Research Article

Split Viewer

J Plant Biotechnol 2016; 43(3): 367-375

Published online September 30, 2016

https://doi.org/10.5010/JPB.2016.43.3.367

© The Korean Society of Plant Biotechnology

Microsatellite 마커를 이용한 옥수수 품종 및 자식 계통에 대한 DNA Fingerprinting 분석

권용삼*

동아대학교 생명자원과학대학 분자유전공학과

Received: 26 July 2016; Revised: 16 August 2016; Accepted: 24 August 2016

DNA fingerprinting analysis of maize varieties and parental lines using microsatellite markers

Yong-Sham Kwon*

Department of Molecular Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea

Correspondence to : e-mail: yskwon3@dau.ac.kr

Received: 26 July 2016; Revised: 16 August 2016; Accepted: 24 August 2016

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

In the present study, we conducted genetic characterization of 90 commercial maize varieties and parental lines using microsatellite markers. Thirteen microsatellite markers were selected from 100 primer pairs in the maize genome data on the basis of polymorphism information contents (PIC) value and distinct amplification products. These markers detected 5 to 24 alleles, with an average of 13.69. The mean PIC value was 0.865 and ranged from 0.716 to 0.942. The unweighted pair-group method with arithmetical average (UPGMA) analysis was conducted for constructing the dendrogram using Jaccard’s genetic similarity coefficient. The genetic similarity varied from 0.07 to 0.824. Thirteen microsatellite markers identified all 90 maize varieties and parental lines. The maize varieties were clustered into 5 major groups consistent with type and pedigree information. The microsatellite profile database of maize varieties could be used to select comparative varieties through genetic relationship analysis between existing varieties and candidate varieties in distinctness tests.

Keywords DNA profile data base, Genetic diversity, Molecular marker, Simple sequence repeat, Variety identification

옥수수는 C4 식물로 광합성 능력이 우수하기 때문에 단위 면적당 생산량이 높을 뿐만 아니라 재배가 용이하며 전분의 주요 공급원으로 활용되기 때문에 의약품, 화장품, 바이오 에탄올, 식품 산업 등에서 아주 중요한 작물의 하나이다. 세계 옥수수 생산량은 2013년 기준 9억 6,732만 톤이며 미국이 전세계 생산량의 37%인 3억 5,352만 톤을 생산하고 있다. 우리나라의 경우 옥수수의 1인당 연간 소비량이 2014년 기준 8.1 kg이며 사료용을 제외한 자급도는 4.2%에 불과하기 때문에 연간 10,242천톤을 수입하고 있는 실정이다(http://www.mafra.go.kr).

옥수수의 품종 개량 방법은 과거에는 주로 집단선발이나 계통 집단선발 방법을 이용하여 육성된 품종이 재배되었으나, 최근에는 우수한 자식계통을 육성하여 이들을 양친으로 단교잡한 품종이 육성 보급되고 있다. 따라서 우리나라에서 재배되는 옥수수 품종은 2016년 6월 30일 현재 생산수입판매 신고된 238건과 농촌진흥청, 지방자치단체, 육종회사, 대학, 개인육종가 등이 품종보호출원 및 등록한 133품종이 시중에 유통되고 있다(http://www.seed.go.kr).

신품종에 대한 배타적인 권리를 확보하기 위하여 품종보호 출원을 하면 형태적 특성 조사에 의해 신품종과 대조품종을 비교 분석하여 구별성, 균일성 및 안정성을 판단하게 된다. 신품종 심사에 활용될 대조품종의 선정은 기존 품종에 대한 특성 조사 데이터베이스를 활용하여 형태적으로 가장 유사한 품종을 선정하거나 육종가가 제시한 품종을 주로 활용하게 된다. 그러나 옥수수의 신품종 특성 조사에 활용된 형질 중 대부분이 환경의 영향을 많이 받는 양적형질이기 때문에 재배방법 및 환경에 따른 특정 형질의 연차간 변이, 조사자의 주관 등 여러 가지 문제점이 발생하여 정확한 대조품종의 선정이 단순하지 않았다. 이러한 문제점을 해결할 수 있는 방안이 분자생물학적 기법을 활용하여 품종별 DNA 프로파일 데이터베이스를 구축하여 식물신품종보호제도에 활용하는 것이다. 국제식물신품종보호동맹(International union for the protection of new varieties of plants; UPOV)에서는 DNA 프로파일 데이터베이스 작성에 대한 국제적 표준화를 이루기 위하여 유전자 분석 기법, 마커의 선정 기준, DNA 분리 방법 등에 대한 가이드라인을 제시하고 있다(UPOV, 2010). 따라서 UPOV 회원국들은 게놈내 염기서열분석에 기반하여 개발된 유전자 분석 방법인 simple sequence repeat (SSR) 및 single nucleotide polymorphism (SNP) 검정 기술을 활용하여 품종별 데이터베이스를 구축하고 이를 품종보호제도에 이용하고 있다. 실제로 우리나라 국립종자원에서도 고추(Kwon et al. 2013), 멜론(Kwon and Hong 2014), 오이(Kwon and Choi 2013), 무(Bae et al. 2015) 등과 같은 채소류를 중심으로 품종별 DNA 프로파일 데이터베이스를 구축하고 이를 품종보호출원 품종의 대조품종이나 품종진위성과 관련된 종자 분쟁에 적극적으로 이용하여 큰 성과를 거두고 있다. 옥수수의 경우 지금까지 농촌진흥청과 강원도 농업기술원 옥수수시험장에서 찰옥수수 자식계통의 유전적 변이성(Jung et al. 2006; Park et al. 2009), 색소 옥수수 계통에 대한 계통간 유연관계 분석(Kim et al. 2012), 색소 및 비색소 옥수수 핵심집단의 유전분석(Kim et al. 2015)에 microsatellite 마커를 활용한 연구 결과가 보고되고 있다. 그러나 우리나라 옥수수 품종 및 계통에 대하여 microsatellite 분석 기법과 자동염기서열분석기를 활용하여 품종별 DNA 프로파일 데이터베이스를 구축하고 품종간 유전적 연관성 및 품종식별력 정도 등에 대하여 분석한 연구 결과는 거의 없는 실정이다.

따라서 본 연구에서는 microsatellite 마커를 활용하여 우리나라 옥수수 품종별 데이터베이스를 구축하기 위하여, 품종보호 출원 및 등록된 옥수수 90품종을 공시하여 품종 식별력이 우수한 핵심 마커의 선정 및 이를 활용한 유전적 유연관계 분석을 통한 품종식별력 검정 등에 대한 일련의 연구를 수행하여 얻어진 연구결과를 보고하는 바이다.

공시품종 및 DNA 추출

본 연구에서는 ‘횡성옥’ 등 90개 품종 및 자식 계통의 옥수수 종자를 공시재료로 선정하였다(Table 1). Safe-Lock 2.0 ml 튜브(Cat. W129549M, Eppendorf, USA)에 공시 품종의 종자 3립과 파쇄용 텅스텐 구슬을 넣고 분쇄기(Pulverisette 6, Fritsch)를 이용하여 시료를 마쇄하였다. 시료 300 mg을 2.0 ml 튜브에 옮긴 다음 NucleoSpin®Plant II(Cat. 740 770.250, Macherey- Nagel GmbH & Co., KG, Deutsch) 를 이용하여 genomic DNA를 분리 하였다. 추출된 DNA는 2.0% 아가로스젤에서 전기 영동하여 DNA 농도를 확인한 후 μl당 10 ng의 농도로 희석하여 polymerase chain reaction (PCR) 분석에 활용하였다.

Table 1 . The 90 maize varieties and parental lines assayed for genetic characterization using microsatellite markers

No Variety name Parentage Sources
1HoengseongokKS15/KS16//KS5Rural Development Administration
2Tuygimok1hoKP1/KP2Rural Development Administration
3MibaekchalHW3/HW4Rural Development Administration
4Chalok3hoKW7/KW35Rural Development Administration
5SinchalokKW36/KW1Rural Development Administration
6Danok3hoKSS2/KSS22Rural Development Administration
7Chalok2hoKW7/KW3Rural Development Administration
8SuwonokKS117/KS7rhmRural Development Administration
9KS7rhmInbred line (Selection of Bulk-2-2-4-1)Rural Development Administration
10KS117Inbred line (Selection of Fla2Bt73Bulk-2-5-2-4)Rural Development Administration
11KW3Inbred line (Selection of Gosungjaeraejong)Rural Development Administration
12KW7Inbred line(Selection of Pyeongchangjaeraejong)Rural Development Administration
13DB544Inbred lineRural Development Administration
14GeumdanokKSS14/KSS19Rural Development Administration
15DumechalHW1/KW7Gangwon-Do
16HeugjeomchalKL103/KW7Rural Development Administration
17DuruokKS7/KS7rhmRural Development Administration
18KwangpyeongokKS124/KS85Rural Development Administration
19KwanganokGa209/DB544Rural Development Administration
20CheonganokKS121/KS118Rural Development Administration
21PungmiokKS121/KS139Rural Development Administration
22Danok2hoKSS3/KSS4Rural Development Administration
23JangdaokKS5/KS135Rural Development Administration
24NC+6440UnknownNonghyup
25P32K61UnknownNonghyup
26Kyungdaechal1HoKS7/KNUW2Kyungpook National University
27Kyungdaechal2hoKNUW1/KNUW3Kyungpook National University
28Satangok1hoSH5/SH8Kyungpook National University
29Satangok2hoSH5/SH8Kyungpook National University
30Kyungdae19chalKNUW5/KNUW6Kyungpook National University
31TongilchalKW7/KNUW1Kyungpook National University
32Jangwonchal1ho2026F1/2101-7-6-5-4Jeil
33Jangwonchal2ho2115-3-2-5-3/2141-4-5-4-3Jeil
34MiheugchalHW7/HW8Gangwon-Do
35CheongsaokKS55/KS131Rural Development Administration
36Chalok4hoKW33/KW35Rural Development Administration
37GangdaokKS140/KS141Rural Development Administration
38IlmichalKW51/KW35Rural Development Administration
39SuokchalUnknownKim, Jae-Hwa
40Golden cross bantam70UnknownUSA
41Alrokichal1ho3/5Jeil
42Chalok1h0KW1/KW2Rural Development Administration
43GangilokHF1/HF2Gangwon-Do
44JomichalHW5/HW6Gangwon-Do
45Mibaek2hoHW9/HW3Gangwon-Do
46Yeonnong2hoYNCR-3/YNCR4Choi, Bong-Ho
47Jaheukchal1ho2/4Jeil
48HoneycornSH4/SH8Kyungpook National University
49Kyungdae19chalKS5wx/KS6wxKyungpook National University
50KeumdeongeorichodangUnknownJeil
51Jeilheukchal1hoUnknownJeil
52Cambella 90UnknownKoregon
53Kyungdaesilage2hoKNU51B/KNUP45Kyungpook National University
54KW51Inbred line(Selection of China germplasm)Rural Development Administration
55KW35Inbred line(Selection of Yeonnong1ho)Rural Development Administration
56KW33Inbred line(Selection of China germplasm)Rural Development Administration
57Daehakchalgold1hoYeongdeogjaerae/OkcheonjaeraeChungnam National University
58Eolrukchal1hoKBW23/KW33Gangwon-Do
59HP1Inbred line(Selection of Korea germplasm)Gangwon-Do
60HP2Inbred line(Selection of Korea germplasm)Gangwon-Do
61HP3Inbred line(Selection of Korea germplasm)Gangwon-Do
62HP4Inbred line(Selection of Korea germplasm)Gangwon-Do
63HP6Inbred line(Selection of Korea germplasm)Gangwon-Do
64HP7Inbred line(Selection of Korea germplasm)Gangwon-Do
65Yeonnong1hoUnknownNongwoo
66PyeonganokKS140/KS94Rural Development Administration
67HeukjinjuchalKBW24/KBW2Rural Development Administration
68JosaengdaehakheukchalUnknownJeil
69JosaengdaehakchalUnknownJeil
70Speeddaehakchal1hoUnknownJeil
71W1480CUnknownNonghyup
72K-PopUnknownAsia
73JosaengalrokidaehakchalUnknownJeil
74JosaengheukjeomdaehakchalUnknownJeil
75Jangwonchal3hoUnknownJeil
76SunnychocolatUnknownDongbu
77HarmonychocolatUnknownDongbu
78HF1Inbred line(Selection of USA germplasm)Gangwon-Do
79HF2Inbred line[Selection of USA germplasm(N2BE/B73)]Gangwon-Do
80HW3Inbred line(Selection of W9060/A632wx)Gangwon-Do
81HW4Inbred line(Selection of Ansungjaeraejong)Gangwon-Do
82HW6Inbred line(Selection of WPE)Gangwon-Do
83HW7Inbred line(Selection of Yanggujaeraejong)Gangwon-Do
84HW8Inbred line(Selection of Hwacheonjaeraejong)Gangwon-Do
85HW9Inbred line(Selection of Jewon/Bosung//KW7Gangwon-Do
86KL103Inbred line(Selection of Gochang)Gangwon-Do
87HW1Inbred line(Selection of Wonju)Gangwon-Do
88Heugjeom2hoHW10/KW7Gangwon-Do
89ArichalHW12/HW11Gangwon-Do
90Daehakpopcorn1hoUnknownLee, Won-Gu

