Research Article

Split Viewer

J Plant Biotechnol 2016; 43(4): 457-465

Published online December 31, 2016

https://doi.org/10.5010/JPB.2016.43.4.457

© The Korean Society of Plant Biotechnology

핵심 Microsatellite 마커를 이용한 한국 콩 품종에 대한 Fingerprinting 분석

권용삼*

동아대학교 생명자원과학대학 분자유전공학과

Received: 26 October 2016; Revised: 21 November 2016; Accepted: 24 November 2016

DNA fingerprinting analysis for soybean (Glycine max) varieties in Korea using a core set of microsatellite marker

Yong-Sham Kwon*

Department of Molecular Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea

Correspondence to : e-mail: yskwon3@dau.ac.kr

Received: 26 October 2016; Revised: 21 November 2016; Accepted: 24 November 2016

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Microsatellites are one of the most suitable markers for identification of variety, as they have the capability to discriminate between narrow genetic variations. The polymorphism level between 120 microsatellite primer pairs and 148 soybean varieties was investigated through the fluorescence based automatic detection system. A set of 16 primer pairs showed highly reproducible polymorphism in these varieties. A total of 204 alleles were detected using the 16 microsatellite markers. The number of alleles per locus ranged from 6 to 28, with an average of 12.75 alleles per locus. The average polymorphism information content (PIC) was 0.86, ranging from 0.75 to 0.95. The unweighted pair group method using the arithmetic averages (UPGMA) cluster analysis for 148 varieties were divided into five distinctive groups, reflecting the varietal types and pedigree information. All the varieties were perfectly discriminated by marker genotypes. These markers may be useful to complement a morphological assessment of candidate varieties in the DUS (distinctness, uniformity and stability) test, intervening of seed disputes relating to variety authentication, and testing of genetic purity in soybean varieties.

Keywords Cluster analysis, Genetic diversity, Molecular marker, Simple sequence repeat, Variety identification

국제식물신품종보호동맹(International union for the protection of new varieties of plants; UPOV)에서는 식물 지식재산권 보호에 유전자 분석 기술의 표준화를 이루기 위하여 유전자 분석 기법과 분자 표지의 선정, DNA 분리 방법 및 데이터베이스 구축 방법 등에 대한 구체적인 가이드라인을 제시하고 있다(UPOV 2010, 2011). 이 가이드라인에서는 반복 재현성이 높고 공우성을 나타내며, 여러 가지 분석 장비에서도 오차가 없고 논문이나 게놈 데이터베이스를 통해 알려진 마커를 이용해야 한다는 기준을 제시하고 있다. 이러한 기준에 가장 적합한 것이 microsatellite와 single nucleotide polymorphism (SNP) 분석 방법인데 SNP 마커에 의한 품종식별 방법은 이용할 만한 정보가 아직까지 크게 부족하기 때문에 microsatellite 검정 방법이 주로 이용되고 있다. 실제로 유럽품종보호사무소(Community plant variety office; CPVO)에서는 토마토(Bredemeijer et al. 2002), 밀(Röder et al. 2002), 감자(Reid et al. 2011) 등과 같은 작물을 대상으로 품종별 DNA 프로파일 데이터베이스를 구축하였다. 일본에서는 딸기, 복숭아, 사과, 밤 등에 대하여 microsatellite 분석 기술에 의한 품종식별 체계를 구축하여 농업 생산물의 가공품에 대한 품종 진위성 확인 및 자국 농산물의 보호 등과 같은 분야에 유전자 분석 기술을 활용하고 있다(http://www.ncss.go.jp). 중국의 경우 옥수수에 대하여 microsatellite 마커와 SNP 분석 기술을 활용하여 품종별 데이터베이스를 구축하고 이를 품종보호 침해에 적극 이용하고 있다(Wang et al. 2011; Tian et al. 2015). 한편, 국립종자원에서 고추(Kwon et al. 2013), 수박(Kwon et al. 2015), 무(Bae et al. 2015), 호박(Sim et al. 2015) 등과 같은 작물에 대하여 다형성이 높은 microsatellite 마커를 활용하여 종자시장에서 유통되고 있는 주요 품종에 대하여 DNA 프로파일 데이터베이스를 구축하였거나 구축 중에 있다. 이러한 작물별 DNA 프로파일 데이터베이스는 품종보호출원 품종의 대조품종 선정 및 품종보호 재배심사시 구별성, 균일성 및 안정성을 확인하는데 보조자료로 이용되고 있다. 최근에는 품종보호등록 품종의 특성 유지 여부를 확인하기 위하여 유전자 분석 기술과 재배시험에 의한 특성조사를 융·복합적으로 이용하고 있다. 또한 품종 식별 분자 마커는 농가와 종자 회사 및 종자회사 간에 발생하는 품종 진위성과 관련된 종자분쟁을 해결하는 하나의 수단으로 적극 활용되고 있는 추세이다.

우리나라 콩의 재배 면적은 2015년 기준 57천 ha이며 생산량은 104천 톤으로 과거에 비해 다소 감소하고 있는 추세이다(http://www.mafra.go.kr). 그러나, 최근 콩을 이용한 다양한 건강 식품이 개발되고 있고 그 수요도 점점 커질 것으로 예상된다. 따라서 콩 육종 목표도 다수성 이외에 용도별 신품종 개발, 기능성 고품질, 안정된 생산을 위한 병충해 및 재해 저항성 품종 개발 등으로 다양화되고 있다. 국내 콩 품종은 2016년 9월 30일 기준 품종보호 출원된 193품종중에서 163 품종이 등록되었으며, ‘대원’, 태광’, ‘대풍’, ‘우람’, ‘연풍’, ‘풍산나물’은 국가에서 직접 종자를 생산하여 농가에 보급하고 있다(http://www.seed.go.kr).

분자 마커를 이용하여 콩의 유전자원 특성 평가 및 품종식별에 대한 국내외 연구 동향을 살펴보면, microsatellite 마커에 의한 우리나라 콩 육성 품종의 유전적 다양성과 유연관계 분석 (Kim et al. 2016a, b)과 콩 보급품종과 엘리트 품종에 대한 유전적 다양성과 품종 판별(Jang et al. 2009), STS-CAPS (Sequence tagged sites-cleaved amplification polymorphic sequence) 마커 개발(Hwang et al. 2012) 등에 대한 연구를 수행한 바 일부 품종에 대해서는 식별이 되지 않음을 지적한 바 있다. 국외의 경우 일본에서 377개 microsatellite 마커를 활용하여 82개 유전자원 및 육성품종에 대해 유전적 다양성을 분석하였으며(Hwang et al. 2008), 미국에서는 콩 품종식별에 적합한 SNP 마커를 개발하여 132개 유전자원 및 품종 식별에 대한 연구 결과도 발표된 바 있다(Yoon et al. 2007). 최근, 인도에서는 자국내의 주요 콩 102 품종에 대한 microsatellite 마커의 유전자형을 설정한 다음 이를 바코드화하여 종자 순도관리에 실용적 활용이 가능함을 제시하였다(Rani et al. 2016). 이상의 연구 결과를 종합해 볼 때, 우리나라 콩에 대한 품종식별 및 유전적 다양성 연구는 유전적으로 가까운 일부 품종이 식별이 되지 않는 점과 검정 대상 품종도 농촌진흥청과 일부 지방 자치 단체에서 육성된 품종을 대상으로 분석하였다는 점이다. 따라서 최근에 농촌진흥청, 지방자치단체, 한국원자력원구원, 대학 및 벤처기업에서 육성된 품종을 대상으로 하여 품종 식별력이 높은 핵심 분자 마커의 선정은 우리나라 콩 품종의 유전적 다양성뿐만 아니라 지식재산권 보호 및 종자의 순도관리 등 다방면에 활용될 수 있을 것이다.

따라서 본 연구에서는 국내에서 육성된 콩 148개 품종에 대해 반복 재현성이 우수한 microsatellite 마커를 선발하고, 이를 활용한 유전적 유연관계 분석을 통한 품종식별 정도 등에 대한 일련의 연구를 수행하여 얻어진 결과를 보고하는 바이다.

공시품종 및 DNA 추출

본 연구에서는 ‘화성풋’ 등 148품종(농촌진흥청 114품종, 강원도 6품종, 경기도 3품종, 충청북도 2품종, 경상북도 영주시 1품종, 한국원자력연구원 3품종, 경북대학교 2품종, 소이벤처 5품종, 경상대학교 6품종, 서울대학교 2품종, 영남대학교 2품종, 제노마인 1품종, 중국 1품종)의 종자를 공시재료로 선정하였다(Table 1). 공시품종의 종자 5립을 분쇄기(Pulverisette 6, Fritsch)를 이용하여 마쇄하고 분말 200 mg을 Safe-Lock 2.0 ml 튜브(Cat. W129549M, Eppendorf, USA)로 옮긴 다음, NucleoSpin® Plant II (Cat. 740 770.250, Macherey-Nagel GmbH & Co., KG, Deutsch) 키트내의 Buffer PL II buffer 400 ml을 첨가하여 조직을 lysis 시켰다. 그 이후 실험 절차는 키트에 포함된 매뉴얼에 준하여 DNA를 추출하였다. 분리된 DNA는 분광광도계(NanoDrop2000, Thermo Scientific, USA)를 이용하여 농도를 확인한 후 µl 당 10 ng의 농도로 정량하였다.

Table 1 . List of 148 soybean varieties assayed for genetic characterization using microsatellite markers

