
  16. Huang Y, Si Y, and Dane F. (2011) Impact of grafting on cold responsive gene expression in Satsuma mandarin (Citrus unshiu). Euphytica 177, 25-32.
    CrossRef
  17. Hur YY, Jung SM, and Yun HK. (2015) Current status and prospects of genomics and bioinformatics in grapes. J Plant Biotechnol 42, 298-311.
    CrossRef
  18. Kim SA, Ahn SY, Han JH, Kim SH, Noh JH, and Yun HK. (2013) Differential expression screening of defense related genes in dormant buds of cold-treated grapevines. Plant Breed Biotech 1, 14-23.
    CrossRef
  19. Koussevitzky S, Suzuki N, Huntington S, Armijo L, Sha W, Cortes D, Shulaev X, and Mittler R. (2008) Ascorbate peroxidase 1 plays a key role in the response of Arabidopsis thaliana to stress combination. J Biol Chem 283, 34197-34203.
    Pubmed KoreaMed CrossRef
  20. Kwon YA, Kwon WT, Boo KO, and Choi Y. (2007) Future projections on subtropical climate regions over south Korea using SRES A1B data. J Korean Geogr Soc 42, 355-367.
  21. Lee GH, Yu JG, and Park YD. (2015) Time-based expression networks of genes related to cold stress in Brassica rapa ssp pekinensis. Korean J Hortic Sci Technol 33, 114-123.
    CrossRef
  22. Liu GT, Wang JF, Cramer G, Dai ZW, Duan W, Xu HG, Wu BH, Fan PG, Wang LJ, and Li SH. (2012) Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress. BMC Plant Biol 12, 174.
    Pubmed KoreaMed CrossRef
  23. Luby JJ, Mansfield AK, Hemstad PR, and Beam BA. (2003) Development and evaluation of cold hardy wine grape breeding selections and cultivars in the upper Midwest. AVERN Report .
  24. Luedeling E, Girvetz EH, Semenov MA, and Brown PH. (2011) Climate change affects winter chill for temperature fruit and nut trees. PLoS ONE 6, e20155.
    Pubmed KoreaMed CrossRef
  25. Ma YY, Zhang YL, Shao H, and Lu J. (2010) Differential physio- biochemical responses to cold stress of cold-tolerant and non-tolerant grape (Vitis L.) from china. J Agron Crop Sci 196, 212-219.
    CrossRef
  26. Mahajan S, and Tuteja N. (2005) Cold, salinity and drought stresses:an overview. Arch Biochem Biophys 444, 139-158.
    Pubmed CrossRef
  27. Oono Y, Seki M, Satoum M, Iida K, Akiyama K, Sakurai T, Fujita M, Yamaguchi-Shinozaki K, and Shinozaki K. (2006) Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays. Funct Integr Genomics 6, 212-234.
    Pubmed CrossRef
  28. Plazek A, and Zur I. (2003) Cold-induced plant resistance to necrotrophic pathogens and antioxidant enzyme activities and cell membrane permeability. Plant Sci 164, 1019-1028.
    CrossRef
  29. Rudrabhatla P, Reddy MM, and Rajasekharan R. (2006) Genome-wide analysis and experimentation of plant serine/threonine/ tyrosine-specific protein kinases. Plant Mol Biol 60, 293-319.
    Pubmed CrossRef
  30. Sanghera GS, Wani SH, Hussain W, and Singh NB. (2011) Engineering cold stress tolerance in crop plants. Curr Genomics 12, 30-43.
    Pubmed KoreaMed CrossRef
  31. Seo HH, and Park HS. (2003) Fruit quality of ‘Tsugaru’ apples influenced by meteorological elements. Korean J Agric Forest Meteorol 5, 218-225.
  32. Tattersall EA, Grimplet J, DeLuc L, Wheatley MD, Vincent D, Osborne C, Ergul A, Lomen E, Blank RR, Schlauch KA, Cushman JC, and Cramer GR. (2007) Transcript abundance profiles reveal larger and more complex responses of grapevine to chilling compared to osmotic and salinity stress. Funct Integr Genomics 7, 317-333.
    Pubmed CrossRef
  33. Thomashow MF. (1999) Plant cold acclimation:Freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol 50, 571-599.
    Pubmed CrossRef
  34. Tillett RL, Wheatley MD, Tattersall EA, Schlauch KA, Cramer GR, and Cushman JC. (2012) The Vitis vinifera C-repeat binding protein 4 (VvCBF4) transcriptional factor enhances freezing tolerance in wine grape. Plant Biotechnol J 10, 105-124.
    Pubmed KoreaMed CrossRef
  35. Walker MA, McKersie BD, and Pauls KP. (1991) Effects of chilling on the biochemical and functional properties of thylakoid membranes. Plant Physiol 97, 663-669.
    Pubmed KoreaMed CrossRef
  36. Wu J, Zhang Y, Zhang H, Huang H, Folta KM, and Lu J. (2010) Whole genome wide expression profiles of Vitis amurensis grape responding to downy mildew by using Solexa sequencing technology. BMC Plant Biol 10, 234.
    Pubmed KoreaMed CrossRef
  37. Xin H, Zhu W, Wang L, Xiang Y, Fang L, Li J, Sun X, Wang N, Londo J, and Li S. (2013) Genome wide transcriptional profile analysis of Vitis amurensis and Vitis vinifera in response to cold stress. PLoS ONE 8, e58740.
    CrossRef
  38. Xu J. (2014). Next-generation sequencing:Current technologies and applications . Caister Academic Press, Ontario, Canada.
  39. Yoon ST, Lee YH, Hong SH, Kim MH, Kang KK, Na YE, and Oh YJ. (2013) Vulnerability assessment of cultivation facility by abnormal weather of climate change. Korean J Agric Forest Meteorol 15, 264-272.
    CrossRef
  40. Zhou D, Zhou J, Meng L, Wang Q, Xie H, Guan Y, Ma Z, Zhong Y, Chen F, and Liu j. (2009) Duplication and adaptive evolution of the COR15 genes within the highly cold-tolerant Draba lineage (Brassicaceae). Gene 441, 36-44.
    Pubmed CrossRef
JPB
Vol 51. 2024

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download