Microsatellite 분석

우리나라 옥수수의 품종지문화에 적합한 microsatellite 분자 마커를 선발하기 위하여, 국제 옥수수 게놈 데이터베이스의 정보(www.maizedb.org)를 기초하여 선정된 40개와 중국에서 옥수수 품종별 fingerprinting 분석(Wang et al. 2011)에 활용된 60개를 활용하였다. 총 100개의 프라이머 정방향에 형광물질(FAM, VIC, NED, PET)로 각각 표지한 다음 이를 DNA 프로파일 데이터베이스를 구축에 이용하였다. PCR증폭에 사용된 용액의 조성은 50 ng의 genomic DNA, 0.1 μM의 정방향 및 역방향microsatellite primer, 2.0 μl dNTP mixture (2.5 mM), 2.5 μl 10×PCR buffer (50 mM KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl2), 0.5U의 HS Prime Taq polymerase (G-7000, Genet Bio, Korea)에 초순수를 첨가하여 전체 부피를 30μl로 조절하였다. PCR 증폭은 94°C에서 5분간 pre- denaturation을 한 후, 94°C에서 30초간 denaturation, 55°C에서 30초간 annealing, 72°C에서 45초간 extension을 40cycle 수행하고, final extension을 72°C에 10분간 실시하였다. 자동염기서열분석기(Genetic Analyzer 3730XL, Applied Biosystems, Foster, USA)를 활용하여 전기 영동 하기 위하여, PCR 증폭 산물 1.0 μl와 deionized formamide 10 μl, size marker (LIZ500 size standard) 0.25 μl를 혼합한 다음PCR기기(C1000, BioRad, USA)를 이용하여 94°C에서 2분간 전처리 하였다. Microsatellite 마커에 의해 증폭된 대립 유전자의 크기는 GeneMapper (version 4.1) 프로그램(Applied Biosystems, Foster, USA)을 이용하여 분석하였다.

유전적 유연관계 분석 및 품종식별력 검정

공시된 옥수수 품종의 microsatellite 마커의 다형성 정도를 조사하기 위하여, Anderson 등(1993)이 제시한 공식에 준하여 polymorphism information content (PIC) 값을 산출하였다. 아래 공식에서 Pij는 마커 i의 밴드들 중에서 j번째 공통 밴드 패턴의 빈도수이다.

PIC=1-i=1npi2

그리고 NTSYSpc (version 2.10b) (Rohlf 2000) 프로그램을 이용하여 Jaccard 방법에 따라 유전적 유사도 값을 계산하였으며, 군집분석은 unweighted pair-group method with arithmetical average (UPGMA) (Sneath and Sokal 1973) 방법으로 수행한 다음 계통도를 작성하고 옥수수 품종에 따른 유전적 유연관계를 분석하였다.

Microsatellite 분석

우리나라 옥수수 품종의 fingerprinting에 적합한 microsatellite 마커를 선정하기 위하여, 국제 옥수수 게놈 데이터베이스 (www.maizedb.org)에서 다형성이 높은 것으로 알려진 40개와 중국에서 옥수수 품종식별에 활용된 60개의 프라이머 정방향에 형광물질(FAM, VIC, NED, PET)을 표지하여 우리나라에서 유통되고 있는 ‘횡성옥’ 등 90품종과 PCR을 수행하였다. 자동염기서열분석기 3730XL을 이용하여 전기영동 하였을 때 100개의 프라이머 가운데 13개를 제외한 87개의 프라이머의 경우 다형성 정도는 높으나 대립유전자의 밴드 양상이 복잡하여 분석자의 주관에 따라 대립유전자의 크기를 오판할 우려가 있어 이를 데이터 분석에 제외하였다. 최종 선정된 13개의 마커는 옥수수 10개의 염색체중에서 3, 4, 9번 염색체를 제외한 나머지 7개의 염색체에 고르게 분포하였다. 따라서 대립유전자의 특성이 우수한 13개와 우리나라에서 육성 보급되고 있는 옥수수 90개 품종 및 자식 계통에 대한 다형성 정도를 조사한 바(Table 2), microsatellite 프라이머에 따라 검출된 대립유전자의 수는 5 ~ 22개로 다양하게 나타났으며 총 178개의 대립유전자가 검출되었고, 마커 당 평균 대립유전자의 수는 13.69개로 분석되었다. Microsatellite 마커의 유전적 다형성 정도를 나타내는 지수인 PIC 값은 0.716 ~ 0.942까지 높은 범위에서 분포하였으며, 평균값도 0.865로 아주 높은 경향을 보였다. 옥수수 품종식별에 활용된 13개의 microsatellite 마커 가운데 umc1125y3과 bnlg1025y4를 제외한 11개의 마커가 0.80 이상의 높은 PIC 값을 나타내었다. 본 연구에서 옥수수 품종 지문화 작업에 최종 활용된 microsatellite 마커의 수는 작지만 각 마커 별로 나타내는 대립유전자 수와 PIC 값이 아주 높기 때문에 우리나라에서 육성된 옥수수 품종식별 및 품종별 유전적 근연 관계를 분석하는데 효과적일 것으로 사료되었다.

Table 2 . Repeat motif, number of alleles, and polymorphism information content (PIC) value of microsatellite markers selected for genetic characterization of 90 maize varieties and parental lines

 SSR designation Primer sequenceRepeat motifChromosome numberAnnealing temp.Product size (bp)No. of allelesPIC value
bnlg439w1F: FAM-AGTTGACATCGCCATCTTGGTGAC(TC)155320-371160.897
R: GAACAAGCCCTTAGCGGGTTGTC
umc1705w1F: FAM-GGAGGTCGTCAGATGGAGTTCG(CT)555258-334160.898
R: CACGTACGGCAATGCAGACAAG
bnlg161k8F: NED-TCTCAGCTCCTGCTTATTGCTTTCG(AG)655145-216220.928
R: GATGGATGGAGCATGAGCTTGC
bnlg1702k1F: PET-GATCCGCATTGTCAAATGACCAC(CT)655266-317210.907
R: AGGACACGCCATCGTCATCA
umc1545y2F: FAM-AATGCCGTTATCATGCGATGC(AAGA)755186-24180.823
R: GCTTGCTGCTTCTTGAATTGCGT
umc1125y3F: VIC-GGATGATGGCGAGGATGATGTC(CTCG)755150-17350.748
R: CCACCAACCCATACCCATACCAG
bnlg240k1F: NED-GCAGGTGTCGGGGATTTTCTC(GA)855219-24190.882
R: GGAACTGAAGAACAGAAGGCATTGATAC
bnlg1671y17F: PET-CCCGACACCTGAGTTGACCTG(CT)155177-250200.942
R: CTGGAGGGTGAAACAAGAGCAATG
umc1536k9F: FAM-TGATAGGTAGTTAGCATATCCCTGGTATCG(GT)(TA)255222-29680.835
R: GAGCATAGAAAAAGTTGAGGTTAATATGGAGC
bnlg1025y4F: VIC-CTCTCCTCACGCCAACTTAATCTGTG(AG)155148-205100.716
R: GTGACTCCTAAGCTCGCCGAATAA
umc1127k1F: PET-CCCCCCTCCCTAATTTTGCTTC(AG)655182-226130.883
R: GCACATCTTACGGATCTAGCTGGACTG
bnlg162k2F: FAM-GGCTCACGTCCGTATCCAAACC(CT)855232-299150.890
R: TCAGTTCAGGTCCGTCGTCCAG
bnlg1712k17F: NED-CGATTTCACGGCTCGTGGC(GA)1055256-293150.892
R: GAAAATACCCTTGGTTCTCCTTCCTGG

Total17811.240

Mean13.690.865

Microsatellite 마커에 따른 옥수수 90개 품종 및 자식 계통에 대한 대립유전자의 분포 빈도 양상을 조사한 바(Fig. 1), bn1g161k8은 대립유전자의 크기가 145 bp에서 216 bp 사이에 총 22개의 대립유전자가 검출되었으며, 대립유전자의 크기가 165 bp와 183 bp에서 각각 16.8%와 18.7%의 다소 높은 빈도분포 양상을 나타내었으나, 나머지는 0.7%에서 7.1%까지 대립유전자가 고르게 분포하는 양상을 나타내었다. bn1g1671y17의 경우도 177 bp에서 250 bp 사이에 총 20개의 대립유전자가 검출되었는데 특정 대립유전자의 크기에 공시품종이 편중되지 않고 대립유전자의 크기에 따라 0.7 ~ 16.6%의 빈도분포 양상을 나타내었다.