No.Varieties nameParentageSourcesNo.Varieties nameParentageSources
1HwasongputPure line selection derived from Gyeongido and Gangwondo germplasmRDA75SonghakDongsan74/JangbaekRDA
2JinyulHwanggeum/SinnongheukRDA76DoremiNamhae/YS569RDA
3Geomjeong3Sinnongheuk/SNUA78010RDA77SohoNamhae/YS569RDA
4AnpyeongEunha/(KAS391-7/SS88034)RDA78JinmiHS12/ManriRDA
5ShingiBaekun/Shinpaldal2RDA79SunamKosuzu/BupyeongRDA
6Chungdu1SI93006/Shinpaldal2RDA80DagiNamhae/D70-6545RDA
7DaemangJangyeob/SeokrangputRDA81Hojang(Jangyeob/Hwanggeum)/Suwon153RDA
8Cheongja3Suwon174/Mokpo17RDA82BosugNamhae/CampRDA
9Daemang2Shinpaldal2/SeokrangputRDA83SokangNamhae/CampRDA
10MilangKeunol/GeomjeongolRDA84NogchaePureun/Milyang44RDA
11Dajang(Haman/Williams)/PaldalRDA85WonhwangCamp/MyungjunamulRDA
12Keumgang[(Suwon61/SS6807)/Clark63]/(Suwon111/H-25)RDA86JangkiEunha/MS91088RDA
13HannamYS236/SS79168-67-5RDA87PungwonSI93001/Suwon164RDA
14IlpumgeomjeongSLSB 87-3/(Hwanggeum/SLSB-45)RDA88JonamEunha/Jeonju-11RDA
15GeomjeongolPure line selection derived from Milyangjaerae germplasmRDA89GalchaeYS1287/Jinju1RDA
16Jangmi(D69-7816/Essex)/SLSB 87-2RDA90SohwangPungsannamul/HS646(Pungsan/Nattosan)RDA
17Duyou(Williams/S7145-BF₂-11-5)/BonghwajaeraejongRDA91JinpungSuwon215/(SI993746/SS01211)RDA
18BukwangJangbaek/BangsaRDA92Joyang1Pungsannamul/Suwon187RDA
19SobaeknamulMilyang18/BonghwajaeraejongRDA93Jungmo3008Hwanggeum/(Suwon180/SI993791)RDA
20Ilmi(Paldal/Saeal)/PaldalRDA94UramSuwon190/(Sinpaldal2/T243)RDA
21Saeol[(Danwon/Paldal)/Keunol]/BaeksajaRDA95HwangkeumolSS92414/HwaeomputRDA
22MyeongjunamulJangyeob/DanyeobRDA96SaedanbaekMD87L/SS92414RDA
23SowonEunha/BangsaRDA97NeulchanSS91501-9-1-1/SS96205RDA
24DaehwangKeunol/SLSB87-3RDA98ChamolSinpaldal2/KeunolRDA
25JangwonBogwang/SS84040RDA99Jungmo3009Milyang121/DaemangRDA
26SaebyeolBugwang/NamhaeRDA100HaepumBoseok/Suwon214RDA
27CheongjaMilyang55/Geomjeong1RDA101Jungmo3004Iksan21/Milyang98RDA
28SeonnogKeunol/Japan introductionRDA102Jungmo3005Cheongja/Geomjeong3RDA
29ShinrokSuwon163/Jinpum2RDA103TaekwangSS77011/Dongsan53RDA
30SorokPureun/NamhaeRDA104MalliJangyeob/PI219782RDA
31Geomjeong4(Paldal/YCS87-3) /YSC87-3RDA105JangsuElf/SS74185RDA
32DaepungBaekun/Shinpaldal2RDA106MuhanHwanggeum/WellsRDA
33DachaeHannam/EunhaRDA107PokwangJangyeob/PI219787RDA
34DaolKeunol/YS1040RDA108BaegunGwanggyo/dt1-long racemeRDA
35DanmiMilyang37/JosaengbaekjojoduRDA109KeunolPure line selection derived from ChilgokjaeraeRDA
36Dajin(Keunol/Josaengbaekdo)/KeunolRDA110Samnam(Suwon101/YS104)/Suwon101RDA
37Cheongja2Milyang70/IlpumgeomjeongRDA111DanweonWilliams/Suwon61RDA
38SojinDanyeob/SI93001RDA112NamhaeDanyeob/HillRDA
39SeonyuSuwon162/(SS79168/Saeal)RDA113DankyeongGwanggyo/WilliamsRDA
40GeomjeongsaeolKeunol/GeomjeongolRDA114SaealGwanggyo/SS7145-2B-45-3-4RDA
41Danmi2Seokrangput/(Seokrang/Milyang77)RDA115HeugcheongPure line selection derived from Yeongwoljaerae germplasmGangwondo
42Ilpumgeomjeong2Milyang68/Suwon178RDA116HobanGWS91/JinpumGangwondo
43HeugmiMilyang78/Milyang68RDA117CheongaShinpaldal2/SS97809Gangwondo
44SocheongMilyang78/PeingRDA118DaewangGWS91/SeokrangputGangwondo
45NogwonKeunol/Hyangnam1RDA119GangilSuwon191/Suwon196Gangwondo
46MansuHwanggeum/Dongsan118RDA120HaessalShinpaldal2/KeunolGangwondo
47NampungSuwon190/BogwangRDA121ManpoongDongsan121/Sprite87Gyeongido
48SangwonKeunol/OsimamidoriRDA122YeonpoongSuwon191/Suwon196Gyeongido
49DaeyangSuwon192/(Jangyeob/Hwaeomput)RDA123JangyonSS96321/SS01242Gyeongido
50DaeheugDaehwang/Milyang79RDA124DaecheongChucheonjaerae/DongbukheukduChungcheongbukdo
51HeugsungGnome85/CheongjaRDA125GalmiPure line selection derived from GwangjujaeraeChungcheongnamdo
52Daeha1Milyang192/(Jangyeob/Hwaeomput)RDA126Buseoktae1Pure line selection derived from YeongjaeraeYeongjusi
53CheonsangSuwon190/HwanggeumRDA127JosaengseoriMutants derived from irradiated SeoritaeKAERI
54Geomjeong5Sinpaldal/Geomjeong2RDA128WonyulMutants derived from irradiated KAS360-22KAERI
55Wonheug(Suwon182/Jinju1)/Jinju1RDA129WonhyunMutants derived from irradiated PaldalKAERI
56Socheong2Milyang78/PekingRDA130Aga1Eunha/KLG10084KPNU
57Cheongyeob1Ilpumgeomjeong/DaehwangRDA131Aga2Eunha/KLG10084KPNU
58IksannamulDanyeob/HillRDA132Aga3Eunha/KLG10084Soy Venture
59AlchanHwangkum/EunhaRDA133Aga4Eunha/KLG10084Soy Venture
60PungsannamulBangsa/KLS87092RDA134Aga9Eunha/KLG10084Soy Venture
61Shinpaldal2Deogyu/PaldalRDA135Aga8Eunha/KLG10084Soy Venture
62Geomjeong1(Jangyeob/Jaeraebabmit)/HwanggeumRDA136Aga10Eunha/KLG10084Soy Venture
63DanbaegDongsan69/D76-8070RDA137Gyeongsang2Seoritae/JinpumKSNU
64KwanganDongsan69/HwanggeumRDA138Gaechuk 1Gyeongsang1/(Seoritae/C242)KSNU
65PureunCheongsaeknamul/L78-379RDA139Gaechuk 2Jinpum2/C242KSNU
66TawonPaldal/ES33RDA140Gyeongsang3Jwinunyi/SP2KSNU
67DaewonSuwon133/Milyang18RDA141Jinnong1Jwinunyi/C242KSNU
68Jinpum2Pure line selection derived from Japanese germplasmRDA142JinyangJinpum2/GS301KSNU
69Geomjeong2SS83021/SS83033RDA143PulmuheukchaeJinju1xPI96188SNU
70JinpumPure line selection derived from Japanese germplasmRDA144PulmujigiPungsannamul/SS2-2SNU
71SomyeongEunha/BangsaRDA145YoungyangWillims/YWS9301YNU
72SodamSNUA78010/Dongsan127RDA146SomyeongEunha/BangsaYNU
73SeonheukHwanggeum/SinnongheukRDA147Gyeongsang1Seoritae/Jinpum1Jenomine
74PaldoKw220-26/HillRDA148ZhonghuangYeodu8/90052-76Lee Yeong Phil

RDA: Rural development administration, KAERI: Korea Atomic Energy Research Institute, KPNU: Kyungpook National University, KSNU: Kyungsang National University, SNU; Seoul National University, YNU; Yeungnam University


Table 2 . Repeat motif, number of alleles, and polymorphism information content (PIC) value of microsatellite markers selected for genetic characterization of the 148 soybean varieties

SSR designationPrimer sequenceRepeat motifLinkage groupAnnealing temp.Product size (bp)No. of allelesPIC value
Satt184F: FAM-GCGCTATGTAGATTATCCAAATTACGC(ATT)14D1a50135-19780.774
R: GCCACTTACTGTTACTCAT(TTG)5
Satt216F: VIC-TACCCTTAATCACCGGACAA(ATT)20D1b50140-217120.840
R: AGGGAACTAACACATTTAATCATCA
Satt614F: VIC-CTCCCCTTTAACCTTTCCTTTATTAG(TTA)38I50257-394210.951
R: CGCGGTAGGAATTAATTGTAGATAGGAT
Satt354F: PET-GCGAAAATGGACACCAAAAGTAGTTA(ATT)14I50179-24790.759
R: GCGATGCACATCAATTAGAATATACAA
Sat_151F: FAM-GCTGCATCAGATCACCCATCCTTC(AT)27J50215-27290.813
R: CATGCCATGTTGTATGTATGT
Sat_255F: VIC-CGGCATGTCATGGTATACGTAACTTTAGA(AT)32J50232-328280.942
R: GCGCAACTGAAGCAAGAAAAGAAACCT
Satt417F: NED-TCTTGCTAATTGCTTCATTTCAT(ATT)18K50280-32780.753
R: AATTGCTTGGGATTTTCATTT
Sat_391F: PET-GCGTAGGCATCGGTCAATATTTT(AT)37M50220-276170.918
R: GCGTTAGCGAGTGGATCAAGATCA
Satt308F: FAM-GCGTTAAGGTTGGCAGGGTGGAAGTG(ATT)21M50132-175120.898
R: GCGCAGCTTTATACAAAAATCAACAA
Satt157F: VIC-GGGCTCACTCTCGATAGTAGGTATAAAG(ATT)31D1b50188-295190.910
R: GGGATACCAAAAGGAATAATTGTCTT
Satt534F: NED-CTCCTCCTGCGCAACAACAATA(ATT)25B250148-212170.893
R: GGGGGATCTAGGCCATGAC
Satt181F: PET-TGGCTAGCAGATTGACA(ATT)18H50178-21760.867
R: GGAGCATAGCTGTTAGGA
Satt160F: FAM-TCCCACACAGTTTTCATATAATATA(ATT)30F50199-270120.883
R: CATCAAAAGTTTATAACGTGTAGAT
Satt002F: VIC-TGTGGGTAAAATAGATAAAAAT(ATT)25D250123-14570.900
R: TCATTTTGAATCGTTGAA
Satt030F: NED-AAAAAGTGAACCAAGCC(ATT)21F50129-170100.844
R: TCTTAAATCTTATGTTGATGC
Satt070F: PET-TAAAAATTAAAATACTAGAAGACAAC(ATT)24B250123-17890.871
R: TGGCATTAGAAAATGATATG

Total20413.815

Mean12.750.863

Microsatellite 분석

우리나라 콩 품종에 대한 microsatellite 분자 마커 기반의 DNA 프로파일 데이터베이스를 구축하기 위하여, 국제 콩 게놈 데이터베이스(http://www.soybase.org) 정보와 지금까지 여러 연구자에 의해 보고된 연구 결과(Hwang et al. 2008; Kim et al. 2006; Tantasawat et al. 2011; Wang et al. 2010)를 참고하여 품종식별력이 우수한 것으로 추정된 120개의microsatellite 마커를 선정하였다. 자동염기서열분석기(Genetic Analyzer 3730XL, Applied Biosystems, Foster, USA)를 활용하여 정밀도 높은 microsatellite 마커 분석을 하기 위하여, 프라이머의 정방향에 형광물질 FAM, VIC, NED, PET을 각각 labelling하였다(Cat. 450056, Applied Biosystems® Custom Primers, USA). PCR증폭에 사용된 용액의 조성은 50 ng의 genomic DNA, 10 pmol microsatellite primer, 2.0 µl 10 mM dNTP mixture, 2.5 µl 10/ Reaction buffer, 0.5U의 HS Prime Taq polymerase (G-7000, Genet Bio, Korea)에 초순수를 첨가하여 전체 부피를 30 µl로 조절하였다. PCR 증폭은 C1000 (BioRad, USA)를 사용하여 pre-denaturation을 94°C에서 5분간 수행하였고, 94°C에서 30초간 denaturation한 후, 50°C에서 30초간 annealing 하였고, 72°C에서 45초간 extension과정을 총39회 수행하고, 72°C에 10분간 final extension을 실시한 후 4°C, ∞ 조건에서 PCR 증폭반응을 완료하였다. 증폭된 PCR 산물을 자동염기서열분석기(Genetic Analyzer 3730XL, Applied Biosystems, Foster, USA)를 활용하여 전기영동 하기 위하여, PCR 증폭 산물 1.0 µl, Deionized formamide 10 µl, size marker (LIZ500 size standard) 0.25 µl를 혼합하여 94°C에서 2분간 denaturation 시켰다. 자동염기서열분석기에 의한 전기영동이 완료된 후, 각 마커에 따른 대립 유전자의 크기는 GeneMapper (version 4.1) 프로그램(Applied Biosystems, Foster, USA)을 이용하여 측정하였다.

유전적 유연관계 분석 및 품종식별력 검정

공시된 콩 품종에 대한의 microsatellite 마커별 대립 유전자의 크기를 설정한 다음 대립유전자의 유무에 따라 1, 0으로 표기한 다음, Anderson et al. (1993)이 제안한 공식에 따라 polymorphism information content (PIC) 값을 산출하였다. 아래 공식에서 Pij는 마커 i의 밴드들 중에서 j번째 공통 밴드 패턴의 빈도수이다.

PIC=1i=1npij2

콩 품종별 유전적 유연관계는 NTSYSpc (version 2.10b) (Rohlf 2000) 프로그램을 이용하여 Jaccard 방법에 따라 유전적 유사도 값을 계산하였으며, unweighted pair-group method with arithmetical average (UPGMA) (Sneath and Sokal 1973) 방법으로 계통도를 작성하고 공시품종별 그룹화 양상 및 품종식별력 정도를 분석하였다.

