J Plant Biotechnol 2017; 44(4): 379-387
Published online December 31, 2017
https://doi.org/10.5010/JPB.2017.44.4.379
© The Korean Society of Plant Biotechnology
김미영, 천재안, 조강희, 박서준, 김세희, 이한찬
농촌진흥청 국립원예특작과학원 과수과
Correspondence to : e-mail: l0hc0811@korea.kr
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Various sizes (0.2~1.2 mm) and developmental stages (referred to as Stage 1~3) of apical and lateral meristems were excised, together or separately, directly from dormant buds of apple ‘Hongro’. They were mixed infected by
Keywords Tissue culture, Meristem excision, Apple tree, Virus detection, RT-PCR
사과는 세계적으로 가장 광범위 하게 재배되고 있는 과수 중의 하나로, 우리나라에서 대표적인 과수 작물이다. 사과에 발생하는 주요 바이러스는
사과에서의 바이러스 제거기술은 기내 또는 기외에서 식물체를 열처리한(thermotherapy) 후, 경정배양(shoot-tip culture)을 병행하는 방법이 주로 사용되었다(Lee et al. 2013; Paprstein et al. 2008). 또한, 항바이러스 약품(antiviral drugs)을 이용한 화학처리법(chemotherapy)(Hansen and Lane 1985; Hu et al. 2015), 초저온보존 처리법(cryopreservation)(Li et al. 2016)등이 보고되었다. 하지만, 기존의 바이러스 제거방법은 감염식물체를 도입한 후 인위적인 무병화 처리를 시도한 것으로 처리과정에 따라 시간과 인력소모가 많은 편이다. 본 연구진은 이러한 점을 해결하고 사과 바이러스 제거에 대한 새로운 방법을 제시하고자, 바이러스에 감염된 동절기 휴면아(측아)를 식물재료로 사용하여 본 연구실험을 수행하였다. 본 연구진이 착안한 점은 노지의 동절기 휴면아 속의 분열조직은 식물체가 비 광합성 상태로 자연 조건 하에서 한냉처리를 받은 것으로 간주할 수 있고, 따라서, 인위적인 무병화 처리를 회피할 수 있다는 점을 염두에 둔 것이다. 본 실험의 내용은 휴면아의 발달단계에 따라 분열 조직을 절취하여 캘러스를 유도한 후 RT-PCR 분석을 통해 절취한 분열조직에서 감염되었던 바이러스가 제거되었는지를 조사한 것으로, 기존에 보고되지 않은 내용이며, 바이러스 제거 방법에 대한 새로운 접근으로 향 후 사과의 무병묘 생산에 매우 유용한 자료로 활용될 수 있을 것이다.
본 연구실험에서는 농촌진흥청 국립원예특작과학원 연구포장에 재식된 사과 ‘홍로’ 식물체 중 ASSVd, ASPV, ACLSV, ASGV의 4종 사과 바이러스 복합 감염을 확인한 #7, #8, #11 (Fig. 1)의 동절기 휴면아를 식물재료로 사용하였다. 1월 말경 각 식물체의 나뭇가지 끝부분을 약 20 ~ 30 cm 길이로 잘라 채취한 후(Fig. 2A), 측아 휴면아를 조직배양용 메스로 도려내었다(Fig. 2B). 휴면아의 바깥부분 포엽(bracts)들을 제거하고, 안쪽 포엽을 약 3 ~ 4 mm 의 길이로 남긴 후, 70% 에탄올에 침지하여 약 40초간 표면살균 한 다음 멸균수로 1회 세척하였다. 이후, 클린벤치 안에서 1% 차아염소산나트륨(sodium hypochlorite)에 2~3분간 침지하여 2차 표면살균 후, 멸균수로 3회 세척하였다. 실체 현미경 하에서 조직배양용 핀셋과 메스, 그리고 일회용 주사기(5 ml)를 이용하여 표면 살균한 재료로부터 분열조직(meristem)을 절취하였다.