Fig. 1.

Histogram depicting the alleles at 2 microsatellite loci, bn1g161k8 (A) and bn1g1671y17 (B). Base-pair size (abscissa) and the frequency at each allele (ordinate) detected by 90 maize varieties and parental lines


우리나라 옥수수 품종 및 계통에 대한 microsatellite 마커를 활용하여 분석한 연구는 Jung 등(2006)이 농촌진흥청에서 육성된 찰옥수수의 자식계통의 주요 품질특성과 관련된 SSR 마커를 선발하기 위하여 64개의 찰옥수수 자식계통에 대하여 30개의 SSR 마커로 분석하였을 때 평균 7.5개의 대립유전자가 확인되고 평균 PIC 값이 0.69임을 보고한 이후, Park 등(2009)은 강원도 농업기술원 옥수수시험장에서 육성된 찰옥수수 품종의 교배친 11계통을 50개의 SSR 마커로 검정시 평균 대립유전자의 수가 3.4이며 gene diversity는 0.596으로 나타남을 보고하였다. Kim 등(2012)은 SSR 마커에 의한 색소옥수수 24계통과 비색소 계통 7계통에 대하여 유전적 다형성을 조사하였을 때, 평균 5.6개의 대립유전자가 검출되었고 평균 PIC 값이 0.62임을 보고하였다. 그러나 본 연구에서 활용된 microsatellite 마커의 경우 평균대립유전자가 13.69개이고 평균 PIC 값이 0.865로 높게 나타나 Jung 등(2006)과 Park 등(2009)Kim 등(2012)이 보고한 연구결과와 다른 양상을 나타내었다. 이러한 이유는 본 연구에서 분석한 옥수수 품종은 찰옥수수, 단옥수수, 초당옥수수, 팝콘용 옥수수 등 다양한 유형의 품종을 유전자 분석에 활용하였을 뿐만 아니라 이전에 연구자들은 주로 PCR 분석 산물을 아크릴아마이드 젤 전기영동에 의해 분석하였으나 본 연구에서는 자동염기서열분석기를 활용하였기 때문에 아크릴아마이드 젤 분석에서 검출이 불가능하였던 대립유전자의 확인이 가능했기 때문이라 판단된다. 한편, Wang 등 (2011)이 중국과 미국에서 수집된 옥수수 231개의 자식계통을 60개의 microsatellite 마커로 분석하였을 때 평균 대립유전자의 수(8.95개) 보다 본 연구의 평균 대립유전자의 수가 13.69개로 높은 경향을 나타났다. 중국의 경우 옥수수 자식계통만 분석하였으나 본 연구에서는 다양한 용도로 육성된 옥수수 F1 품종 66개와 자식계통 24개에 대하여 품종식별력이 아주 우수한 13개의 microsatellite를 선발하여 품종지문화에 이용했기 때문에 나타난 결과라고 사료된다.

품종식별력 검정 및 유전적 유사도 분석

옥수수 품종 및 계통 90개에 대한 microsatellite 분석에서 대립유전자의 패턴이 우수하고 PIC 값이 0.70 이상인 마커를 선발하고 이를 활용하여 군집분석에 의한 계통도를 작성한 바(Fig. 2), 공시된 품종 및 계통에 대한 전체 유사도 지수는0.07 ~ 0.82로 나타났고, 유전적 유사도 지수 0.14에서 공시된 계통 및 품종은 5개의 대그룹으로 구분되었다. 그리고 공시된 모든 품종과 계통들은 microsatellite 마커의 유전자형에 의해 뚜렷하게 식별이 가능한 것으로 나타났다.

Fig. 2.

Dendrogram depicting the classification of 90 maize varieties and parental lines constructed using unweighted pair-group method with arithmetical average (UPGMA) and based on microsatellite markers. The scale at the bottom is Jaccard’s coefficient of similarity


Microsatellite 마커의 유전자형에 따라 군집분석 하였을 때 I그룹은 찰옥수수, 팝콘용 옥수수, 단 및 초당 옥수수 등 38개 품종 및 계통이 그룹화되었다. I그룹을 유전적 유사도 지수 0.16에서 4개의 소그룹으로 다시 구분할 수 있었다. I-1 소그룹에는 ‘횡성옥’ 등 21품종이 분포하였다. 육종기관별로 보면 농촌진흥청에서 육성된 ‘횡성옥’ 등 13품종과 강원도 농업기술원 옥수수시험장에서 육성된 ‘강일옥’과 이 품종의 양친으로 활용된 ‘HF1’과 ‘HF2’ 계통이 하나의 소그룹화 되었다. 그리고 경북대에서 육성된 ‘경대찰’과 ‘경대사일리지2호’와 충남대에서 육성된 ‘대학찰골드1호’가 속하였다. 특이하게 사일리지용 옥수수인 ‘경대사일리지2호’는 독립적인 하나의 품종군으로 그룹화되지 않은 양상을 나타내었는데 이러한 원인은 품종 육성과정에 교배모본으로 활용된 계통중에 찰옥수수의 유전적 특성을 어느 정도 가지고 있기 때문에 나타난 결과라고 추정되며 향후 이러한 품종 유형의 양친 및 F1에 대하여 깊이 있는 연구가 수행되어야 될 것으로 사료된다. I-2 그룹에는 ‘연농1호’의 후대에서 선발한 ‘KW35’와 중국 유전자원에서 선발한 ‘KW51’ 및 이 계통을 활용하여 육성된 ‘일미찰’이 속하였고, 제일종묘에서 육성한 ‘조생대학흑찰’이 포함되었다. I-3 그룹은 팝콘용 옥수수인 ‘튀김옥1호’와 초당 옥수수인 ‘사탕옥1호’, ‘사탕옥2호’, ‘허니콘’, ‘금덩어리초당’, ‘캠벨라90’, ‘하모니쇼콜라’, ‘써니쇼콜라’와 단옥수수인 ‘금단옥’, ‘단옥2호’, ‘단옥3호’, ‘골든크로스반탐70’이 속하였고 I-4 그룹은 사료용으로 미국에서 수입되고 있는 ‘W1480C’ 한 품종이 독립적으로 그룹화 되었다. 한편, 팝콘용 옥수수인 ‘튀김옥1호’가 단옥수수와 초당옥수수와 동일 그룹에 속하였다. 이 원인은 팝콘용 옥수수와 단 및 초당 옥수수 품종의 경우 양친으로 활용된 계통이 주로 미국에서 도입된 종을 고정하여 사용하였기 때문인 것으로 추정된다.

II그룹에는 ‘미백찰’ 등 44품종이 그룹화 되었고 유사도 지수 0.25에서 8개의 소그룹으로 세분할 수 있었다. II-1은 농촌진흥청에서 육성한 ‘신찰옥’과 ‘찰옥1호’, 강원도농업기술원에서 육성한 ‘미백찰’ 등 5품종, 제일종묘에서 육성한 ‘스피드대학찰1호’ 등 4품종, 개인 육종가에 의해 육성된 ‘수옥찰’ 등 3품종이 포함되었다. II-2는 자식 계통인 ‘KW3’과 ‘KW7’과 이들이 모본이나 부본으로 활용되어 육성된 ‘찰옥3호’, ‘두메찰’, ‘찰옥2호’가 소그룹화 되었다. II-3은 ‘흑점찰’ 등 8품종이 속하였는데 유전적 유사도 지수 0.26에서 종피의 색깔이 흑색인 ‘흑점찰’ 등 4품종과 경북대에서 육성된 ‘경대찰1호’ 등 4품종이 다시 소그룹화 되었다. II-4는 강원도 농업기술원에서 육성된 종피의 색깔이 흑색인 ‘미흑찰’과 ‘흑점2호’ 및 자식 계통인 ‘HW7’과 ‘HW8’이 포함되었고, II-5에는 팝콘용 옥수수인 ‘케이팝’과 ‘대학팝콘1호’가 속하였다. II-6은 제일종묘에서 육성한 ‘장원찰1호’ 등 5품종과 농촌진흥청과 강원도 농업기술원에서 육성한 자식계통 ‘KW33’ 및 이 계통을 양친으로 활용한 ‘찰옥4호’와 ‘얼룩찰1호’가 포함되었다. II-7은 강원도 농업기술원 옥수수시험장에서 ‘W9060’과 ‘A632wx’ 조합에서 순계 분리하여 양성된 ‘HW3’이 속하였고, II-8은 찰옥수수 조생 모집단 ‘WPE’에서 순계 분리한 ‘HW6’과 이 계통이 부본으로 사용되어 양성된 ‘조미찰’ 품종이 그룹화되었다.

III 그룹에는 강원도 농업기술원 옥수수시험장에서 팝콘용 옥수수의 교배친으로 활용되고 있는 ‘HP1’ 등 6계통이 속하였으며, IV 그룹은 강원도 원주지역에서 수집하여 교배친으로 양성한 계통 ‘HW1’ 한 계통이 그룹핑되었고, V 그룹은 ‘광안옥’의 부본으로 사용된 ‘DB544’ 계통이 속하였다.

이상의 연구 결과를 종합해보면 본 연구에 활용된 13개의 microsatellite 마커는 옥수수 90개 품종 및 계통에 대하여 옥수수 품종 유형 및 품종 육성 계보에 따라 뚜렷하게 그룹화되는 경향을 보였기 때문에, 이는 옥수수 품종간 유연관계 설정을 통한 유전자원의 특성 평가에 매우 유용하게 이용될 수 있을 것으로 판단된다. 그리고 13개의 microsatellite 마커에 의하여 공시품종 및 계통들이 완전하게 식별이 가능한 것으로 나타나 옥수수 품종 진위성과 관련된 종자분쟁, 농업 생산물과 관련된 도난 사건, 종자의 순도검정 등에 보조적인 수단으로 활용이 가능할 것이다. 한편, 본 연구에서는 자동염기서열분석기를 활용하여 작성된 microsatellite DNA 데이터베이스이기 때문에 신품종이 육성되면 해당 품종만 microsatellite 분석하여 기 구축된 옥수수 품종별 데이터베이스와 비교하면 신품종의 유전적 거리 예측이 가능하기 때문에 육종효율을 향상에 크게 기여할 뿐만 아니라 옥수수 유전자원의 보호 및 품종보호제도 등과 같은 신지식재산권 강화에 활용도가 높을 것으로 판단된다.