Microsatellite 분석

우리나라 콩 품종 식별 및 유전적 다양성 분석에 표준화된 microsatellite 마커를 선정하기 위하여, 국내외 연구자에 의해 콩 품종 및 유전자원 특성 평가에 활용된 프라이머 60개와 국제 콩 게놈 데이터베이스(http://www.soybase.org)에서 보고된 60개의 프라이머 정방향에 형광물질(FAM, VIC, NED, PET)을 표지하여 ‘화성풋’ 등 148품종과 PCR을 수행하였다. 1차적으로 120개의 프라이머 중에서 80개만이 반복 재현성이 높은 증폭 양상을 보였으나, 나머지 프라이머들은 안정성 있는 PCR 반응을 나타내지 않았는데 이는 종자에서 추출한 DNA의 순도와 분석의 단순화를 위해 annealing 온도 설정을 50°C로 고정하여 분석하였기 때문에 나타난 결과라고 추정된다. PCR 반응이 안정적인 80개의 프라이머를 이용하여 증폭된 PCR 산물을 자동염기서열분석기 3730XL을 이용하여 전기영동하고 GeneMapper (version 4.1) 프로그램으로 대립유전자의 크기를 추정하였을 때, 80개의 프라이머 가운데 40개는 대립유전자의 패턴이 복잡하여 콩 fingerprinting 분석에 제외시켰다. 나머지 40개의 프라이머 중에서 대립유전자의 크기를 명확하게 추정할 수 있으면서 다형성 정도가 높은 16개의 프라이머를 최종 선발하였다. Fig. 1은 콩 품종 식별에 적합한 16개의 프라이머 가운데 하나인 Satt614를 ‘청자’, ‘선록’, ‘신록’ 품종에 대하여 DNA 분석하였을 때, 대립유전자의 양상을 나타낸 것인데, 품종 별로 하나의 명확한 피크를 나타내었으며, ‘청자’는 394 bp, ‘선농’은 257 bp, ‘신록’의 경우 312 bp에서 뚜렷한 대립유전자 크기의 차이를 나타내었다. 따라서 Fig. 1의 Satt614와 같이 대립유전자의 피크 특성이 우수한 16개의 마커를 이용하여 콩 148 품종에 대한 다형성 정도를 조사한 바 (Table 1), 대립유전자의 수는 분석된 마커에 따라 최소 6개(Satt181)에서 최대 28개(Sat_251)까지 분포하였다. 전체 대립유전자의 수는 204개로 나타났고, 마커 당 평균 대립유전자의 수는 12.75개 였다. 마커에 따른 유전적 다형성 정도를 나타내는 지수인 PIC 값은 0.753 ~ 0.951까지 높은 범위에서 분포하였으며, 평균값도 0.863으로 아주 높게 나타났다. 본 연구에 최종 선정된 16개의 마커 중에서 Satt184, Satt216, Satt354, Sat_151, Satt417, Satt030을 제외한 10개의 마커는 0.85 이상의 높은 PIC 값을 나타내었다. 이상의 분석 결과를 종합해 볼 때, 본 연구에서 선정된 16개의 microsatellite 마커의 경우 마커 별 대립유전자 수와 PIC 값이 아주 높기 때문에 우리나라 콩 품종간 유전적 근연도 분석뿐만 아니라 품종 지문화에 유용하게 활용될 수 있을 것으로 나타났다.

Fig. 1.

Amplified fragment pattern of a SSR marker, Satt614 in 3 soybean varieties. PCR products were separated and detected using 3730 XL Genetic Analyzer (Applied Biosystems) with a 36 cm array and POP-7 polymer. Lane A, ‘Cheongja ’; B, ‘Seonnog’; C, ‘Shinrok’


본 연구에서 선발된 콩 148품종의 품종식별에 활용된 16개의 microsatellite 마커 가운데 대립유전자의 수가 20개 이상이고 PIC 값이 0.94 이상인 Satt614와 Satt255를 이용하여 대립유전자의 분포 빈도 양상을 조사한 바(Fig. 2), Satt614에 의해 검출되는 대립유전자는 257 bp에서 394 bp 사이에서 21개가 분석되었고, 대립유전자의 크기에 따른 빈도 분포양상은 0.6 ~ 14.5%까지 고르게 분포하였다. Sat_255의 경우 232 bp에서 328 bp 사이에 총 28개의 대립유전자가 위치하였으며, 대립유전자의 크기가 236 bp, 297 bp, 299 bp에서 각각 10% 이상의 다소 높은 빈도 분포 양상을 나타내었다. 그러나 나머지 대립유전자들은 빈도 분포는 0.7 ~ 7.2%까지 고르게 분포하였다.

Fig. 2.

Histogram depicting the alleles at 2 microsatellite loci, Satt614 (A) and Satt255 (B). Base-pair size and the frequency at each allele detected by148 soybean varieties


분자표지를 이용한 우리나라 콩 품종의 유전적 다양성 및 품종 식별에 대한 연구는 Kim 등(2016a, b)이 91개 콩 품종과 20개의 microsatellite 마커를 이용하여 분석시 평균 7.5개의 대립유전자가 확인되었고 평균 PIC 값은 0.711로 나타남을 보고하였고, PIC 값이 높은 5개의 SSR 마커 (Sat_043, Sat_036, Sat_022, Sat_088, Satt045)를 이용하여 91품종중 82품종이 식별이 가능함을 보고하였다. 일본에서는 377개의 microsatellite 마커를 이용하여 자국내의 87개 콩 품종 및 유전자원의 다양성 정도를 분석하였을 때 검출되는 대립유전자의 수는 2 ~ 10개의 범위이고, PIC 값은 0.02 ~ 086 범위에 속함을 보고하였으며(Hwang et al. 2008), 최근 인도에서는 102개 품종을 10개의 microsatellite 마커로 분석시 2 ~ 8개의 대립유전자가 분석되고 각 마커에 따른 PIC 값은 0.467 ~ 0.812로 나타남을 제시하였다 (Rani et al. 2016). 그러나 본 연구에서는 microsatellite 마커에 의해 검출된 평균대립유전자가 12.75개이고 평균 PIC 값도 0.863으로 높게 나타나 기존에 우리나라, 일본 및 인도에서 연구한 결과보다 대립유전자의 수도 많고 PIC 값도 높은 경향이었다. 이러한 이유는 본 연구에서 120개의 프라이머 중에서 품종식별력이 높은 16개의 핵심 분자표지를 선정하고 다양한 유전적 조성을 가진 콩 148 품종을 분석에 활용했기 때문이라 사료된다. 그리고 microsatellite 마커에 따른 품종별 대립유전자의 크기를 확인하는데 기존 연구자들은 아크릴아마이드나 아가로즈젤에서 분석한 것에 비해 본 연구에서는 자동염기서열분석기를 활용하여 품종별 대립유전자의 크기를 정확하게 설정하였기 때문에 나타난 결과라고 판단된다.

품종식별력 검정 및 유전적 유사도 분석

콩 148개 품종을 대립유전자 크기 추정이 용이하고 PIC 값이 0.75 이상인 마커 16개를 활용하여 군집분석에 의한 계통도를 작성한 바(Fig. 3), 공시된 품종들은 전체 유사도 지수는 0.04 ~ 0.88사이에 분포하였으며, 유사도 지수 0.10에서 공시품종은 5개의 대그룹으로 나눌 수 있었다. 그리고 모든 품종은 microsatellite 마커의 유전자형에 의해 뚜렷하게 식별이 되었다. I 그룹은 ‘화성풋’ 등 49품종이 속하였고, 이들 품종은 유사도 지수 0.16에서 3개의 소그룹으로 구분이 되었다. ‘다올’과 ‘큰올’ 품종이 87% 유전적 다소 높은 유전적 유사도를 나타내었다. 이러한 이유는 ‘다올’의 경우 ‘큰올’을 교배모본으로 활용하여 육성된 품종이기 때문인 것으로 판단된다. I-1은 ‘큰올’과 ‘검정올’이 모본이나 부본으로 활용된 ‘선녹’ 등 26품종이 속하였고, I-2은 종피색과 제색이 주로 흑색인 ‘청자’ 등 13품종이 분포하였다. I-3은 ‘진품’과 ‘진품2’ 및 이들 품종을 교배모본으로 활용된 10품종이 속하였다.

Fig. 3.

Dendrogram for 148 soybean varieties constructed using cluster analysis of the 204 microsatellite loci by unweighted pair-group method with arithmetical average (UPGMA). The scale at the bottom is Jaccard’s coefficient of similarity


II 그룹에는 ‘진율’ 등 54품종이 속하였고 ‘흑청’과 ‘대청’이 89%의 높은 유전적 유사도를 나타내었으며, 유사도 지도 0.14에서 4개의 소그룹으로 구분되었다. II-1은 ‘황금’이 교배모본으로 활용된 ‘진율’, ‘천상’, ‘선흑’과 ‘신농흑’을 이용하여 육성된 ‘검정3’ 등 9품종이 속하였다. II-2 그룹은 ‘신기’ 등 26품종이 포함되었고, 유사도 지수 0.17에서 2개의 그룹으로 다시 나눌 수 있었는데, II-2-a 그룹은 ‘신팔달2’와 ‘장엽’이 교배모본으로 활용된 ‘신기’, ‘검정2’, ‘검정5’, ‘대망’, ‘중모3009’, ‘대망2’ 등 8품종이 속하였고, II-2-b 그룹은 ‘수원190’, ‘수원191’, ‘수원193’ 및 미국 도입종인 ‘Williams’를 육성 재료로 활용되어 개발된 ‘다장’, ‘남풍’, ‘우람’, ‘단경’, ‘단원’, ‘만수’, ‘강일’, ‘연풍’ 등 18품종이 그룹화되었다. II-3그룹에는 ‘장엽’을 교배모본으로 육성된 ‘보광’, ‘만리’, ‘검정1’, ‘호장’ 등 9품종이 속하였고, II-4 그룹에는 ‘청두1’ 등 11품종이 속하였고, ‘백운’과 이를 이용하여 육성된 ‘명주나물’, ‘원황’, ‘대풍’이 속하였다.

III 그룹에는 ‘소명’ 등 9품종이 속하였고, ‘방사’ 또는 ‘풍산나물’을 이용하여 육성된 ‘소명’, ‘풀무지기’, ‘소황’과 한국원자력연구원에서 돌연변이 육종법으로 육성된 ‘원율’과 ‘원현’이 포함되었다. IV 그룹은 ‘안평’ 등 35품종이 속하였고, 유사도 지수 0.16에서 4개의 소그룹으로 구분할 수 있었다. IV-1은 ‘은하’, ‘남해’, ‘단엽’을 교배모본으로 이용하여 육성된 ‘안평’ 등 19품종이 속하였고, IV-2 경북대 및 소이벤처에서 ‘은하’와 야생콩(G. soja)를 교배하여 육성한 ‘아가1’ 등 7품종이 그룹화되었다. IV-3은 농촌진흥청에서 육성한 ‘부광’, ‘서남’, ‘소록’이 속하였고, IV-4는 종피색이 흑색인 ‘원흑’, ‘풀무흑채’, ‘다원’, ‘영양’, ‘진농’과 갈색 종피색을 가지는 ‘갈채’가 하나의 그룹을 형성하였다. V 그룹은 중국에서 육성되어 국내에 품종 보호 출원한 ‘중황13’이 독립된 그룹으로 분류되었다.

이상의 결과를 종합해보면 16개의 microsatellite마커는 지금까지 우리나라 콩 품종 식별 및 유전적 다양성 분석에 사용하지 않았던 새로운 핵심 마커 세트로서 국내에서 육성된 147품종과 중국에서 육성된 1품종에 대해서 품종 육성 계보에 따라 뚜렷하게 그룹화될 뿐만 아니라 모든 품종의 식별이 가능함을 확인하였다. 이러한 연구 결과는 콩 신품종에 대한 유전적 거리의 사전 예측, 품종보호 출원품종의 대조품종 선정과 구별성, 균일성, 안전성의 확인, 품종보호등록 품종의 특성 유지 확인, 콩 원종 및 보급종의 이품종 혼종 여부를 확인하는데 유용한 수단으로 활용될 수 있을 것이다.

최근 주요 작물에 대한 유전체 연구가 활발하게 진행되고 있는데, 염색체 내의 단일염기서열 변이(SNP)를 탐색하고 이를 품종식별용 마커로 개발하여 각 품종별로 바코드화한 연구가 보고 되고 있다(Tian et al. 2015; Gao et al. 2016). 향후, SNP 기반의 콩 품종식별 체계와 본 연구에서 microsatellite 마커에 의해 구축된 품종별 DNA 프로파일과의 그 효율성이 구체적으로 비교·분석된다면 콩의 품종 확인의 정확도는 한층 더 높아질 것으로 사료된다.

핵심 microsatellite 마커를 활용하여 우리나라에서 품종보호출원 및 등록된 콩 148 품종에 대한 DNA 프로파일 데이터베이스를 구축한 다음 유전적 유사도 분석을 통한 품종 식별력 정도를 조사하였다. 콩 148품종을 120개의 microsatellite 마커로 검정하고 밴드의 패턴이 명확하고 다형성 정도가 높은 핵심 마커 16개의 대립유전자의 수는 6 ~ 28개로 나타났고 평균 대립유전자의 수는 12.75개 였다. PIC 값은 0.753 ~ 0.951 사이에 분포하였고 평균값은 0.863으로 아주 높았다. 콩 148 품종에 대하여 Jaccard 방법에 따라 유전적 유사도를 설정한 다음 비가중 산술평균결합에 의해 집괴분석하여 계통도를 작성하였을 때, 콩의 품종 유형 및 품종 육성 계보에 따라 5개의 대그룹으로 나누어졌으며 모든 품종이 식별이 가능하였다.

본 연구에서 콩 품종식별용 핵심 microsatellite는 품종보호출원 품종의 구별성, 균일성, 안정성의 확인, 품종진위성과 관련된 종자분쟁, 종자 순도 관리에 매우 유용하게 활용될 수 있을 것이다.

이 논문은 동아대학교 교내연구비 지원에 의하여 연구되었음.

  1. Anderson JA, Churchill CA, Autrique JE, Tanksley SD, and Sorrells ME. (1993) Optimizing parental selection for genetic-linkage maps. Genome 36, 181-186.
    Pubmed CrossRef
  2. Bae KM, Sim SC, Hong JH, Choi KJ, Kim DH, and Kwon YS. (2015) Development of genomic SSR markers and genetic diversity analysis in cultivated radish (Raphanus sativus L.). Hortic Environ Biotechnol 56, 216-224.
    CrossRef
  3. Bredemeijer GMM, Cooke RJ, Ganal MW, Peeters R, Isaac P, Noordijk Y, Rendell S, Jackson J, Röder MS, Wendehake K, Dijcks M, Amelaine M, Wickaert V, Bertrand L, and Vosman B. (2002) Construction and testing of a microsatellite database containing more than 500 tomato varieties. Theor Appl Genet 105, 1019-1026.
    Pubmed CrossRef
  4. Gao L, Jia J, and Kong X. (2016) A SNP-based molecular barcode for characterization of common wheat. PLoS ONE 11, e0150947.
    CrossRef
  5. Hwang TY, Nakamoto Y, Kono I, Enoki H, Funatsuki H, Kitamura K, and Ishimoto M. (2008) Genetic diversity of cultivated and wild soybeans including Japanese elite cultivars as revealed by length polymorphism of SSR markers. Breed Sci 58, 315-323.
    CrossRef
  6. Hwang TY, Seo MJ, Lee SK, Park HM, Jeong KH, Lee YY, Kim SL, Yun HT, Lee JE, Kim DW, Jung GH, Kwon YU, Kim HS, and Kim YH. (2012) Discrimination of 110 Korean soybean cultivars by sequence tagged sites (STS)-CAPS markers. Kor J Breed Sci 44, 258-272.
  7. Jang SJ, Park SJ, Park KH, Song HL, Cho YG, Jong SK, Kang JH, and Kim HS. (2009) Genetic diversity and Identification of Korean elite soybean cultivars based on SSR markers. Korean J Crop Sci 54, 231-240.
  8. Kim SH, Chung JW, Moon JK, Woo SH, Cho YG, Jong SK, and Kim HS. (2006a) Discrimination of Korean soybean cultivars by SSR markers. Kor J Crop Sci 51, 658-668.
  9. Kim SH, Chung JW, Moon JK, Woo SH, Cho YG, Jong SK, and Kim HS. (2006b) Genetic diversity and relationship by SSR markers of Korean soybean cultivars. Kor J Crop Sci 51, 248-258.
  10. Kwon YS, Hong JH, and Choi KJ. (2013) Construction of a microsatellite marker database of commercial pepper cultivars. Korean J Hortic Sci Technol 31, 580-589.
    CrossRef
  11. Kwon YS, Hong JH, Kim DH, and Kim DH. (2015) Use of Microsatellite Markers Derived from Genomic and Expressed Sequence Tag (EST) to Identify Commercial Watermelon Cultivars. Korean J Hortic Sci Technol 33, 737-750.
    CrossRef
  12. Rani A, Kumar V, Shukla S, Jha P, and Rawal R. (2016) DNA barcoding of Indian soybean varieties as constructed through SSR markers. Seed Sci & Technol 44, 357-369.
    CrossRef
  13. Reid A, Hof L, Felix G, Rücker B, Tams S, Milczynska E, Esselink D, Uenk G, Vosman B, and Weitz A. (2011) Construction of an integrated microsatellite and key morphological characteristic database of potato varieties on the EU common catalogue. Euphytica 182, 239-249.
    CrossRef
  14. Röder MS, Wendehake K, Korzun V, Bredemeijer G, Laborie D, Bertrand L, Isaac P, Rendell S, Jackson J, Cooke RJ, Vosman B, and Ganal MW. (2002) Construction and analysis of a microsatellite-based database of European wheat varieties. Theor Appl Genet 106, 67-73.
    Pubmed CrossRef
  15. Rohlf FJ. (2000). NTSYSpc: Numerical taxonomy and multivariate analysis system, ver. 2.10b . Applied Biostatistics Inc, New York.
  16. Sim SC, Hong JH, and Kwon YS. (2015) DNA profiling of commercial pumpkin cultivars using simple sequence repeat polymorphisms. Hortic Environ Biotechnol 56, 811-820.
    CrossRef
  17. Sneath PHA, and Sokal RR. (1973). Numerical taxonomy: The principles and practice of numerical classification . Freeman W.H., San Francisco.
  18. Tantasawat P, Trongchuen J, Prajongjai T, Jenweerawat S, and Chaowiset W. (2011) SSR analysis of soybean (Glycine max (L.) Merr.) genetic relationship and variety identification in Thailand. Aust J Crop Sci 4, 301-308.
  19. Tian HL, Wang FG, Zhao JR, Yi HM, Wang L, Wang R, Tang Y, and Song W. (2015) Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Mol Breeding 35, 136.
    Pubmed KoreaMed CrossRef
  20. ., UPOV (2010). Guideline for DNA-profiling: molecular marker Selection and Database Construction (“BMT Guideline”) , Geneva, Switzerland.
  21. ., UPOV (2011). Possible Use of Molecular Markers in the Examination of Distinctness, Uniformity, and Stability (DUS) , Geneva, Switzerland.
  22. Wang M, Li RZ, Yang WM, and Du WJ. (2010) Assessing the genetic diversity of cultivars and wild soybeans using SSR markers. Afr J Biotechnol 9, 4857-4866.
  23. Wang FG, Tian HL, Zhao JR, Yi HM, Wang L, and Song W. (2011) Development and characterization of a core set of SSR markers for fingerprinting analysis of Chinese maize varieties. Maydica 56, 7-17.
  24. Yoon MS, Song QJ, Choi IY, Specht JE, Hyten DL, and Cregan PB. (2007) BARCSoySNP23: a panel of 23 selected SNPs for soybean cultivar identification. Theor Appl Genet 114, 885-899.
    Pubmed CrossRef

Article

Research Article

J Plant Biotechnol 2016; 43(4): 457-465

Published online December 31, 2016 https://doi.org/10.5010/JPB.2016.43.4.457

Copyright © The Korean Society of Plant Biotechnology.

핵심 Microsatellite 마커를 이용한 한국 콩 품종에 대한 Fingerprinting 분석

권용삼*

동아대학교 생명자원과학대학 분자유전공학과

Received: 26 October 2016; Revised: 21 November 2016; Accepted: 24 November 2016

DNA fingerprinting analysis for soybean (Glycine max) varieties in Korea using a core set of microsatellite marker

Yong-Sham Kwon*

Department of Molecular Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea

Correspondence to:e-mail: yskwon3@dau.ac.kr

Received: 26 October 2016; Revised: 21 November 2016; Accepted: 24 November 2016

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Microsatellites are one of the most suitable markers for identification of variety, as they have the capability to discriminate between narrow genetic variations. The polymorphism level between 120 microsatellite primer pairs and 148 soybean varieties was investigated through the fluorescence based automatic detection system. A set of 16 primer pairs showed highly reproducible polymorphism in these varieties. A total of 204 alleles were detected using the 16 microsatellite markers. The number of alleles per locus ranged from 6 to 28, with an average of 12.75 alleles per locus. The average polymorphism information content (PIC) was 0.86, ranging from 0.75 to 0.95. The unweighted pair group method using the arithmetic averages (UPGMA) cluster analysis for 148 varieties were divided into five distinctive groups, reflecting the varietal types and pedigree information. All the varieties were perfectly discriminated by marker genotypes. These markers may be useful to complement a morphological assessment of candidate varieties in the DUS (distinctness, uniformity and stability) test, intervening of seed disputes relating to variety authentication, and testing of genetic purity in soybean varieties.

Keywords: Cluster analysis, Genetic diversity, Molecular marker, Simple sequence repeat, Variety identification

서론

국제식물신품종보호동맹(International union for the protection of new varieties of plants; UPOV)에서는 식물 지식재산권 보호에 유전자 분석 기술의 표준화를 이루기 위하여 유전자 분석 기법과 분자 표지의 선정, DNA 분리 방법 및 데이터베이스 구축 방법 등에 대한 구체적인 가이드라인을 제시하고 있다(UPOV 2010, 2011). 이 가이드라인에서는 반복 재현성이 높고 공우성을 나타내며, 여러 가지 분석 장비에서도 오차가 없고 논문이나 게놈 데이터베이스를 통해 알려진 마커를 이용해야 한다는 기준을 제시하고 있다. 이러한 기준에 가장 적합한 것이 microsatellite와 single nucleotide polymorphism (SNP) 분석 방법인데 SNP 마커에 의한 품종식별 방법은 이용할 만한 정보가 아직까지 크게 부족하기 때문에 microsatellite 검정 방법이 주로 이용되고 있다. 실제로 유럽품종보호사무소(Community plant variety office; CPVO)에서는 토마토(Bredemeijer et al. 2002), 밀(Röder et al. 2002), 감자(Reid et al. 2011) 등과 같은 작물을 대상으로 품종별 DNA 프로파일 데이터베이스를 구축하였다. 일본에서는 딸기, 복숭아, 사과, 밤 등에 대하여 microsatellite 분석 기술에 의한 품종식별 체계를 구축하여 농업 생산물의 가공품에 대한 품종 진위성 확인 및 자국 농산물의 보호 등과 같은 분야에 유전자 분석 기술을 활용하고 있다(http://www.ncss.go.jp). 중국의 경우 옥수수에 대하여 microsatellite 마커와 SNP 분석 기술을 활용하여 품종별 데이터베이스를 구축하고 이를 품종보호 침해에 적극 이용하고 있다(Wang et al. 2011; Tian et al. 2015). 한편, 국립종자원에서 고추(Kwon et al. 2013), 수박(Kwon et al. 2015), 무(Bae et al. 2015), 호박(Sim et al. 2015) 등과 같은 작물에 대하여 다형성이 높은 microsatellite 마커를 활용하여 종자시장에서 유통되고 있는 주요 품종에 대하여 DNA 프로파일 데이터베이스를 구축하였거나 구축 중에 있다. 이러한 작물별 DNA 프로파일 데이터베이스는 품종보호출원 품종의 대조품종 선정 및 품종보호 재배심사시 구별성, 균일성 및 안정성을 확인하는데 보조자료로 이용되고 있다. 최근에는 품종보호등록 품종의 특성 유지 여부를 확인하기 위하여 유전자 분석 기술과 재배시험에 의한 특성조사를 융·복합적으로 이용하고 있다. 또한 품종 식별 분자 마커는 농가와 종자 회사 및 종자회사 간에 발생하는 품종 진위성과 관련된 종자분쟁을 해결하는 하나의 수단으로 적극 활용되고 있는 추세이다.

우리나라 콩의 재배 면적은 2015년 기준 57천 ha이며 생산량은 104천 톤으로 과거에 비해 다소 감소하고 있는 추세이다(http://www.mafra.go.kr). 그러나, 최근 콩을 이용한 다양한 건강 식품이 개발되고 있고 그 수요도 점점 커질 것으로 예상된다. 따라서 콩 육종 목표도 다수성 이외에 용도별 신품종 개발, 기능성 고품질, 안정된 생산을 위한 병충해 및 재해 저항성 품종 개발 등으로 다양화되고 있다. 국내 콩 품종은 2016년 9월 30일 기준 품종보호 출원된 193품종중에서 163 품종이 등록되었으며, ‘대원’, 태광’, ‘대풍’, ‘우람’, ‘연풍’, ‘풍산나물’은 국가에서 직접 종자를 생산하여 농가에 보급하고 있다(http://www.seed.go.kr).