최근 차세대염기서열분석기를 이용하여 염색체 내의 SNP 염기서열 변이를 탐색하고 이를 마커로 개발하면 자동화를 통한 대량 분석이 가능하기 때문에 옥수수 품종 식별에 소요되는 시간, 비용, 노력을 절감시킬 수 있는 장점이 있다(Tian et al. 2015). 따라서, 우리나라 옥수수 품종 식별용 SNP 마커가 개발되고, 본 연구에서 microsatellite 마커에 의해 구축된 DNA 데이터베이스와 상호 비교하여 그 효율성이 분석된다면 옥수수 품종 확인의 정확도는 한층 더 높아질 것으로 사료된다.

국내에서 육성된 옥수수 90 품종 및 자식 계통에 대하여 microsatellite 마커를 활용하여 DNA 프로파일 데이터베이스를 구축한 다음 공시품종에 따른 유전적 유사도 분석 및 품종식별력 검정에 대한 연구를 수행하였다. 옥수수 90품종을 100개의 microsatellite 마커로 검정하고 대립유전자의 패턴이 우수하고 다형성 정도가 높은 13개를 선정하여 분석하였을 때 대립유전자의 수는 5 ~ 24개까지 다양하게 분포하였고 평균 대립유전자의 수는 13.69개로 높았다. PIC 값의 경우도 0.716 ~ 0.942 범위에 속하였고 평균값은 0.865로 아주 높았다. 옥수수 90품종 및 계통에 대하여 UPGMA 분석에 의한 계통도를 작성하였을 때, 옥수수의 품종 유형 및 품종 육성 계보에 따라 5개의 대그룹으로 나누어졌다.

본 연구에서 구축됨 옥수수 자식계통 및 품종별 microsatellite DNA 프로파일 데이터베이스는 신품종과 기 육성된 품종과 유전적 유사도 분석이 가능하기 때문에 품종보호출원시 대조품종 선정 및 품종진위성과 관련된 종자분쟁에 매우 유용하게 활용될 수 있을 것이다.

이 논문은 동아대학교 교내연구비 지원에 의하여 연구되었음.

  1. Anderson JA, Churchill CA, Autrique JE, Tanksley SD, and Sorrells ME. (1993) Optimizing parental selection for genetic-linkage maps. Genome 36, 181-186.
    Pubmed CrossRef
  2. Bae KM, Sim SC, Hong JH, Choi KJ, Kim DH, and Kwon YS. (2015) Development of genomic SSR markers and genetic diversity analysis in cultivated radish (Raphanus sativus L.). Hortic Environ Biotechnol 56, 216-224.
    CrossRef
  3. Jung TW, Moon HY, Son BY, Kim SL, and Kim SK. (2006) SSR markers related to major characteristics affected kernel quality in waxy corn inbred lines. Korean J Crop Sci 51S , 185-192.
  4. Kim BW, Sa KJ, Park KJ, Park JY, and Lee JK. (2015) Genetic analysis of core sets of colored maize and non-colored maize inbred lines using SSR markers. Korean J Breed Sci 47, 54-62.
    CrossRef
  5. Kim BW, Sa KJ, Choi SH, Park JY, Park JY, and Lee JK. (2012) Analysis of the genetic relationship and population structure for colored maize lines using SSR markers. Korean J Breed Sci 44, 301-311.
  6. Kim JY, Moon JC, Baek SB, Kwon YU, Song GT, and Lee BM. (2014) Genetic improvement of maize by marker-assisted breeding. Korean J Crop Sci 59, 109-127.
    CrossRef
  7. Kwon YS, and Choi KJ. (2013) Construction of a DNA profile database for commercial cucumber (Cucumis sativus L.) cultivars using microsatellite markers. Kor J Hort Sci Technol 31, 344-351.
    CrossRef
  8. Kwon YS, and Hong JH. (2014) Use of microsatellite markers to identify commercial melon cultivars and for hybrid seed purity testing. Korean J Hortic Sci Technol 32, 525-534.
    CrossRef
  9. Kwon YS, Hong JH, and Choi KJ. (2013) Construction of a microsatellite marker database of commercial pepper cultivars. Korean J Hortic Sci Technol 31, 580-589.
    CrossRef
  10. Park JS, Sa KJ, Park KJ, Jang JS, and Lee JK. (2009) Genetic variation of parental inbred lines for Korean waxy corn hybrid varieties revealed by SSR markers. Korean J Breed Sci 41, 106-114.
  11. Rohlf F.J. (2000). NTSYSpc:Numerical taxonomy and multivariate analysis system, ver. 2.10b . Applied Biostatistics Inc, New York.
  12. Sneath P.H.A, and Sokal R.R. (1973). Numerical taxonomy:The principles and practice of numerical classification . San Francisco, Freeman W.H.
  13. Tian HL, Wang FG, Zhao JR, Yi HM, Wang L, Wang R, Tang Y, and Song W. (2015) Development of maizeSNP3072, a high- throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Mol Breeding 35, 136.
    Pubmed KoreaMed CrossRef
  14. ., UPOV (2010). Guideline for DNA-profiling:molecular marker Selection and Database Construction (“BMT Guideline”) , Geneva. Switzerland.
  15. Wang FG, Tian HL, Zhao JR, Yi HM, Wang L, and Song W. (2011) Development and characterization of a core set of SSR markers for fingerprinting analysis of Chinese maize varieties. Maydica 56, 7-17.

Article

Research Article

J Plant Biotechnol 2016; 43(3): 367-375

Published online September 30, 2016 https://doi.org/10.5010/JPB.2016.43.3.367

Copyright © The Korean Society of Plant Biotechnology.

Microsatellite 마커를 이용한 옥수수 품종 및 자식 계통에 대한 DNA Fingerprinting 분석

권용삼*

동아대학교 생명자원과학대학 분자유전공학과

Received: 26 July 2016; Revised: 16 August 2016; Accepted: 24 August 2016

DNA fingerprinting analysis of maize varieties and parental lines using microsatellite markers

Yong-Sham Kwon*

Department of Molecular Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea

Correspondence to: e-mail: yskwon3@dau.ac.kr

Received: 26 July 2016; Revised: 16 August 2016; Accepted: 24 August 2016

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

In the present study, we conducted genetic characterization of 90 commercial maize varieties and parental lines using microsatellite markers. Thirteen microsatellite markers were selected from 100 primer pairs in the maize genome data on the basis of polymorphism information contents (PIC) value and distinct amplification products. These markers detected 5 to 24 alleles, with an average of 13.69. The mean PIC value was 0.865 and ranged from 0.716 to 0.942. The unweighted pair-group method with arithmetical average (UPGMA) analysis was conducted for constructing the dendrogram using Jaccard’s genetic similarity coefficient. The genetic similarity varied from 0.07 to 0.824. Thirteen microsatellite markers identified all 90 maize varieties and parental lines. The maize varieties were clustered into 5 major groups consistent with type and pedigree information. The microsatellite profile database of maize varieties could be used to select comparative varieties through genetic relationship analysis between existing varieties and candidate varieties in distinctness tests.

Keywords: DNA profile data base, Genetic diversity, Molecular marker, Simple sequence repeat, Variety identification

서론

옥수수는 C4 식물로 광합성 능력이 우수하기 때문에 단위 면적당 생산량이 높을 뿐만 아니라 재배가 용이하며 전분의 주요 공급원으로 활용되기 때문에 의약품, 화장품, 바이오 에탄올, 식품 산업 등에서 아주 중요한 작물의 하나이다. 세계 옥수수 생산량은 2013년 기준 9억 6,732만 톤이며 미국이 전세계 생산량의 37%인 3억 5,352만 톤을 생산하고 있다. 우리나라의 경우 옥수수의 1인당 연간 소비량이 2014년 기준 8.1 kg이며 사료용을 제외한 자급도는 4.2%에 불과하기 때문에 연간 10,242천톤을 수입하고 있는 실정이다(http://www.mafra.go.kr).

옥수수의 품종 개량 방법은 과거에는 주로 집단선발이나 계통 집단선발 방법을 이용하여 육성된 품종이 재배되었으나, 최근에는 우수한 자식계통을 육성하여 이들을 양친으로 단교잡한 품종이 육성 보급되고 있다. 따라서 우리나라에서 재배되는 옥수수 품종은 2016년 6월 30일 현재 생산수입판매 신고된 238건과 농촌진흥청, 지방자치단체, 육종회사, 대학, 개인육종가 등이 품종보호출원 및 등록한 133품종이 시중에 유통되고 있다(http://www.seed.go.kr).

신품종에 대한 배타적인 권리를 확보하기 위하여 품종보호 출원을 하면 형태적 특성 조사에 의해 신품종과 대조품종을 비교 분석하여 구별성, 균일성 및 안정성을 판단하게 된다. 신품종 심사에 활용될 대조품종의 선정은 기존 품종에 대한 특성 조사 데이터베이스를 활용하여 형태적으로 가장 유사한 품종을 선정하거나 육종가가 제시한 품종을 주로 활용하게 된다. 그러나 옥수수의 신품종 특성 조사에 활용된 형질 중 대부분이 환경의 영향을 많이 받는 양적형질이기 때문에 재배방법 및 환경에 따른 특정 형질의 연차간 변이, 조사자의 주관 등 여러 가지 문제점이 발생하여 정확한 대조품종의 선정이 단순하지 않았다. 이러한 문제점을 해결할 수 있는 방안이 분자생물학적 기법을 활용하여 품종별 DNA 프로파일 데이터베이스를 구축하여 식물신품종보호제도에 활용하는 것이다. 국제식물신품종보호동맹(International union for the protection of new varieties of plants; UPOV)에서는 DNA 프로파일 데이터베이스 작성에 대한 국제적 표준화를 이루기 위하여 유전자 분석 기법, 마커의 선정 기준, DNA 분리 방법 등에 대한 가이드라인을 제시하고 있다(UPOV, 2010). 따라서 UPOV 회원국들은 게놈내 염기서열분석에 기반하여 개발된 유전자 분석 방법인 simple sequence repeat (SSR) 및 single nucleotide polymorphism (SNP) 검정 기술을 활용하여 품종별 데이터베이스를 구축하고 이를 품종보호제도에 이용하고 있다. 실제로 우리나라 국립종자원에서도 고추(Kwon et al. 2013), 멜론(Kwon and Hong 2014), 오이(Kwon and Choi 2013), 무(Bae et al. 2015) 등과 같은 채소류를 중심으로 품종별 DNA 프로파일 데이터베이스를 구축하고 이를 품종보호출원 품종의 대조품종이나 품종진위성과 관련된 종자 분쟁에 적극적으로 이용하여 큰 성과를 거두고 있다. 옥수수의 경우 지금까지 농촌진흥청과 강원도 농업기술원 옥수수시험장에서 찰옥수수 자식계통의 유전적 변이성(Jung et al. 2006; Park et al. 2009), 색소 옥수수 계통에 대한 계통간 유연관계 분석(Kim et al. 2012), 색소 및 비색소 옥수수 핵심집단의 유전분석(Kim et al. 2015)에 microsatellite 마커를 활용한 연구 결과가 보고되고 있다. 그러나 우리나라 옥수수 품종 및 계통에 대하여 microsatellite 분석 기법과 자동염기서열분석기를 활용하여 품종별 DNA 프로파일 데이터베이스를 구축하고 품종간 유전적 연관성 및 품종식별력 정도 등에 대하여 분석한 연구 결과는 거의 없는 실정이다.