분자 마커를 이용하여 콩의 유전자원 특성 평가 및 품종식별에 대한 국내외 연구 동향을 살펴보면, microsatellite 마커에 의한 우리나라 콩 육성 품종의 유전적 다양성과 유연관계 분석 (Kim et al. 2016a, b)과 콩 보급품종과 엘리트 품종에 대한 유전적 다양성과 품종 판별(Jang et al. 2009), STS-CAPS (Sequence tagged sites-cleaved amplification polymorphic sequence) 마커 개발(Hwang et al. 2012) 등에 대한 연구를 수행한 바 일부 품종에 대해서는 식별이 되지 않음을 지적한 바 있다. 국외의 경우 일본에서 377개 microsatellite 마커를 활용하여 82개 유전자원 및 육성품종에 대해 유전적 다양성을 분석하였으며(Hwang et al. 2008), 미국에서는 콩 품종식별에 적합한 SNP 마커를 개발하여 132개 유전자원 및 품종 식별에 대한 연구 결과도 발표된 바 있다(Yoon et al. 2007). 최근, 인도에서는 자국내의 주요 콩 102 품종에 대한 microsatellite 마커의 유전자형을 설정한 다음 이를 바코드화하여 종자 순도관리에 실용적 활용이 가능함을 제시하였다(Rani et al. 2016). 이상의 연구 결과를 종합해 볼 때, 우리나라 콩에 대한 품종식별 및 유전적 다양성 연구는 유전적으로 가까운 일부 품종이 식별이 되지 않는 점과 검정 대상 품종도 농촌진흥청과 일부 지방 자치 단체에서 육성된 품종을 대상으로 분석하였다는 점이다. 따라서 최근에 농촌진흥청, 지방자치단체, 한국원자력원구원, 대학 및 벤처기업에서 육성된 품종을 대상으로 하여 품종 식별력이 높은 핵심 분자 마커의 선정은 우리나라 콩 품종의 유전적 다양성뿐만 아니라 지식재산권 보호 및 종자의 순도관리 등 다방면에 활용될 수 있을 것이다.

따라서 본 연구에서는 국내에서 육성된 콩 148개 품종에 대해 반복 재현성이 우수한 microsatellite 마커를 선발하고, 이를 활용한 유전적 유연관계 분석을 통한 품종식별 정도 등에 대한 일련의 연구를 수행하여 얻어진 결과를 보고하는 바이다.

재료 및 방법

공시품종 및 DNA 추출

본 연구에서는 ‘화성풋’ 등 148품종(농촌진흥청 114품종, 강원도 6품종, 경기도 3품종, 충청북도 2품종, 경상북도 영주시 1품종, 한국원자력연구원 3품종, 경북대학교 2품종, 소이벤처 5품종, 경상대학교 6품종, 서울대학교 2품종, 영남대학교 2품종, 제노마인 1품종, 중국 1품종)의 종자를 공시재료로 선정하였다(Table 1). 공시품종의 종자 5립을 분쇄기(Pulverisette 6, Fritsch)를 이용하여 마쇄하고 분말 200 mg을 Safe-Lock 2.0 ml 튜브(Cat. W129549M, Eppendorf, USA)로 옮긴 다음, NucleoSpin® Plant II (Cat. 740 770.250, Macherey-Nagel GmbH & Co., KG, Deutsch) 키트내의 Buffer PL II buffer 400 ml을 첨가하여 조직을 lysis 시켰다. 그 이후 실험 절차는 키트에 포함된 매뉴얼에 준하여 DNA를 추출하였다. 분리된 DNA는 분광광도계(NanoDrop2000, Thermo Scientific, USA)를 이용하여 농도를 확인한 후 µl 당 10 ng의 농도로 정량하였다.

Table 1 . List of 148 soybean varieties assayed for genetic characterization using microsatellite markers.

No.Varieties nameParentageSourcesNo.Varieties nameParentageSources
1HwasongputPure line selection derived from Gyeongido and Gangwondo germplasmRDA75SonghakDongsan74/JangbaekRDA
2JinyulHwanggeum/SinnongheukRDA76DoremiNamhae/YS569RDA
3Geomjeong3Sinnongheuk/SNUA78010RDA77SohoNamhae/YS569RDA
4AnpyeongEunha/(KAS391-7/SS88034)RDA78JinmiHS12/ManriRDA
5ShingiBaekun/Shinpaldal2RDA79SunamKosuzu/BupyeongRDA
6Chungdu1SI93006/Shinpaldal2RDA80DagiNamhae/D70-6545RDA
7DaemangJangyeob/SeokrangputRDA81Hojang(Jangyeob/Hwanggeum)/Suwon153RDA
8Cheongja3Suwon174/Mokpo17RDA82BosugNamhae/CampRDA
9Daemang2Shinpaldal2/SeokrangputRDA83SokangNamhae/CampRDA
10MilangKeunol/GeomjeongolRDA84NogchaePureun/Milyang44RDA
11Dajang(Haman/Williams)/PaldalRDA85WonhwangCamp/MyungjunamulRDA
12Keumgang[(Suwon61/SS6807)/Clark63]/(Suwon111/H-25)RDA86JangkiEunha/MS91088RDA
13HannamYS236/SS79168-67-5RDA87PungwonSI93001/Suwon164RDA
14IlpumgeomjeongSLSB 87-3/(Hwanggeum/SLSB-45)RDA88JonamEunha/Jeonju-11RDA
15GeomjeongolPure line selection derived from Milyangjaerae germplasmRDA89GalchaeYS1287/Jinju1RDA
16Jangmi(D69-7816/Essex)/SLSB 87-2RDA90SohwangPungsannamul/HS646(Pungsan/Nattosan)RDA
17Duyou(Williams/S7145-BF₂-11-5)/BonghwajaeraejongRDA91JinpungSuwon215/(SI993746/SS01211)RDA
18BukwangJangbaek/BangsaRDA92Joyang1Pungsannamul/Suwon187RDA
19SobaeknamulMilyang18/BonghwajaeraejongRDA93Jungmo3008Hwanggeum/(Suwon180/SI993791)RDA
20Ilmi(Paldal/Saeal)/PaldalRDA94UramSuwon190/(Sinpaldal2/T243)RDA
21Saeol[(Danwon/Paldal)/Keunol]/BaeksajaRDA95HwangkeumolSS92414/HwaeomputRDA
22MyeongjunamulJangyeob/DanyeobRDA96SaedanbaekMD87L/SS92414RDA
23SowonEunha/BangsaRDA97NeulchanSS91501-9-1-1/SS96205RDA
24DaehwangKeunol/SLSB87-3RDA98ChamolSinpaldal2/KeunolRDA
25JangwonBogwang/SS84040RDA99Jungmo3009Milyang121/DaemangRDA
26SaebyeolBugwang/NamhaeRDA100HaepumBoseok/Suwon214RDA
27CheongjaMilyang55/Geomjeong1RDA101Jungmo3004Iksan21/Milyang98RDA
28SeonnogKeunol/Japan introductionRDA102Jungmo3005Cheongja/Geomjeong3RDA
29ShinrokSuwon163/Jinpum2RDA103TaekwangSS77011/Dongsan53RDA
30SorokPureun/NamhaeRDA104MalliJangyeob/PI219782RDA
31Geomjeong4(Paldal/YCS87-3) /YSC87-3RDA105JangsuElf/SS74185RDA
32DaepungBaekun/Shinpaldal2RDA106MuhanHwanggeum/WellsRDA
33DachaeHannam/EunhaRDA107PokwangJangyeob/PI219787RDA
34DaolKeunol/YS1040RDA108BaegunGwanggyo/dt1-long racemeRDA
35DanmiMilyang37/JosaengbaekjojoduRDA109KeunolPure line selection derived from ChilgokjaeraeRDA
36Dajin(Keunol/Josaengbaekdo)/KeunolRDA110Samnam(Suwon101/YS104)/Suwon101RDA
37Cheongja2Milyang70/IlpumgeomjeongRDA111DanweonWilliams/Suwon61RDA
38SojinDanyeob/SI93001RDA112NamhaeDanyeob/HillRDA
39SeonyuSuwon162/(SS79168/Saeal)RDA113DankyeongGwanggyo/WilliamsRDA
40GeomjeongsaeolKeunol/GeomjeongolRDA114SaealGwanggyo/SS7145-2B-45-3-4RDA
41Danmi2Seokrangput/(Seokrang/Milyang77)RDA115HeugcheongPure line selection derived from Yeongwoljaerae germplasmGangwondo
42Ilpumgeomjeong2Milyang68/Suwon178RDA116HobanGWS91/JinpumGangwondo
43HeugmiMilyang78/Milyang68RDA117CheongaShinpaldal2/SS97809Gangwondo
44SocheongMilyang78/PeingRDA118DaewangGWS91/SeokrangputGangwondo
45NogwonKeunol/Hyangnam1RDA119GangilSuwon191/Suwon196Gangwondo
46MansuHwanggeum/Dongsan118RDA120HaessalShinpaldal2/KeunolGangwondo
47NampungSuwon190/BogwangRDA121ManpoongDongsan121/Sprite87Gyeongido
48SangwonKeunol/OsimamidoriRDA122YeonpoongSuwon191/Suwon196Gyeongido
49DaeyangSuwon192/(Jangyeob/Hwaeomput)RDA123JangyonSS96321/SS01242Gyeongido
50DaeheugDaehwang/Milyang79RDA124DaecheongChucheonjaerae/DongbukheukduChungcheongbukdo
51HeugsungGnome85/CheongjaRDA125GalmiPure line selection derived from GwangjujaeraeChungcheongnamdo
52Daeha1Milyang192/(Jangyeob/Hwaeomput)RDA126Buseoktae1Pure line selection derived from YeongjaeraeYeongjusi
53CheonsangSuwon190/HwanggeumRDA127JosaengseoriMutants derived from irradiated SeoritaeKAERI
54Geomjeong5Sinpaldal/Geomjeong2RDA128WonyulMutants derived from irradiated KAS360-22KAERI
55Wonheug(Suwon182/Jinju1)/Jinju1RDA129WonhyunMutants derived from irradiated PaldalKAERI
56Socheong2Milyang78/PekingRDA130Aga1Eunha/KLG10084KPNU
57Cheongyeob1Ilpumgeomjeong/DaehwangRDA131Aga2Eunha/KLG10084KPNU
58IksannamulDanyeob/HillRDA132Aga3Eunha/KLG10084Soy Venture
59AlchanHwangkum/EunhaRDA133Aga4Eunha/KLG10084Soy Venture
60PungsannamulBangsa/KLS87092RDA134Aga9Eunha/KLG10084Soy Venture
61Shinpaldal2Deogyu/PaldalRDA135Aga8Eunha/KLG10084Soy Venture
62Geomjeong1(Jangyeob/Jaeraebabmit)/HwanggeumRDA136Aga10Eunha/KLG10084Soy Venture
63DanbaegDongsan69/D76-8070RDA137Gyeongsang2Seoritae/JinpumKSNU
64KwanganDongsan69/HwanggeumRDA138Gaechuk 1Gyeongsang1/(Seoritae/C242)KSNU
65PureunCheongsaeknamul/L78-379RDA139Gaechuk 2Jinpum2/C242KSNU
66TawonPaldal/ES33RDA140Gyeongsang3Jwinunyi/SP2KSNU
67DaewonSuwon133/Milyang18RDA141Jinnong1Jwinunyi/C242KSNU
68Jinpum2Pure line selection derived from Japanese germplasmRDA142JinyangJinpum2/GS301KSNU
69Geomjeong2SS83021/SS83033RDA143PulmuheukchaeJinju1xPI96188SNU
70JinpumPure line selection derived from Japanese germplasmRDA144PulmujigiPungsannamul/SS2-2SNU
71SomyeongEunha/BangsaRDA145YoungyangWillims/YWS9301YNU
72SodamSNUA78010/Dongsan127RDA146SomyeongEunha/BangsaYNU
73SeonheukHwanggeum/SinnongheukRDA147Gyeongsang1Seoritae/Jinpum1Jenomine
74PaldoKw220-26/HillRDA148ZhonghuangYeodu8/90052-76Lee Yeong Phil

RDA: Rural development administration, KAERI: Korea Atomic Energy Research Institute, KPNU: Kyungpook National University, KSNU: Kyungsang National University, SNU; Seoul National University, YNU; Yeungnam University.


Table 2 . Repeat motif, number of alleles, and polymorphism information content (PIC) value of microsatellite markers selected for genetic characterization of the 148 soybean varieties.

SSR designationPrimer sequenceRepeat motifLinkage groupAnnealing temp.Product size (bp)No. of allelesPIC value
Satt184F: FAM-GCGCTATGTAGATTATCCAAATTACGC(ATT)14D1a50135-19780.774
R: GCCACTTACTGTTACTCAT(TTG)5
Satt216F: VIC-TACCCTTAATCACCGGACAA(ATT)20D1b50140-217120.840
R: AGGGAACTAACACATTTAATCATCA
Satt614F: VIC-CTCCCCTTTAACCTTTCCTTTATTAG(TTA)38I50257-394210.951
R: CGCGGTAGGAATTAATTGTAGATAGGAT
Satt354F: PET-GCGAAAATGGACACCAAAAGTAGTTA(ATT)14I50179-24790.759
R: GCGATGCACATCAATTAGAATATACAA
Sat_151F: FAM-GCTGCATCAGATCACCCATCCTTC(AT)27J50215-27290.813
R: CATGCCATGTTGTATGTATGT
Sat_255F: VIC-CGGCATGTCATGGTATACGTAACTTTAGA(AT)32J50232-328280.942
R: GCGCAACTGAAGCAAGAAAAGAAACCT
Satt417F: NED-TCTTGCTAATTGCTTCATTTCAT(ATT)18K50280-32780.753
R: AATTGCTTGGGATTTTCATTT
Sat_391F: PET-GCGTAGGCATCGGTCAATATTTT(AT)37M50220-276170.918
R: GCGTTAGCGAGTGGATCAAGATCA
Satt308F: FAM-GCGTTAAGGTTGGCAGGGTGGAAGTG(ATT)21M50132-175120.898
R: GCGCAGCTTTATACAAAAATCAACAA
Satt157F: VIC-GGGCTCACTCTCGATAGTAGGTATAAAG(ATT)31D1b50188-295190.910
R: GGGATACCAAAAGGAATAATTGTCTT
Satt534F: NED-CTCCTCCTGCGCAACAACAATA(ATT)25B250148-212170.893
R: GGGGGATCTAGGCCATGAC
Satt181F: PET-TGGCTAGCAGATTGACA(ATT)18H50178-21760.867
R: GGAGCATAGCTGTTAGGA
Satt160F: FAM-TCCCACACAGTTTTCATATAATATA(ATT)30F50199-270120.883
R: CATCAAAAGTTTATAACGTGTAGAT
Satt002F: VIC-TGTGGGTAAAATAGATAAAAAT(ATT)25D250123-14570.900
R: TCATTTTGAATCGTTGAA
Satt030F: NED-AAAAAGTGAACCAAGCC(ATT)21F50129-170100.844
R: TCTTAAATCTTATGTTGATGC
Satt070F: PET-TAAAAATTAAAATACTAGAAGACAAC(ATT)24B250123-17890.871
R: TGGCATTAGAAAATGATATG

Total20413.815

Mean12.750.863

Microsatellite 분석

우리나라 콩 품종에 대한 microsatellite 분자 마커 기반의 DNA 프로파일 데이터베이스를 구축하기 위하여, 국제 콩 게놈 데이터베이스(http://www.soybase.org) 정보와 지금까지 여러 연구자에 의해 보고된 연구 결과(Hwang et al. 2008; Kim et al. 2006; Tantasawat et al. 2011; Wang et al. 2010)를 참고하여 품종식별력이 우수한 것으로 추정된 120개의microsatellite 마커를 선정하였다. 자동염기서열분석기(Genetic Analyzer 3730XL, Applied Biosystems, Foster, USA)를 활용하여 정밀도 높은 microsatellite 마커 분석을 하기 위하여, 프라이머의 정방향에 형광물질 FAM, VIC, NED, PET을 각각 labelling하였다(Cat. 450056, Applied Biosystems® Custom Primers, USA). PCR증폭에 사용된 용액의 조성은 50 ng의 genomic DNA, 10 pmol microsatellite primer, 2.0 µl 10 mM dNTP mixture, 2.5 µl 10/ Reaction buffer, 0.5U의 HS Prime Taq polymerase (G-7000, Genet Bio, Korea)에 초순수를 첨가하여 전체 부피를 30 µl로 조절하였다. PCR 증폭은 C1000 (BioRad, USA)를 사용하여 pre-denaturation을 94°C에서 5분간 수행하였고, 94°C에서 30초간 denaturation한 후, 50°C에서 30초간 annealing 하였고, 72°C에서 45초간 extension과정을 총39회 수행하고, 72°C에 10분간 final extension을 실시한 후 4°C, ∞ 조건에서 PCR 증폭반응을 완료하였다. 증폭된 PCR 산물을 자동염기서열분석기(Genetic Analyzer 3730XL, Applied Biosystems, Foster, USA)를 활용하여 전기영동 하기 위하여, PCR 증폭 산물 1.0 µl, Deionized formamide 10 µl, size marker (LIZ500 size standard) 0.25 µl를 혼합하여 94°C에서 2분간 denaturation 시켰다. 자동염기서열분석기에 의한 전기영동이 완료된 후, 각 마커에 따른 대립 유전자의 크기는 GeneMapper (version 4.1) 프로그램(Applied Biosystems, Foster, USA)을 이용하여 측정하였다.

유전적 유연관계 분석 및 품종식별력 검정

공시된 콩 품종에 대한의 microsatellite 마커별 대립 유전자의 크기를 설정한 다음 대립유전자의 유무에 따라 1, 0으로 표기한 다음, Anderson et al. (1993)이 제안한 공식에 따라 polymorphism information content (PIC) 값을 산출하였다. 아래 공식에서 Pij는 마커 i의 밴드들 중에서 j번째 공통 밴드 패턴의 빈도수이다.

PIC=1i=1npij2

콩 품종별 유전적 유연관계는 NTSYSpc (version 2.10b) (Rohlf 2000) 프로그램을 이용하여 Jaccard 방법에 따라 유전적 유사도 값을 계산하였으며, unweighted pair-group method with arithmetical average (UPGMA) (Sneath and Sokal 1973) 방법으로 계통도를 작성하고 공시품종별 그룹화 양상 및 품종식별력 정도를 분석하였다.

결과 및 고찰

Microsatellite 분석

우리나라 콩 품종 식별 및 유전적 다양성 분석에 표준화된 microsatellite 마커를 선정하기 위하여, 국내외 연구자에 의해 콩 품종 및 유전자원 특성 평가에 활용된 프라이머 60개와 국제 콩 게놈 데이터베이스(http://www.soybase.org)에서 보고된 60개의 프라이머 정방향에 형광물질(FAM, VIC, NED, PET)을 표지하여 ‘화성풋’ 등 148품종과 PCR을 수행하였다. 1차적으로 120개의 프라이머 중에서 80개만이 반복 재현성이 높은 증폭 양상을 보였으나, 나머지 프라이머들은 안정성 있는 PCR 반응을 나타내지 않았는데 이는 종자에서 추출한 DNA의 순도와 분석의 단순화를 위해 annealing 온도 설정을 50°C로 고정하여 분석하였기 때문에 나타난 결과라고 추정된다. PCR 반응이 안정적인 80개의 프라이머를 이용하여 증폭된 PCR 산물을 자동염기서열분석기 3730XL을 이용하여 전기영동하고 GeneMapper (version 4.1) 프로그램으로 대립유전자의 크기를 추정하였을 때, 80개의 프라이머 가운데 40개는 대립유전자의 패턴이 복잡하여 콩 fingerprinting 분석에 제외시켰다. 나머지 40개의 프라이머 중에서 대립유전자의 크기를 명확하게 추정할 수 있으면서 다형성 정도가 높은 16개의 프라이머를 최종 선발하였다. Fig. 1은 콩 품종 식별에 적합한 16개의 프라이머 가운데 하나인 Satt614를 ‘청자’, ‘선록’, ‘신록’ 품종에 대하여 DNA 분석하였을 때, 대립유전자의 양상을 나타낸 것인데, 품종 별로 하나의 명확한 피크를 나타내었으며, ‘청자’는 394 bp, ‘선농’은 257 bp, ‘신록’의 경우 312 bp에서 뚜렷한 대립유전자 크기의 차이를 나타내었다. 따라서 Fig. 1의 Satt614와 같이 대립유전자의 피크 특성이 우수한 16개의 마커를 이용하여 콩 148 품종에 대한 다형성 정도를 조사한 바 (Table 1), 대립유전자의 수는 분석된 마커에 따라 최소 6개(Satt181)에서 최대 28개(Sat_251)까지 분포하였다. 전체 대립유전자의 수는 204개로 나타났고, 마커 당 평균 대립유전자의 수는 12.75개 였다. 마커에 따른 유전적 다형성 정도를 나타내는 지수인 PIC 값은 0.753 ~ 0.951까지 높은 범위에서 분포하였으며, 평균값도 0.863으로 아주 높게 나타났다. 본 연구에 최종 선정된 16개의 마커 중에서 Satt184, Satt216, Satt354, Sat_151, Satt417, Satt030을 제외한 10개의 마커는 0.85 이상의 높은 PIC 값을 나타내었다. 이상의 분석 결과를 종합해 볼 때, 본 연구에서 선정된 16개의 microsatellite 마커의 경우 마커 별 대립유전자 수와 PIC 값이 아주 높기 때문에 우리나라 콩 품종간 유전적 근연도 분석뿐만 아니라 품종 지문화에 유용하게 활용될 수 있을 것으로 나타났다.

Figure 1.

Amplified fragment pattern of a SSR marker, Satt614 in 3 soybean varieties. PCR products were separated and detected using 3730 XL Genetic Analyzer (Applied Biosystems) with a 36 cm array and POP-7 polymer. Lane A, ‘Cheongja ’; B, ‘Seonnog’; C, ‘Shinrok’


본 연구에서 선발된 콩 148품종의 품종식별에 활용된 16개의 microsatellite 마커 가운데 대립유전자의 수가 20개 이상이고 PIC 값이 0.94 이상인 Satt614와 Satt255를 이용하여 대립유전자의 분포 빈도 양상을 조사한 바(Fig. 2), Satt614에 의해 검출되는 대립유전자는 257 bp에서 394 bp 사이에서 21개가 분석되었고, 대립유전자의 크기에 따른 빈도 분포양상은 0.6 ~ 14.5%까지 고르게 분포하였다. Sat_255의 경우 232 bp에서 328 bp 사이에 총 28개의 대립유전자가 위치하였으며, 대립유전자의 크기가 236 bp, 297 bp, 299 bp에서 각각 10% 이상의 다소 높은 빈도 분포 양상을 나타내었다. 그러나 나머지 대립유전자들은 빈도 분포는 0.7 ~ 7.2%까지 고르게 분포하였다.

Figure 2.

Histogram depicting the alleles at 2 microsatellite loci, Satt614 (A) and Satt255 (B). Base-pair size and the frequency at each allele detected by148 soybean varieties


분자표지를 이용한 우리나라 콩 품종의 유전적 다양성 및 품종 식별에 대한 연구는 Kim 등(2016a, b)이 91개 콩 품종과 20개의 microsatellite 마커를 이용하여 분석시 평균 7.5개의 대립유전자가 확인되었고 평균 PIC 값은 0.711로 나타남을 보고하였고, PIC 값이 높은 5개의 SSR 마커 (Sat_043, Sat_036, Sat_022, Sat_088, Satt045)를 이용하여 91품종중 82품종이 식별이 가능함을 보고하였다. 일본에서는 377개의 microsatellite 마커를 이용하여 자국내의 87개 콩 품종 및 유전자원의 다양성 정도를 분석하였을 때 검출되는 대립유전자의 수는 2 ~ 10개의 범위이고, PIC 값은 0.02 ~ 086 범위에 속함을 보고하였으며(Hwang et al. 2008), 최근 인도에서는 102개 품종을 10개의 microsatellite 마커로 분석시 2 ~ 8개의 대립유전자가 분석되고 각 마커에 따른 PIC 값은 0.467 ~ 0.812로 나타남을 제시하였다 (Rani et al. 2016). 그러나 본 연구에서는 microsatellite 마커에 의해 검출된 평균대립유전자가 12.75개이고 평균 PIC 값도 0.863으로 높게 나타나 기존에 우리나라, 일본 및 인도에서 연구한 결과보다 대립유전자의 수도 많고 PIC 값도 높은 경향이었다. 이러한 이유는 본 연구에서 120개의 프라이머 중에서 품종식별력이 높은 16개의 핵심 분자표지를 선정하고 다양한 유전적 조성을 가진 콩 148 품종을 분석에 활용했기 때문이라 사료된다. 그리고 microsatellite 마커에 따른 품종별 대립유전자의 크기를 확인하는데 기존 연구자들은 아크릴아마이드나 아가로즈젤에서 분석한 것에 비해 본 연구에서는 자동염기서열분석기를 활용하여 품종별 대립유전자의 크기를 정확하게 설정하였기 때문에 나타난 결과라고 판단된다.

품종식별력 검정 및 유전적 유사도 분석

콩 148개 품종을 대립유전자 크기 추정이 용이하고 PIC 값이 0.75 이상인 마커 16개를 활용하여 군집분석에 의한 계통도를 작성한 바(Fig. 3), 공시된 품종들은 전체 유사도 지수는 0.04 ~ 0.88사이에 분포하였으며, 유사도 지수 0.10에서 공시품종은 5개의 대그룹으로 나눌 수 있었다. 그리고 모든 품종은 microsatellite 마커의 유전자형에 의해 뚜렷하게 식별이 되었다. I 그룹은 ‘화성풋’ 등 49품종이 속하였고, 이들 품종은 유사도 지수 0.16에서 3개의 소그룹으로 구분이 되었다. ‘다올’과 ‘큰올’ 품종이 87% 유전적 다소 높은 유전적 유사도를 나타내었다. 이러한 이유는 ‘다올’의 경우 ‘큰올’을 교배모본으로 활용하여 육성된 품종이기 때문인 것으로 판단된다. I-1은 ‘큰올’과 ‘검정올’이 모본이나 부본으로 활용된 ‘선녹’ 등 26품종이 속하였고, I-2은 종피색과 제색이 주로 흑색인 ‘청자’ 등 13품종이 분포하였다. I-3은 ‘진품’과 ‘진품2’ 및 이들 품종을 교배모본으로 활용된 10품종이 속하였다.