따라서 본 연구에서는 microsatellite 마커를 활용하여 우리나라 옥수수 품종별 데이터베이스를 구축하기 위하여, 품종보호 출원 및 등록된 옥수수 90품종을 공시하여 품종 식별력이 우수한 핵심 마커의 선정 및 이를 활용한 유전적 유연관계 분석을 통한 품종식별력 검정 등에 대한 일련의 연구를 수행하여 얻어진 연구결과를 보고하는 바이다.

재료 및 방법

공시품종 및 DNA 추출

본 연구에서는 ‘횡성옥’ 등 90개 품종 및 자식 계통의 옥수수 종자를 공시재료로 선정하였다(Table 1). Safe-Lock 2.0 ml 튜브(Cat. W129549M, Eppendorf, USA)에 공시 품종의 종자 3립과 파쇄용 텅스텐 구슬을 넣고 분쇄기(Pulverisette 6, Fritsch)를 이용하여 시료를 마쇄하였다. 시료 300 mg을 2.0 ml 튜브에 옮긴 다음 NucleoSpin®Plant II(Cat. 740 770.250, Macherey- Nagel GmbH & Co., KG, Deutsch) 를 이용하여 genomic DNA를 분리 하였다. 추출된 DNA는 2.0% 아가로스젤에서 전기 영동하여 DNA 농도를 확인한 후 μl당 10 ng의 농도로 희석하여 polymerase chain reaction (PCR) 분석에 활용하였다.

Table 1 . The 90 maize varieties and parental lines assayed for genetic characterization using microsatellite markers.

No Variety name Parentage Sources
1HoengseongokKS15/KS16//KS5Rural Development Administration
2Tuygimok1hoKP1/KP2Rural Development Administration
3MibaekchalHW3/HW4Rural Development Administration
4Chalok3hoKW7/KW35Rural Development Administration
5SinchalokKW36/KW1Rural Development Administration
6Danok3hoKSS2/KSS22Rural Development Administration
7Chalok2hoKW7/KW3Rural Development Administration
8SuwonokKS117/KS7rhmRural Development Administration
9KS7rhmInbred line (Selection of Bulk-2-2-4-1)Rural Development Administration
10KS117Inbred line (Selection of Fla2Bt73Bulk-2-5-2-4)Rural Development Administration
11KW3Inbred line (Selection of Gosungjaeraejong)Rural Development Administration
12KW7Inbred line(Selection of Pyeongchangjaeraejong)Rural Development Administration
13DB544Inbred lineRural Development Administration
14GeumdanokKSS14/KSS19Rural Development Administration
15DumechalHW1/KW7Gangwon-Do
16HeugjeomchalKL103/KW7Rural Development Administration
17DuruokKS7/KS7rhmRural Development Administration
18KwangpyeongokKS124/KS85Rural Development Administration
19KwanganokGa209/DB544Rural Development Administration
20CheonganokKS121/KS118Rural Development Administration
21PungmiokKS121/KS139Rural Development Administration
22Danok2hoKSS3/KSS4Rural Development Administration
23JangdaokKS5/KS135Rural Development Administration
24NC+6440UnknownNonghyup
25P32K61UnknownNonghyup
26Kyungdaechal1HoKS7/KNUW2Kyungpook National University
27Kyungdaechal2hoKNUW1/KNUW3Kyungpook National University
28Satangok1hoSH5/SH8Kyungpook National University
29Satangok2hoSH5/SH8Kyungpook National University
30Kyungdae19chalKNUW5/KNUW6Kyungpook National University
31TongilchalKW7/KNUW1Kyungpook National University
32Jangwonchal1ho2026F1/2101-7-6-5-4Jeil
33Jangwonchal2ho2115-3-2-5-3/2141-4-5-4-3Jeil
34MiheugchalHW7/HW8Gangwon-Do
35CheongsaokKS55/KS131Rural Development Administration
36Chalok4hoKW33/KW35Rural Development Administration
37GangdaokKS140/KS141Rural Development Administration
38IlmichalKW51/KW35Rural Development Administration
39SuokchalUnknownKim, Jae-Hwa
40Golden cross bantam70UnknownUSA
41Alrokichal1ho3/5Jeil
42Chalok1h0KW1/KW2Rural Development Administration
43GangilokHF1/HF2Gangwon-Do
44JomichalHW5/HW6Gangwon-Do
45Mibaek2hoHW9/HW3Gangwon-Do
46Yeonnong2hoYNCR-3/YNCR4Choi, Bong-Ho
47Jaheukchal1ho2/4Jeil
48HoneycornSH4/SH8Kyungpook National University
49Kyungdae19chalKS5wx/KS6wxKyungpook National University
50KeumdeongeorichodangUnknownJeil
51Jeilheukchal1hoUnknownJeil
52Cambella 90UnknownKoregon
53Kyungdaesilage2hoKNU51B/KNUP45Kyungpook National University
54KW51Inbred line(Selection of China germplasm)Rural Development Administration
55KW35Inbred line(Selection of Yeonnong1ho)Rural Development Administration
56KW33Inbred line(Selection of China germplasm)Rural Development Administration
57Daehakchalgold1hoYeongdeogjaerae/OkcheonjaeraeChungnam National University
58Eolrukchal1hoKBW23/KW33Gangwon-Do
59HP1Inbred line(Selection of Korea germplasm)Gangwon-Do
60HP2Inbred line(Selection of Korea germplasm)Gangwon-Do
61HP3Inbred line(Selection of Korea germplasm)Gangwon-Do
62HP4Inbred line(Selection of Korea germplasm)Gangwon-Do
63HP6Inbred line(Selection of Korea germplasm)Gangwon-Do
64HP7Inbred line(Selection of Korea germplasm)Gangwon-Do
65Yeonnong1hoUnknownNongwoo
66PyeonganokKS140/KS94Rural Development Administration
67HeukjinjuchalKBW24/KBW2Rural Development Administration
68JosaengdaehakheukchalUnknownJeil
69JosaengdaehakchalUnknownJeil
70Speeddaehakchal1hoUnknownJeil
71W1480CUnknownNonghyup
72K-PopUnknownAsia
73JosaengalrokidaehakchalUnknownJeil
74JosaengheukjeomdaehakchalUnknownJeil
75Jangwonchal3hoUnknownJeil
76SunnychocolatUnknownDongbu
77HarmonychocolatUnknownDongbu
78HF1Inbred line(Selection of USA germplasm)Gangwon-Do
79HF2Inbred line[Selection of USA germplasm(N2BE/B73)]Gangwon-Do
80HW3Inbred line(Selection of W9060/A632wx)Gangwon-Do
81HW4Inbred line(Selection of Ansungjaeraejong)Gangwon-Do
82HW6Inbred line(Selection of WPE)Gangwon-Do
83HW7Inbred line(Selection of Yanggujaeraejong)Gangwon-Do
84HW8Inbred line(Selection of Hwacheonjaeraejong)Gangwon-Do
85HW9Inbred line(Selection of Jewon/Bosung//KW7Gangwon-Do
86KL103Inbred line(Selection of Gochang)Gangwon-Do
87HW1Inbred line(Selection of Wonju)Gangwon-Do
88Heugjeom2hoHW10/KW7Gangwon-Do
89ArichalHW12/HW11Gangwon-Do
90Daehakpopcorn1hoUnknownLee, Won-Gu

Microsatellite 분석

우리나라 옥수수의 품종지문화에 적합한 microsatellite 분자 마커를 선발하기 위하여, 국제 옥수수 게놈 데이터베이스의 정보(www.maizedb.org)를 기초하여 선정된 40개와 중국에서 옥수수 품종별 fingerprinting 분석(Wang et al. 2011)에 활용된 60개를 활용하였다. 총 100개의 프라이머 정방향에 형광물질(FAM, VIC, NED, PET)로 각각 표지한 다음 이를 DNA 프로파일 데이터베이스를 구축에 이용하였다. PCR증폭에 사용된 용액의 조성은 50 ng의 genomic DNA, 0.1 μM의 정방향 및 역방향microsatellite primer, 2.0 μl dNTP mixture (2.5 mM), 2.5 μl 10×PCR buffer (50 mM KCl, 20 mM Tris-HCl, pH 8.0, 2.0 mM MgCl2), 0.5U의 HS Prime Taq polymerase (G-7000, Genet Bio, Korea)에 초순수를 첨가하여 전체 부피를 30μl로 조절하였다. PCR 증폭은 94°C에서 5분간 pre- denaturation을 한 후, 94°C에서 30초간 denaturation, 55°C에서 30초간 annealing, 72°C에서 45초간 extension을 40cycle 수행하고, final extension을 72°C에 10분간 실시하였다. 자동염기서열분석기(Genetic Analyzer 3730XL, Applied Biosystems, Foster, USA)를 활용하여 전기 영동 하기 위하여, PCR 증폭 산물 1.0 μl와 deionized formamide 10 μl, size marker (LIZ500 size standard) 0.25 μl를 혼합한 다음PCR기기(C1000, BioRad, USA)를 이용하여 94°C에서 2분간 전처리 하였다. Microsatellite 마커에 의해 증폭된 대립 유전자의 크기는 GeneMapper (version 4.1) 프로그램(Applied Biosystems, Foster, USA)을 이용하여 분석하였다.