Figure 3.

Dendrogram for 148 soybean varieties constructed using cluster analysis of the 204 microsatellite loci by unweighted pair-group method with arithmetical average (UPGMA). The scale at the bottom is Jaccard’s coefficient of similarity


II 그룹에는 ‘진율’ 등 54품종이 속하였고 ‘흑청’과 ‘대청’이 89%의 높은 유전적 유사도를 나타내었으며, 유사도 지도 0.14에서 4개의 소그룹으로 구분되었다. II-1은 ‘황금’이 교배모본으로 활용된 ‘진율’, ‘천상’, ‘선흑’과 ‘신농흑’을 이용하여 육성된 ‘검정3’ 등 9품종이 속하였다. II-2 그룹은 ‘신기’ 등 26품종이 포함되었고, 유사도 지수 0.17에서 2개의 그룹으로 다시 나눌 수 있었는데, II-2-a 그룹은 ‘신팔달2’와 ‘장엽’이 교배모본으로 활용된 ‘신기’, ‘검정2’, ‘검정5’, ‘대망’, ‘중모3009’, ‘대망2’ 등 8품종이 속하였고, II-2-b 그룹은 ‘수원190’, ‘수원191’, ‘수원193’ 및 미국 도입종인 ‘Williams’를 육성 재료로 활용되어 개발된 ‘다장’, ‘남풍’, ‘우람’, ‘단경’, ‘단원’, ‘만수’, ‘강일’, ‘연풍’ 등 18품종이 그룹화되었다. II-3그룹에는 ‘장엽’을 교배모본으로 육성된 ‘보광’, ‘만리’, ‘검정1’, ‘호장’ 등 9품종이 속하였고, II-4 그룹에는 ‘청두1’ 등 11품종이 속하였고, ‘백운’과 이를 이용하여 육성된 ‘명주나물’, ‘원황’, ‘대풍’이 속하였다.

III 그룹에는 ‘소명’ 등 9품종이 속하였고, ‘방사’ 또는 ‘풍산나물’을 이용하여 육성된 ‘소명’, ‘풀무지기’, ‘소황’과 한국원자력연구원에서 돌연변이 육종법으로 육성된 ‘원율’과 ‘원현’이 포함되었다. IV 그룹은 ‘안평’ 등 35품종이 속하였고, 유사도 지수 0.16에서 4개의 소그룹으로 구분할 수 있었다. IV-1은 ‘은하’, ‘남해’, ‘단엽’을 교배모본으로 이용하여 육성된 ‘안평’ 등 19품종이 속하였고, IV-2 경북대 및 소이벤처에서 ‘은하’와 야생콩(G. soja)를 교배하여 육성한 ‘아가1’ 등 7품종이 그룹화되었다. IV-3은 농촌진흥청에서 육성한 ‘부광’, ‘서남’, ‘소록’이 속하였고, IV-4는 종피색이 흑색인 ‘원흑’, ‘풀무흑채’, ‘다원’, ‘영양’, ‘진농’과 갈색 종피색을 가지는 ‘갈채’가 하나의 그룹을 형성하였다. V 그룹은 중국에서 육성되어 국내에 품종 보호 출원한 ‘중황13’이 독립된 그룹으로 분류되었다.

이상의 결과를 종합해보면 16개의 microsatellite마커는 지금까지 우리나라 콩 품종 식별 및 유전적 다양성 분석에 사용하지 않았던 새로운 핵심 마커 세트로서 국내에서 육성된 147품종과 중국에서 육성된 1품종에 대해서 품종 육성 계보에 따라 뚜렷하게 그룹화될 뿐만 아니라 모든 품종의 식별이 가능함을 확인하였다. 이러한 연구 결과는 콩 신품종에 대한 유전적 거리의 사전 예측, 품종보호 출원품종의 대조품종 선정과 구별성, 균일성, 안전성의 확인, 품종보호등록 품종의 특성 유지 확인, 콩 원종 및 보급종의 이품종 혼종 여부를 확인하는데 유용한 수단으로 활용될 수 있을 것이다.

최근 주요 작물에 대한 유전체 연구가 활발하게 진행되고 있는데, 염색체 내의 단일염기서열 변이(SNP)를 탐색하고 이를 품종식별용 마커로 개발하여 각 품종별로 바코드화한 연구가 보고 되고 있다(Tian et al. 2015; Gao et al. 2016). 향후, SNP 기반의 콩 품종식별 체계와 본 연구에서 microsatellite 마커에 의해 구축된 품종별 DNA 프로파일과의 그 효율성이 구체적으로 비교·분석된다면 콩의 품종 확인의 정확도는 한층 더 높아질 것으로 사료된다.

적요

핵심 microsatellite 마커를 활용하여 우리나라에서 품종보호출원 및 등록된 콩 148 품종에 대한 DNA 프로파일 데이터베이스를 구축한 다음 유전적 유사도 분석을 통한 품종 식별력 정도를 조사하였다. 콩 148품종을 120개의 microsatellite 마커로 검정하고 밴드의 패턴이 명확하고 다형성 정도가 높은 핵심 마커 16개의 대립유전자의 수는 6 ~ 28개로 나타났고 평균 대립유전자의 수는 12.75개 였다. PIC 값은 0.753 ~ 0.951 사이에 분포하였고 평균값은 0.863으로 아주 높았다. 콩 148 품종에 대하여 Jaccard 방법에 따라 유전적 유사도를 설정한 다음 비가중 산술평균결합에 의해 집괴분석하여 계통도를 작성하였을 때, 콩의 품종 유형 및 품종 육성 계보에 따라 5개의 대그룹으로 나누어졌으며 모든 품종이 식별이 가능하였다.

본 연구에서 콩 품종식별용 핵심 microsatellite는 품종보호출원 품종의 구별성, 균일성, 안정성의 확인, 품종진위성과 관련된 종자분쟁, 종자 순도 관리에 매우 유용하게 활용될 수 있을 것이다.

사사

이 논문은 동아대학교 교내연구비 지원에 의하여 연구되었음.

Fig 1.

Figure 1.

Amplified fragment pattern of a SSR marker, Satt614 in 3 soybean varieties. PCR products were separated and detected using 3730 XL Genetic Analyzer (Applied Biosystems) with a 36 cm array and POP-7 polymer. Lane A, ‘Cheongja ’; B, ‘Seonnog’; C, ‘Shinrok’

Journal of Plant Biotechnology 2016; 43: 457-465https://doi.org/10.5010/JPB.2016.43.4.457

Fig 2.

Figure 2.

Histogram depicting the alleles at 2 microsatellite loci, Satt614 (A) and Satt255 (B). Base-pair size and the frequency at each allele detected by148 soybean varieties

Journal of Plant Biotechnology 2016; 43: 457-465https://doi.org/10.5010/JPB.2016.43.4.457

Fig 3.

Figure 3.

Dendrogram for 148 soybean varieties constructed using cluster analysis of the 204 microsatellite loci by unweighted pair-group method with arithmetical average (UPGMA). The scale at the bottom is Jaccard’s coefficient of similarity

Journal of Plant Biotechnology 2016; 43: 457-465https://doi.org/10.5010/JPB.2016.43.4.457

Table 1 . List of 148 soybean varieties assayed for genetic characterization using microsatellite markers.

No.Varieties nameParentageSourcesNo.Varieties nameParentageSources
1HwasongputPure line selection derived from Gyeongido and Gangwondo germplasmRDA75SonghakDongsan74/JangbaekRDA
2JinyulHwanggeum/SinnongheukRDA76DoremiNamhae/YS569RDA
3Geomjeong3Sinnongheuk/SNUA78010RDA77SohoNamhae/YS569RDA
4AnpyeongEunha/(KAS391-7/SS88034)RDA78JinmiHS12/ManriRDA
5ShingiBaekun/Shinpaldal2RDA79SunamKosuzu/BupyeongRDA
6Chungdu1SI93006/Shinpaldal2RDA80DagiNamhae/D70-6545RDA
7DaemangJangyeob/SeokrangputRDA81Hojang(Jangyeob/Hwanggeum)/Suwon153RDA
8Cheongja3Suwon174/Mokpo17RDA82BosugNamhae/CampRDA
9Daemang2Shinpaldal2/SeokrangputRDA83SokangNamhae/CampRDA
10MilangKeunol/GeomjeongolRDA84NogchaePureun/Milyang44RDA
11Dajang(Haman/Williams)/PaldalRDA85WonhwangCamp/MyungjunamulRDA
12Keumgang[(Suwon61/SS6807)/Clark63]/(Suwon111/H-25)RDA86JangkiEunha/MS91088RDA
13HannamYS236/SS79168-67-5RDA87PungwonSI93001/Suwon164RDA
14IlpumgeomjeongSLSB 87-3/(Hwanggeum/SLSB-45)RDA88JonamEunha/Jeonju-11RDA
15GeomjeongolPure line selection derived from Milyangjaerae germplasmRDA89GalchaeYS1287/Jinju1RDA
16Jangmi(D69-7816/Essex)/SLSB 87-2RDA90SohwangPungsannamul/HS646(Pungsan/Nattosan)RDA
17Duyou(Williams/S7145-BF₂-11-5)/BonghwajaeraejongRDA91JinpungSuwon215/(SI993746/SS01211)RDA
18BukwangJangbaek/BangsaRDA92Joyang1Pungsannamul/Suwon187RDA
19SobaeknamulMilyang18/BonghwajaeraejongRDA93Jungmo3008Hwanggeum/(Suwon180/SI993791)RDA
20Ilmi(Paldal/Saeal)/PaldalRDA94UramSuwon190/(Sinpaldal2/T243)RDA
21Saeol[(Danwon/Paldal)/Keunol]/BaeksajaRDA95HwangkeumolSS92414/HwaeomputRDA
22MyeongjunamulJangyeob/DanyeobRDA96SaedanbaekMD87L/SS92414RDA
23SowonEunha/BangsaRDA97NeulchanSS91501-9-1-1/SS96205RDA
24DaehwangKeunol/SLSB87-3RDA98ChamolSinpaldal2/KeunolRDA
25JangwonBogwang/SS84040RDA99Jungmo3009Milyang121/DaemangRDA
26SaebyeolBugwang/NamhaeRDA100HaepumBoseok/Suwon214RDA
27CheongjaMilyang55/Geomjeong1RDA101Jungmo3004Iksan21/Milyang98RDA
28SeonnogKeunol/Japan introductionRDA102Jungmo3005Cheongja/Geomjeong3RDA
29ShinrokSuwon163/Jinpum2RDA103TaekwangSS77011/Dongsan53RDA
30SorokPureun/NamhaeRDA104MalliJangyeob/PI219782RDA
31Geomjeong4(Paldal/YCS87-3) /YSC87-3RDA105JangsuElf/SS74185RDA
32DaepungBaekun/Shinpaldal2RDA106MuhanHwanggeum/WellsRDA
33DachaeHannam/EunhaRDA107PokwangJangyeob/PI219787RDA
34DaolKeunol/YS1040RDA108BaegunGwanggyo/dt1-long racemeRDA
35DanmiMilyang37/JosaengbaekjojoduRDA109KeunolPure line selection derived from ChilgokjaeraeRDA
36Dajin(Keunol/Josaengbaekdo)/KeunolRDA110Samnam(Suwon101/YS104)/Suwon101RDA
37Cheongja2Milyang70/IlpumgeomjeongRDA111DanweonWilliams/Suwon61RDA
38SojinDanyeob/SI93001RDA112NamhaeDanyeob/HillRDA
39SeonyuSuwon162/(SS79168/Saeal)RDA113DankyeongGwanggyo/WilliamsRDA
40GeomjeongsaeolKeunol/GeomjeongolRDA114SaealGwanggyo/SS7145-2B-45-3-4RDA
41Danmi2Seokrangput/(Seokrang/Milyang77)RDA115HeugcheongPure line selection derived from Yeongwoljaerae germplasmGangwondo
42Ilpumgeomjeong2Milyang68/Suwon178RDA116HobanGWS91/JinpumGangwondo
43HeugmiMilyang78/Milyang68RDA117CheongaShinpaldal2/SS97809Gangwondo
44SocheongMilyang78/PeingRDA118DaewangGWS91/SeokrangputGangwondo
45NogwonKeunol/Hyangnam1RDA119GangilSuwon191/Suwon196Gangwondo
46MansuHwanggeum/Dongsan118RDA120HaessalShinpaldal2/KeunolGangwondo
47NampungSuwon190/BogwangRDA121ManpoongDongsan121/Sprite87Gyeongido
48SangwonKeunol/OsimamidoriRDA122YeonpoongSuwon191/Suwon196Gyeongido
49DaeyangSuwon192/(Jangyeob/Hwaeomput)RDA123JangyonSS96321/SS01242Gyeongido
50DaeheugDaehwang/Milyang79RDA124DaecheongChucheonjaerae/DongbukheukduChungcheongbukdo
51HeugsungGnome85/CheongjaRDA125GalmiPure line selection derived from GwangjujaeraeChungcheongnamdo
52Daeha1Milyang192/(Jangyeob/Hwaeomput)RDA126Buseoktae1Pure line selection derived from YeongjaeraeYeongjusi
53CheonsangSuwon190/HwanggeumRDA127JosaengseoriMutants derived from irradiated SeoritaeKAERI
54Geomjeong5Sinpaldal/Geomjeong2RDA128WonyulMutants derived from irradiated KAS360-22KAERI
55Wonheug(Suwon182/Jinju1)/Jinju1RDA129WonhyunMutants derived from irradiated PaldalKAERI
56Socheong2Milyang78/PekingRDA130Aga1Eunha/KLG10084KPNU
57Cheongyeob1Ilpumgeomjeong/DaehwangRDA131Aga2Eunha/KLG10084KPNU
58IksannamulDanyeob/HillRDA132Aga3Eunha/KLG10084Soy Venture
59AlchanHwangkum/EunhaRDA133Aga4Eunha/KLG10084Soy Venture
60PungsannamulBangsa/KLS87092RDA134Aga9Eunha/KLG10084Soy Venture
61Shinpaldal2Deogyu/PaldalRDA135Aga8Eunha/KLG10084Soy Venture
62Geomjeong1(Jangyeob/Jaeraebabmit)/HwanggeumRDA136Aga10Eunha/KLG10084Soy Venture
63DanbaegDongsan69/D76-8070RDA137Gyeongsang2Seoritae/JinpumKSNU
64KwanganDongsan69/HwanggeumRDA138Gaechuk 1Gyeongsang1/(Seoritae/C242)KSNU
65PureunCheongsaeknamul/L78-379RDA139Gaechuk 2Jinpum2/C242KSNU
66TawonPaldal/ES33RDA140Gyeongsang3Jwinunyi/SP2KSNU
67DaewonSuwon133/Milyang18RDA141Jinnong1Jwinunyi/C242KSNU
68Jinpum2Pure line selection derived from Japanese germplasmRDA142JinyangJinpum2/GS301KSNU
69Geomjeong2SS83021/SS83033RDA143PulmuheukchaeJinju1xPI96188SNU
70JinpumPure line selection derived from Japanese germplasmRDA144PulmujigiPungsannamul/SS2-2SNU
71SomyeongEunha/BangsaRDA145YoungyangWillims/YWS9301YNU
72SodamSNUA78010/Dongsan127RDA146SomyeongEunha/BangsaYNU
73SeonheukHwanggeum/SinnongheukRDA147Gyeongsang1Seoritae/Jinpum1Jenomine
74PaldoKw220-26/HillRDA148ZhonghuangYeodu8/90052-76Lee Yeong Phil