유전적 유연관계 분석 및 품종식별력 검정

공시된 옥수수 품종의 microsatellite 마커의 다형성 정도를 조사하기 위하여, Anderson 등(1993)이 제시한 공식에 준하여 polymorphism information content (PIC) 값을 산출하였다. 아래 공식에서 Pij는 마커 i의 밴드들 중에서 j번째 공통 밴드 패턴의 빈도수이다.

PIC=1-i=1npi2

그리고 NTSYSpc (version 2.10b) (Rohlf 2000) 프로그램을 이용하여 Jaccard 방법에 따라 유전적 유사도 값을 계산하였으며, 군집분석은 unweighted pair-group method with arithmetical average (UPGMA) (Sneath and Sokal 1973) 방법으로 수행한 다음 계통도를 작성하고 옥수수 품종에 따른 유전적 유연관계를 분석하였다.

결과 및 고찰

Microsatellite 분석

우리나라 옥수수 품종의 fingerprinting에 적합한 microsatellite 마커를 선정하기 위하여, 국제 옥수수 게놈 데이터베이스 (www.maizedb.org)에서 다형성이 높은 것으로 알려진 40개와 중국에서 옥수수 품종식별에 활용된 60개의 프라이머 정방향에 형광물질(FAM, VIC, NED, PET)을 표지하여 우리나라에서 유통되고 있는 ‘횡성옥’ 등 90품종과 PCR을 수행하였다. 자동염기서열분석기 3730XL을 이용하여 전기영동 하였을 때 100개의 프라이머 가운데 13개를 제외한 87개의 프라이머의 경우 다형성 정도는 높으나 대립유전자의 밴드 양상이 복잡하여 분석자의 주관에 따라 대립유전자의 크기를 오판할 우려가 있어 이를 데이터 분석에 제외하였다. 최종 선정된 13개의 마커는 옥수수 10개의 염색체중에서 3, 4, 9번 염색체를 제외한 나머지 7개의 염색체에 고르게 분포하였다. 따라서 대립유전자의 특성이 우수한 13개와 우리나라에서 육성 보급되고 있는 옥수수 90개 품종 및 자식 계통에 대한 다형성 정도를 조사한 바(Table 2), microsatellite 프라이머에 따라 검출된 대립유전자의 수는 5 ~ 22개로 다양하게 나타났으며 총 178개의 대립유전자가 검출되었고, 마커 당 평균 대립유전자의 수는 13.69개로 분석되었다. Microsatellite 마커의 유전적 다형성 정도를 나타내는 지수인 PIC 값은 0.716 ~ 0.942까지 높은 범위에서 분포하였으며, 평균값도 0.865로 아주 높은 경향을 보였다. 옥수수 품종식별에 활용된 13개의 microsatellite 마커 가운데 umc1125y3과 bnlg1025y4를 제외한 11개의 마커가 0.80 이상의 높은 PIC 값을 나타내었다. 본 연구에서 옥수수 품종 지문화 작업에 최종 활용된 microsatellite 마커의 수는 작지만 각 마커 별로 나타내는 대립유전자 수와 PIC 값이 아주 높기 때문에 우리나라에서 육성된 옥수수 품종식별 및 품종별 유전적 근연 관계를 분석하는데 효과적일 것으로 사료되었다.

Table 2 . Repeat motif, number of alleles, and polymorphism information content (PIC) value of microsatellite markers selected for genetic characterization of 90 maize varieties and parental lines.

 SSR designation Primer sequenceRepeat motifChromosome numberAnnealing temp.Product size (bp)No. of allelesPIC value
bnlg439w1F: FAM-AGTTGACATCGCCATCTTGGTGAC(TC)155320-371160.897
R: GAACAAGCCCTTAGCGGGTTGTC
umc1705w1F: FAM-GGAGGTCGTCAGATGGAGTTCG(CT)555258-334160.898
R: CACGTACGGCAATGCAGACAAG
bnlg161k8F: NED-TCTCAGCTCCTGCTTATTGCTTTCG(AG)655145-216220.928
R: GATGGATGGAGCATGAGCTTGC
bnlg1702k1F: PET-GATCCGCATTGTCAAATGACCAC(CT)655266-317210.907
R: AGGACACGCCATCGTCATCA
umc1545y2F: FAM-AATGCCGTTATCATGCGATGC(AAGA)755186-24180.823
R: GCTTGCTGCTTCTTGAATTGCGT
umc1125y3F: VIC-GGATGATGGCGAGGATGATGTC(CTCG)755150-17350.748
R: CCACCAACCCATACCCATACCAG
bnlg240k1F: NED-GCAGGTGTCGGGGATTTTCTC(GA)855219-24190.882
R: GGAACTGAAGAACAGAAGGCATTGATAC
bnlg1671y17F: PET-CCCGACACCTGAGTTGACCTG(CT)155177-250200.942
R: CTGGAGGGTGAAACAAGAGCAATG
umc1536k9F: FAM-TGATAGGTAGTTAGCATATCCCTGGTATCG(GT)(TA)255222-29680.835
R: GAGCATAGAAAAAGTTGAGGTTAATATGGAGC
bnlg1025y4F: VIC-CTCTCCTCACGCCAACTTAATCTGTG(AG)155148-205100.716
R: GTGACTCCTAAGCTCGCCGAATAA
umc1127k1F: PET-CCCCCCTCCCTAATTTTGCTTC(AG)655182-226130.883
R: GCACATCTTACGGATCTAGCTGGACTG
bnlg162k2F: FAM-GGCTCACGTCCGTATCCAAACC(CT)855232-299150.890
R: TCAGTTCAGGTCCGTCGTCCAG
bnlg1712k17F: NED-CGATTTCACGGCTCGTGGC(GA)1055256-293150.892
R: GAAAATACCCTTGGTTCTCCTTCCTGG

Total17811.240

Mean13.690.865

Microsatellite 마커에 따른 옥수수 90개 품종 및 자식 계통에 대한 대립유전자의 분포 빈도 양상을 조사한 바(Fig. 1), bn1g161k8은 대립유전자의 크기가 145 bp에서 216 bp 사이에 총 22개의 대립유전자가 검출되었으며, 대립유전자의 크기가 165 bp와 183 bp에서 각각 16.8%와 18.7%의 다소 높은 빈도분포 양상을 나타내었으나, 나머지는 0.7%에서 7.1%까지 대립유전자가 고르게 분포하는 양상을 나타내었다. bn1g1671y17의 경우도 177 bp에서 250 bp 사이에 총 20개의 대립유전자가 검출되었는데 특정 대립유전자의 크기에 공시품종이 편중되지 않고 대립유전자의 크기에 따라 0.7 ~ 16.6%의 빈도분포 양상을 나타내었다.

Figure 1.

Histogram depicting the alleles at 2 microsatellite loci, bn1g161k8 (A) and bn1g1671y17 (B). Base-pair size (abscissa) and the frequency at each allele (ordinate) detected by 90 maize varieties and parental lines


우리나라 옥수수 품종 및 계통에 대한 microsatellite 마커를 활용하여 분석한 연구는 Jung 등(2006)이 농촌진흥청에서 육성된 찰옥수수의 자식계통의 주요 품질특성과 관련된 SSR 마커를 선발하기 위하여 64개의 찰옥수수 자식계통에 대하여 30개의 SSR 마커로 분석하였을 때 평균 7.5개의 대립유전자가 확인되고 평균 PIC 값이 0.69임을 보고한 이후, Park 등(2009)은 강원도 농업기술원 옥수수시험장에서 육성된 찰옥수수 품종의 교배친 11계통을 50개의 SSR 마커로 검정시 평균 대립유전자의 수가 3.4이며 gene diversity는 0.596으로 나타남을 보고하였다. Kim 등(2012)은 SSR 마커에 의한 색소옥수수 24계통과 비색소 계통 7계통에 대하여 유전적 다형성을 조사하였을 때, 평균 5.6개의 대립유전자가 검출되었고 평균 PIC 값이 0.62임을 보고하였다. 그러나 본 연구에서 활용된 microsatellite 마커의 경우 평균대립유전자가 13.69개이고 평균 PIC 값이 0.865로 높게 나타나 Jung 등(2006)과 Park 등(2009)Kim 등(2012)이 보고한 연구결과와 다른 양상을 나타내었다. 이러한 이유는 본 연구에서 분석한 옥수수 품종은 찰옥수수, 단옥수수, 초당옥수수, 팝콘용 옥수수 등 다양한 유형의 품종을 유전자 분석에 활용하였을 뿐만 아니라 이전에 연구자들은 주로 PCR 분석 산물을 아크릴아마이드 젤 전기영동에 의해 분석하였으나 본 연구에서는 자동염기서열분석기를 활용하였기 때문에 아크릴아마이드 젤 분석에서 검출이 불가능하였던 대립유전자의 확인이 가능했기 때문이라 판단된다. 한편, Wang 등 (2011)이 중국과 미국에서 수집된 옥수수 231개의 자식계통을 60개의 microsatellite 마커로 분석하였을 때 평균 대립유전자의 수(8.95개) 보다 본 연구의 평균 대립유전자의 수가 13.69개로 높은 경향을 나타났다. 중국의 경우 옥수수 자식계통만 분석하였으나 본 연구에서는 다양한 용도로 육성된 옥수수 F1 품종 66개와 자식계통 24개에 대하여 품종식별력이 아주 우수한 13개의 microsatellite를 선발하여 품종지문화에 이용했기 때문에 나타난 결과라고 사료된다.

품종식별력 검정 및 유전적 유사도 분석

옥수수 품종 및 계통 90개에 대한 microsatellite 분석에서 대립유전자의 패턴이 우수하고 PIC 값이 0.70 이상인 마커를 선발하고 이를 활용하여 군집분석에 의한 계통도를 작성한 바(Fig. 2), 공시된 품종 및 계통에 대한 전체 유사도 지수는0.07 ~ 0.82로 나타났고, 유전적 유사도 지수 0.14에서 공시된 계통 및 품종은 5개의 대그룹으로 구분되었다. 그리고 공시된 모든 품종과 계통들은 microsatellite 마커의 유전자형에 의해 뚜렷하게 식별이 가능한 것으로 나타났다.

Figure 2.