RDA: Rural development administration, KAERI: Korea Atomic Energy Research Institute, KPNU: Kyungpook National University, KSNU: Kyungsang National University, SNU; Seoul National University, YNU; Yeungnam University.


Table 2 . Repeat motif, number of alleles, and polymorphism information content (PIC) value of microsatellite markers selected for genetic characterization of the 148 soybean varieties.

SSR designationPrimer sequenceRepeat motifLinkage groupAnnealing temp.Product size (bp)No. of allelesPIC value
Satt184F: FAM-GCGCTATGTAGATTATCCAAATTACGC(ATT)14D1a50135-19780.774
R: GCCACTTACTGTTACTCAT(TTG)5
Satt216F: VIC-TACCCTTAATCACCGGACAA(ATT)20D1b50140-217120.840
R: AGGGAACTAACACATTTAATCATCA
Satt614F: VIC-CTCCCCTTTAACCTTTCCTTTATTAG(TTA)38I50257-394210.951
R: CGCGGTAGGAATTAATTGTAGATAGGAT
Satt354F: PET-GCGAAAATGGACACCAAAAGTAGTTA(ATT)14I50179-24790.759
R: GCGATGCACATCAATTAGAATATACAA
Sat_151F: FAM-GCTGCATCAGATCACCCATCCTTC(AT)27J50215-27290.813
R: CATGCCATGTTGTATGTATGT
Sat_255F: VIC-CGGCATGTCATGGTATACGTAACTTTAGA(AT)32J50232-328280.942
R: GCGCAACTGAAGCAAGAAAAGAAACCT
Satt417F: NED-TCTTGCTAATTGCTTCATTTCAT(ATT)18K50280-32780.753
R: AATTGCTTGGGATTTTCATTT
Sat_391F: PET-GCGTAGGCATCGGTCAATATTTT(AT)37M50220-276170.918
R: GCGTTAGCGAGTGGATCAAGATCA
Satt308F: FAM-GCGTTAAGGTTGGCAGGGTGGAAGTG(ATT)21M50132-175120.898
R: GCGCAGCTTTATACAAAAATCAACAA
Satt157F: VIC-GGGCTCACTCTCGATAGTAGGTATAAAG(ATT)31D1b50188-295190.910
R: GGGATACCAAAAGGAATAATTGTCTT
Satt534F: NED-CTCCTCCTGCGCAACAACAATA(ATT)25B250148-212170.893
R: GGGGGATCTAGGCCATGAC
Satt181F: PET-TGGCTAGCAGATTGACA(ATT)18H50178-21760.867
R: GGAGCATAGCTGTTAGGA
Satt160F: FAM-TCCCACACAGTTTTCATATAATATA(ATT)30F50199-270120.883
R: CATCAAAAGTTTATAACGTGTAGAT
Satt002F: VIC-TGTGGGTAAAATAGATAAAAAT(ATT)25D250123-14570.900
R: TCATTTTGAATCGTTGAA
Satt030F: NED-AAAAAGTGAACCAAGCC(ATT)21F50129-170100.844
R: TCTTAAATCTTATGTTGATGC
Satt070F: PET-TAAAAATTAAAATACTAGAAGACAAC(ATT)24B250123-17890.871
R: TGGCATTAGAAAATGATATG

Total20413.815

Mean12.750.863

References

  1. Anderson JA, Churchill CA, Autrique JE, Tanksley SD, and Sorrells ME. (1993) Optimizing parental selection for genetic-linkage maps. Genome 36, 181-186.
    Pubmed CrossRef
  2. Bae KM, Sim SC, Hong JH, Choi KJ, Kim DH, and Kwon YS. (2015) Development of genomic SSR markers and genetic diversity analysis in cultivated radish (Raphanus sativus L.). Hortic Environ Biotechnol 56, 216-224.
    CrossRef
  3. Bredemeijer GMM, Cooke RJ, Ganal MW, Peeters R, Isaac P, Noordijk Y, Rendell S, Jackson J, Röder MS, Wendehake K, Dijcks M, Amelaine M, Wickaert V, Bertrand L, and Vosman B. (2002) Construction and testing of a microsatellite database containing more than 500 tomato varieties. Theor Appl Genet 105, 1019-1026.
    Pubmed CrossRef
  4. Gao L, Jia J, and Kong X. (2016) A SNP-based molecular barcode for characterization of common wheat. PLoS ONE 11, e0150947.
    CrossRef
  5. Hwang TY, Nakamoto Y, Kono I, Enoki H, Funatsuki H, Kitamura K, and Ishimoto M. (2008) Genetic diversity of cultivated and wild soybeans including Japanese elite cultivars as revealed by length polymorphism of SSR markers. Breed Sci 58, 315-323.
    CrossRef
  6. Hwang TY, Seo MJ, Lee SK, Park HM, Jeong KH, Lee YY, Kim SL, Yun HT, Lee JE, Kim DW, Jung GH, Kwon YU, Kim HS, and Kim YH. (2012) Discrimination of 110 Korean soybean cultivars by sequence tagged sites (STS)-CAPS markers. Kor J Breed Sci 44, 258-272.
  7. Jang SJ, Park SJ, Park KH, Song HL, Cho YG, Jong SK, Kang JH, and Kim HS. (2009) Genetic diversity and Identification of Korean elite soybean cultivars based on SSR markers. Korean J Crop Sci 54, 231-240.
  8. Kim SH, Chung JW, Moon JK, Woo SH, Cho YG, Jong SK, and Kim HS. (2006a) Discrimination of Korean soybean cultivars by SSR markers. Kor J Crop Sci 51, 658-668.
  9. Kim SH, Chung JW, Moon JK, Woo SH, Cho YG, Jong SK, and Kim HS. (2006b) Genetic diversity and relationship by SSR markers of Korean soybean cultivars. Kor J Crop Sci 51, 248-258.
  10. Kwon YS, Hong JH, and Choi KJ. (2013) Construction of a microsatellite marker database of commercial pepper cultivars. Korean J Hortic Sci Technol 31, 580-589.
    CrossRef
  11. Kwon YS, Hong JH, Kim DH, and Kim DH. (2015) Use of Microsatellite Markers Derived from Genomic and Expressed Sequence Tag (EST) to Identify Commercial Watermelon Cultivars. Korean J Hortic Sci Technol 33, 737-750.
    CrossRef
  12. Rani A, Kumar V, Shukla S, Jha P, and Rawal R. (2016) DNA barcoding of Indian soybean varieties as constructed through SSR markers. Seed Sci & Technol 44, 357-369.
    CrossRef
  13. Reid A, Hof L, Felix G, Rücker B, Tams S, Milczynska E, Esselink D, Uenk G, Vosman B, and Weitz A. (2011) Construction of an integrated microsatellite and key morphological characteristic database of potato varieties on the EU common catalogue. Euphytica 182, 239-249.
    CrossRef
  14. Röder MS, Wendehake K, Korzun V, Bredemeijer G, Laborie D, Bertrand L, Isaac P, Rendell S, Jackson J, Cooke RJ, Vosman B, and Ganal MW. (2002) Construction and analysis of a microsatellite-based database of European wheat varieties. Theor Appl Genet 106, 67-73.
    Pubmed CrossRef
  15. Rohlf FJ. (2000). NTSYSpc: Numerical taxonomy and multivariate analysis system, ver. 2.10b . Applied Biostatistics Inc, New York.
  16. Sim SC, Hong JH, and Kwon YS. (2015) DNA profiling of commercial pumpkin cultivars using simple sequence repeat polymorphisms. Hortic Environ Biotechnol 56, 811-820.
    CrossRef
  17. Sneath PHA, and Sokal RR. (1973). Numerical taxonomy: The principles and practice of numerical classification . Freeman W.H., San Francisco.
  18. Tantasawat P, Trongchuen J, Prajongjai T, Jenweerawat S, and Chaowiset W. (2011) SSR analysis of soybean (Glycine max (L.) Merr.) genetic relationship and variety identification in Thailand. Aust J Crop Sci 4, 301-308.
  19. Tian HL, Wang FG, Zhao JR, Yi HM, Wang L, Wang R, Tang Y, and Song W. (2015) Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Mol Breeding 35, 136.
    Pubmed KoreaMed CrossRef
  20. ., UPOV (2010). Guideline for DNA-profiling: molecular marker Selection and Database Construction (“BMT Guideline”) , Geneva, Switzerland.
  21. ., UPOV (2011). Possible Use of Molecular Markers in the Examination of Distinctness, Uniformity, and Stability (DUS) , Geneva, Switzerland.
  22. Wang M, Li RZ, Yang WM, and Du WJ. (2010) Assessing the genetic diversity of cultivars and wild soybeans using SSR markers. Afr J Biotechnol 9, 4857-4866.
  23. Wang FG, Tian HL, Zhao JR, Yi HM, Wang L, and Song W. (2011) Development and characterization of a core set of SSR markers for fingerprinting analysis of Chinese maize varieties. Maydica 56, 7-17.
  24. Yoon MS, Song QJ, Choi IY, Specht JE, Hyten DL, and Cregan PB. (2007) BARCSoySNP23: a panel of 23 selected SNPs for soybean cultivar identification. Theor Appl Genet 114, 885-899.
    Pubmed CrossRef
JPB
Vol 51. 2024

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download