Dendrogram depicting the classification of 90 maize varieties and parental lines constructed using unweighted pair-group method with arithmetical average (UPGMA) and based on microsatellite markers. The scale at the bottom is Jaccard’s coefficient of similarity


Microsatellite 마커의 유전자형에 따라 군집분석 하였을 때 I그룹은 찰옥수수, 팝콘용 옥수수, 단 및 초당 옥수수 등 38개 품종 및 계통이 그룹화되었다. I그룹을 유전적 유사도 지수 0.16에서 4개의 소그룹으로 다시 구분할 수 있었다. I-1 소그룹에는 ‘횡성옥’ 등 21품종이 분포하였다. 육종기관별로 보면 농촌진흥청에서 육성된 ‘횡성옥’ 등 13품종과 강원도 농업기술원 옥수수시험장에서 육성된 ‘강일옥’과 이 품종의 양친으로 활용된 ‘HF1’과 ‘HF2’ 계통이 하나의 소그룹화 되었다. 그리고 경북대에서 육성된 ‘경대찰’과 ‘경대사일리지2호’와 충남대에서 육성된 ‘대학찰골드1호’가 속하였다. 특이하게 사일리지용 옥수수인 ‘경대사일리지2호’는 독립적인 하나의 품종군으로 그룹화되지 않은 양상을 나타내었는데 이러한 원인은 품종 육성과정에 교배모본으로 활용된 계통중에 찰옥수수의 유전적 특성을 어느 정도 가지고 있기 때문에 나타난 결과라고 추정되며 향후 이러한 품종 유형의 양친 및 F1에 대하여 깊이 있는 연구가 수행되어야 될 것으로 사료된다. I-2 그룹에는 ‘연농1호’의 후대에서 선발한 ‘KW35’와 중국 유전자원에서 선발한 ‘KW51’ 및 이 계통을 활용하여 육성된 ‘일미찰’이 속하였고, 제일종묘에서 육성한 ‘조생대학흑찰’이 포함되었다. I-3 그룹은 팝콘용 옥수수인 ‘튀김옥1호’와 초당 옥수수인 ‘사탕옥1호’, ‘사탕옥2호’, ‘허니콘’, ‘금덩어리초당’, ‘캠벨라90’, ‘하모니쇼콜라’, ‘써니쇼콜라’와 단옥수수인 ‘금단옥’, ‘단옥2호’, ‘단옥3호’, ‘골든크로스반탐70’이 속하였고 I-4 그룹은 사료용으로 미국에서 수입되고 있는 ‘W1480C’ 한 품종이 독립적으로 그룹화 되었다. 한편, 팝콘용 옥수수인 ‘튀김옥1호’가 단옥수수와 초당옥수수와 동일 그룹에 속하였다. 이 원인은 팝콘용 옥수수와 단 및 초당 옥수수 품종의 경우 양친으로 활용된 계통이 주로 미국에서 도입된 종을 고정하여 사용하였기 때문인 것으로 추정된다.

II그룹에는 ‘미백찰’ 등 44품종이 그룹화 되었고 유사도 지수 0.25에서 8개의 소그룹으로 세분할 수 있었다. II-1은 농촌진흥청에서 육성한 ‘신찰옥’과 ‘찰옥1호’, 강원도농업기술원에서 육성한 ‘미백찰’ 등 5품종, 제일종묘에서 육성한 ‘스피드대학찰1호’ 등 4품종, 개인 육종가에 의해 육성된 ‘수옥찰’ 등 3품종이 포함되었다. II-2는 자식 계통인 ‘KW3’과 ‘KW7’과 이들이 모본이나 부본으로 활용되어 육성된 ‘찰옥3호’, ‘두메찰’, ‘찰옥2호’가 소그룹화 되었다. II-3은 ‘흑점찰’ 등 8품종이 속하였는데 유전적 유사도 지수 0.26에서 종피의 색깔이 흑색인 ‘흑점찰’ 등 4품종과 경북대에서 육성된 ‘경대찰1호’ 등 4품종이 다시 소그룹화 되었다. II-4는 강원도 농업기술원에서 육성된 종피의 색깔이 흑색인 ‘미흑찰’과 ‘흑점2호’ 및 자식 계통인 ‘HW7’과 ‘HW8’이 포함되었고, II-5에는 팝콘용 옥수수인 ‘케이팝’과 ‘대학팝콘1호’가 속하였다. II-6은 제일종묘에서 육성한 ‘장원찰1호’ 등 5품종과 농촌진흥청과 강원도 농업기술원에서 육성한 자식계통 ‘KW33’ 및 이 계통을 양친으로 활용한 ‘찰옥4호’와 ‘얼룩찰1호’가 포함되었다. II-7은 강원도 농업기술원 옥수수시험장에서 ‘W9060’과 ‘A632wx’ 조합에서 순계 분리하여 양성된 ‘HW3’이 속하였고, II-8은 찰옥수수 조생 모집단 ‘WPE’에서 순계 분리한 ‘HW6’과 이 계통이 부본으로 사용되어 양성된 ‘조미찰’ 품종이 그룹화되었다.

III 그룹에는 강원도 농업기술원 옥수수시험장에서 팝콘용 옥수수의 교배친으로 활용되고 있는 ‘HP1’ 등 6계통이 속하였으며, IV 그룹은 강원도 원주지역에서 수집하여 교배친으로 양성한 계통 ‘HW1’ 한 계통이 그룹핑되었고, V 그룹은 ‘광안옥’의 부본으로 사용된 ‘DB544’ 계통이 속하였다.

이상의 연구 결과를 종합해보면 본 연구에 활용된 13개의 microsatellite 마커는 옥수수 90개 품종 및 계통에 대하여 옥수수 품종 유형 및 품종 육성 계보에 따라 뚜렷하게 그룹화되는 경향을 보였기 때문에, 이는 옥수수 품종간 유연관계 설정을 통한 유전자원의 특성 평가에 매우 유용하게 이용될 수 있을 것으로 판단된다. 그리고 13개의 microsatellite 마커에 의하여 공시품종 및 계통들이 완전하게 식별이 가능한 것으로 나타나 옥수수 품종 진위성과 관련된 종자분쟁, 농업 생산물과 관련된 도난 사건, 종자의 순도검정 등에 보조적인 수단으로 활용이 가능할 것이다. 한편, 본 연구에서는 자동염기서열분석기를 활용하여 작성된 microsatellite DNA 데이터베이스이기 때문에 신품종이 육성되면 해당 품종만 microsatellite 분석하여 기 구축된 옥수수 품종별 데이터베이스와 비교하면 신품종의 유전적 거리 예측이 가능하기 때문에 육종효율을 향상에 크게 기여할 뿐만 아니라 옥수수 유전자원의 보호 및 품종보호제도 등과 같은 신지식재산권 강화에 활용도가 높을 것으로 판단된다.

최근 차세대염기서열분석기를 이용하여 염색체 내의 SNP 염기서열 변이를 탐색하고 이를 마커로 개발하면 자동화를 통한 대량 분석이 가능하기 때문에 옥수수 품종 식별에 소요되는 시간, 비용, 노력을 절감시킬 수 있는 장점이 있다(Tian et al. 2015). 따라서, 우리나라 옥수수 품종 식별용 SNP 마커가 개발되고, 본 연구에서 microsatellite 마커에 의해 구축된 DNA 데이터베이스와 상호 비교하여 그 효율성이 분석된다면 옥수수 품종 확인의 정확도는 한층 더 높아질 것으로 사료된다.

적요

국내에서 육성된 옥수수 90 품종 및 자식 계통에 대하여 microsatellite 마커를 활용하여 DNA 프로파일 데이터베이스를 구축한 다음 공시품종에 따른 유전적 유사도 분석 및 품종식별력 검정에 대한 연구를 수행하였다. 옥수수 90품종을 100개의 microsatellite 마커로 검정하고 대립유전자의 패턴이 우수하고 다형성 정도가 높은 13개를 선정하여 분석하였을 때 대립유전자의 수는 5 ~ 24개까지 다양하게 분포하였고 평균 대립유전자의 수는 13.69개로 높았다. PIC 값의 경우도 0.716 ~ 0.942 범위에 속하였고 평균값은 0.865로 아주 높았다. 옥수수 90품종 및 계통에 대하여 UPGMA 분석에 의한 계통도를 작성하였을 때, 옥수수의 품종 유형 및 품종 육성 계보에 따라 5개의 대그룹으로 나누어졌다.

본 연구에서 구축됨 옥수수 자식계통 및 품종별 microsatellite DNA 프로파일 데이터베이스는 신품종과 기 육성된 품종과 유전적 유사도 분석이 가능하기 때문에 품종보호출원시 대조품종 선정 및 품종진위성과 관련된 종자분쟁에 매우 유용하게 활용될 수 있을 것이다.

사사

이 논문은 동아대학교 교내연구비 지원에 의하여 연구되었음.

Fig 1.

Figure 1.

Histogram depicting the alleles at 2 microsatellite loci, bn1g161k8 (A) and bn1g1671y17 (B). Base-pair size (abscissa) and the frequency at each allele (ordinate) detected by 90 maize varieties and parental lines

Journal of Plant Biotechnology 2016; 43: 367-375https://doi.org/10.5010/JPB.2016.43.3.367

Fig 2.

Figure 2.

Dendrogram depicting the classification of 90 maize varieties and parental lines constructed using unweighted pair-group method with arithmetical average (UPGMA) and based on microsatellite markers. The scale at the bottom is Jaccard’s coefficient of similarity

Journal of Plant Biotechnology 2016; 43: 367-375https://doi.org/10.5010/JPB.2016.43.3.367

Table 1 . The 90 maize varieties and parental lines assayed for genetic characterization using microsatellite markers.

No Variety name Parentage Sources
1HoengseongokKS15/KS16//KS5Rural Development Administration
2Tuygimok1hoKP1/KP2Rural Development Administration
3MibaekchalHW3/HW4Rural Development Administration
4Chalok3hoKW7/KW35Rural Development Administration
5SinchalokKW36/KW1Rural Development Administration
6Danok3hoKSS2/KSS22Rural Development Administration
7Chalok2hoKW7/KW3Rural Development Administration
8SuwonokKS117/KS7rhmRural Development Administration
9KS7rhmInbred line (Selection of Bulk-2-2-4-1)Rural Development Administration
10KS117Inbred line (Selection of Fla2Bt73Bulk-2-5-2-4)Rural Development Administration
11KW3Inbred line (Selection of Gosungjaeraejong)Rural Development Administration
12KW7Inbred line(Selection of Pyeongchangjaeraejong)Rural Development Administration
13DB544Inbred lineRural Development Administration
14GeumdanokKSS14/KSS19Rural Development Administration
15DumechalHW1/KW7Gangwon-Do
16HeugjeomchalKL103/KW7Rural Development Administration
17DuruokKS7/KS7rhmRural Development Administration
18KwangpyeongokKS124/KS85Rural Development Administration
19KwanganokGa209/DB544Rural Development Administration
20CheonganokKS121/KS118Rural Development Administration
21PungmiokKS121/KS139Rural Development Administration
22Danok2hoKSS3/KSS4Rural Development Administration
23JangdaokKS5/KS135Rural Development Administration
24NC+6440UnknownNonghyup
25P32K61UnknownNonghyup
26Kyungdaechal1HoKS7/KNUW2Kyungpook National University
27Kyungdaechal2hoKNUW1/KNUW3Kyungpook National University
28Satangok1hoSH5/SH8Kyungpook National University
29Satangok2hoSH5/SH8Kyungpook National University
30Kyungdae19chalKNUW5/KNUW6Kyungpook National University
31TongilchalKW7/KNUW1Kyungpook National University
32Jangwonchal1ho2026F1/2101-7-6-5-4Jeil
33Jangwonchal2ho2115-3-2-5-3/2141-4-5-4-3Jeil
34MiheugchalHW7/HW8Gangwon-Do
35CheongsaokKS55/KS131Rural Development Administration
36Chalok4hoKW33/KW35Rural Development Administration
37GangdaokKS140/KS141Rural Development Administration
38IlmichalKW51/KW35Rural Development Administration
39SuokchalUnknownKim, Jae-Hwa
40Golden cross bantam70UnknownUSA
41Alrokichal1ho3/5Jeil
42Chalok1h0KW1/KW2Rural Development Administration
43GangilokHF1/HF2Gangwon-Do
44JomichalHW5/HW6Gangwon-Do
45Mibaek2hoHW9/HW3Gangwon-Do
46Yeonnong2hoYNCR-3/YNCR4Choi, Bong-Ho
47Jaheukchal1ho2/4Jeil
48HoneycornSH4/SH8Kyungpook National University
49Kyungdae19chalKS5wx/KS6wxKyungpook National University
50KeumdeongeorichodangUnknownJeil
51Jeilheukchal1hoUnknownJeil
52Cambella 90UnknownKoregon
53Kyungdaesilage2hoKNU51B/KNUP45Kyungpook National University
54KW51Inbred line(Selection of China germplasm)Rural Development Administration
55KW35Inbred line(Selection of Yeonnong1ho)Rural Development Administration
56KW33Inbred line(Selection of China germplasm)Rural Development Administration
57Daehakchalgold1hoYeongdeogjaerae/OkcheonjaeraeChungnam National University
58Eolrukchal1hoKBW23/KW33Gangwon-Do
59HP1Inbred line(Selection of Korea germplasm)Gangwon-Do
60HP2Inbred line(Selection of Korea germplasm)Gangwon-Do
61HP3Inbred line(Selection of Korea germplasm)Gangwon-Do
62HP4Inbred line(Selection of Korea germplasm)Gangwon-Do
63HP6Inbred line(Selection of Korea germplasm)Gangwon-Do
64HP7Inbred line(Selection of Korea germplasm)Gangwon-Do
65Yeonnong1hoUnknownNongwoo
66PyeonganokKS140/KS94Rural Development Administration
67HeukjinjuchalKBW24/KBW2Rural Development Administration
68JosaengdaehakheukchalUnknownJeil
69JosaengdaehakchalUnknownJeil
70Speeddaehakchal1hoUnknownJeil
71W1480CUnknownNonghyup
72K-PopUnknownAsia
73JosaengalrokidaehakchalUnknownJeil
74JosaengheukjeomdaehakchalUnknownJeil
75Jangwonchal3hoUnknownJeil
76SunnychocolatUnknownDongbu
77HarmonychocolatUnknownDongbu
78HF1Inbred line(Selection of USA germplasm)Gangwon-Do
79HF2Inbred line[Selection of USA germplasm(N2BE/B73)]Gangwon-Do
80HW3Inbred line(Selection of W9060/A632wx)Gangwon-Do
81HW4Inbred line(Selection of Ansungjaeraejong)Gangwon-Do
82HW6Inbred line(Selection of WPE)Gangwon-Do
83HW7Inbred line(Selection of Yanggujaeraejong)Gangwon-Do
84HW8Inbred line(Selection of Hwacheonjaeraejong)Gangwon-Do
85HW9Inbred line(Selection of Jewon/Bosung//KW7Gangwon-Do
86KL103Inbred line(Selection of Gochang)Gangwon-Do
87HW1Inbred line(Selection of Wonju)Gangwon-Do
88Heugjeom2hoHW10/KW7Gangwon-Do
89ArichalHW12/HW11Gangwon-Do
90Daehakpopcorn1hoUnknownLee, Won-Gu

Table 2 . Repeat motif, number of alleles, and polymorphism information content (PIC) value of microsatellite markers selected for genetic characterization of 90 maize varieties and parental lines.

 SSR designation Primer sequenceRepeat motifChromosome numberAnnealing temp.Product size (bp)No. of allelesPIC value
bnlg439w1F: FAM-AGTTGACATCGCCATCTTGGTGAC(TC)155320-371160.897
R: GAACAAGCCCTTAGCGGGTTGTC
umc1705w1F: FAM-GGAGGTCGTCAGATGGAGTTCG(CT)555258-334160.898
R: CACGTACGGCAATGCAGACAAG
bnlg161k8F: NED-TCTCAGCTCCTGCTTATTGCTTTCG(AG)655145-216220.928
R: GATGGATGGAGCATGAGCTTGC
bnlg1702k1F: PET-GATCCGCATTGTCAAATGACCAC(CT)655266-317210.907
R: AGGACACGCCATCGTCATCA
umc1545y2F: FAM-AATGCCGTTATCATGCGATGC(AAGA)755186-24180.823
R: GCTTGCTGCTTCTTGAATTGCGT
umc1125y3F: VIC-GGATGATGGCGAGGATGATGTC(CTCG)755150-17350.748
R: CCACCAACCCATACCCATACCAG
bnlg240k1F: NED-GCAGGTGTCGGGGATTTTCTC(GA)855219-24190.882
R: GGAACTGAAGAACAGAAGGCATTGATAC
bnlg1671y17F: PET-CCCGACACCTGAGTTGACCTG(CT)155177-250200.942
R: CTGGAGGGTGAAACAAGAGCAATG
umc1536k9F: FAM-TGATAGGTAGTTAGCATATCCCTGGTATCG(GT)(TA)255222-29680.835
R: GAGCATAGAAAAAGTTGAGGTTAATATGGAGC
bnlg1025y4F: VIC-CTCTCCTCACGCCAACTTAATCTGTG(AG)155148-205100.716
R: GTGACTCCTAAGCTCGCCGAATAA
umc1127k1F: PET-CCCCCCTCCCTAATTTTGCTTC(AG)655182-226130.883
R: GCACATCTTACGGATCTAGCTGGACTG
bnlg162k2F: FAM-GGCTCACGTCCGTATCCAAACC(CT)855232-299150.890
R: TCAGTTCAGGTCCGTCGTCCAG
bnlg1712k17F: NED-CGATTTCACGGCTCGTGGC(GA)1055256-293150.892
R: GAAAATACCCTTGGTTCTCCTTCCTGG

Total17811.240

Mean13.690.865

References

  1. Anderson JA, Churchill CA, Autrique JE, Tanksley SD, and Sorrells ME. (1993) Optimizing parental selection for genetic-linkage maps. Genome 36, 181-186.
    Pubmed CrossRef
  2. Bae KM, Sim SC, Hong JH, Choi KJ, Kim DH, and Kwon YS. (2015) Development of genomic SSR markers and genetic diversity analysis in cultivated radish (Raphanus sativus L.). Hortic Environ Biotechnol 56, 216-224.
    CrossRef
  3. Jung TW, Moon HY, Son BY, Kim SL, and Kim SK. (2006) SSR markers related to major characteristics affected kernel quality in waxy corn inbred lines. Korean J Crop Sci 51S , 185-192.
  4. Kim BW, Sa KJ, Park KJ, Park JY, and Lee JK. (2015) Genetic analysis of core sets of colored maize and non-colored maize inbred lines using SSR markers. Korean J Breed Sci 47, 54-62.
    CrossRef
  5. Kim BW, Sa KJ, Choi SH, Park JY, Park JY, and Lee JK. (2012) Analysis of the genetic relationship and population structure for colored maize lines using SSR markers. Korean J Breed Sci 44, 301-311.
  6. Kim JY, Moon JC, Baek SB, Kwon YU, Song GT, and Lee BM. (2014) Genetic improvement of maize by marker-assisted breeding. Korean J Crop Sci 59, 109-127.
    CrossRef
  7. Kwon YS, and Choi KJ. (2013) Construction of a DNA profile database for commercial cucumber (Cucumis sativus L.) cultivars using microsatellite markers. Kor J Hort Sci Technol 31, 344-351.
    CrossRef
  8. Kwon YS, and Hong JH. (2014) Use of microsatellite markers to identify commercial melon cultivars and for hybrid seed purity testing. Korean J Hortic Sci Technol 32, 525-534.
    CrossRef
  9. Kwon YS, Hong JH, and Choi KJ. (2013) Construction of a microsatellite marker database of commercial pepper cultivars. Korean J Hortic Sci Technol 31, 580-589.
    CrossRef
  10. Park JS, Sa KJ, Park KJ, Jang JS, and Lee JK. (2009) Genetic variation of parental inbred lines for Korean waxy corn hybrid varieties revealed by SSR markers. Korean J Breed Sci 41, 106-114.
  11. Rohlf F.J. (2000). NTSYSpc:Numerical taxonomy and multivariate analysis system, ver. 2.10b . Applied Biostatistics Inc, New York.
  12. Sneath P.H.A, and Sokal R.R. (1973). Numerical taxonomy:The principles and practice of numerical classification . San Francisco, Freeman W.H.
  13. Tian HL, Wang FG, Zhao JR, Yi HM, Wang L, Wang R, Tang Y, and Song W. (2015) Development of maizeSNP3072, a high- throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Mol Breeding 35, 136.
    Pubmed KoreaMed CrossRef
  14. ., UPOV (2010). Guideline for DNA-profiling:molecular marker Selection and Database Construction (“BMT Guideline”) , Geneva. Switzerland.
  15. Wang FG, Tian HL, Zhao JR, Yi HM, Wang L, and Song W. (2011) Development and characterization of a core set of SSR markers for fingerprinting analysis of Chinese maize varieties. Maydica 56, 7-17.
JPB
Vol 51. 2024

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download