Virus detection of ASSVd, ASGV, ACLSV and ASPV by RT-PCR in infected ‘Hongro’ plants before meristem culture. PCR amplification of (A) ASSVd, (B) ASGV, (C) ACLSV and (D) ASPV. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers (#6~#11), ‘Hongro’ plants tested. The plants #7, #8 and #11 were found to be co-infected by ASSVd, ASGV, ACLSV and ASPV, and were used in this study
Meristem excision from dormant buds of apple cultivar Hongro mixed infected by
분열조직의 절취 부위는 휴면아의 발달단계에 따라 Stage 1, Stage 2, Stage 3의 3단계로 분류하였으며(Fig. 2), 중앙 정단 분열조직(apical meristem, 0.4~0.8 mm)만을 절취하거나, 측부 분열조직(lateral meristem) 중 한 개(0.2~0.4 mm)를 선택하거나, 또는 정단 분열조직과 측부 분열조직을 동시에 절취하여(0.8~1.2 mm) 절편체로 사용하였는데(Fig. 2C), 이때 분열조직을 에워싼 포엽을 2~3매 포함하기도 하였다(Fig. 2E). 분열조직 절편체는 휴면아의 발달단계와 절취 부위에 따라 그 크기와 모양이 다양하였다(Fig. 2C-2E). 절편체로부터 캘러스를 유도하기 위하여 절편체는 배양용기(model 310100, SPL Life Sciences, Korea) (100 mm × 40 mm)안에 50 ml 씩 분주된 캘러스 유도 배지에 10~20개 씩 치상하여 배양하였다. 캘러스 유도 배지는 MS 배지(Murashige and Skoog 1962) 4.4 g, sucrose 30 g/L, benzyladenine (BA) 3.0 mg/L, 3-indolebutyric acid (IBA) 0.1 mg/L을 첨가하여 pH를 5.8로 조정한 후, plant agar 7 g/L를 첨가하여 autoclave에서 121℃로 20분간 고압 증기 살균하여 제조하였다. 배양환경은 낮 16/ 밤 8시간의 광주기 조건에 온도 25±2°C, 광도 50 ~ 100 μmol・m-2・s-1 하에서 16주 동안 배양하였으며, 4~8주마다 동일배지에 계대배양 하였다.
ASSVd, ASPV, ACLSV, ASGV 4종의 바이러스가 복합 감염된 사과 ‘홍로’ #7, #8, #11 식물체의 동절기 휴면아로부터 절취한 분열조직 절편체들은 배양 16주 후에 분열조직의 발달단계 따라 절편체의 생존율, 캘러스 형성률, 바이러스 제거효율을 조사하였다. 캘러스는 RT-PCR에 사용되어야 하므로 직경 10 mm 이상 증식한 계통만 형성률에 포함시켰고, 분열조직 절편체로부터의 바이러스 제거효율은 직경 10 mm 이상의 캘러스를 형성한 절편체 수에 대한, 각 사과 바이러스의 RT-PCR negative 캘러스를 생산한 절편체 수의 백분율로 표시하였다.
분석에 사용할 식물 시료 100mg을 CTAB 방법(Gambino et al. 2008)을 변형하여 total RNA를 추출하였으며, 추출된 RNA는 M-MLV reverse transcriptase (Invitrogen, USA)를 이용하여 cDNA 합성에 사용하였다. cDNA를 주형으로 각 바이러스 특이 primer sets (Table 1)를 PCR 반응에 사용하였다. PCR에 사용한 총 20 μL의 반응액은 0.2 μM primer 1 μL, 2.5 mM dNTPs l.6 μL, 5 U TaKaRa Ex Taq polymerase (Takara Bio Inc., Japan) 0.1 μL, 10X Taq Buffer 2 μL, cDNA 1 μL, RNAase-free water 13.3 μL을 혼합하여 사용하였다. PCR 조건은 초기변성을 위해 94°C에서 2분간 반응시킨 뒤, DNA 증폭을 위한 반응(95°C에서 40초간 DNA 변성, 60°C에서 30초간 primer 접합, 72°C에서 30초간 DNA 신장)을 35회 반복하였다. 최종 신장을 위해 72°C에서 5분간 반응시킨 후 종료하였으며, 18S rRNA를 내부 대조구(internal control) 사용하여 합성된 cDNA가 RT-PCR 반응에 제대로 사용되었는지를 확인하였다. 반응이 증폭된 DNA는 1.3% agarose gel 상에서 100 V에서 30분간 전기영동 한 후, ethidium bromide로 염색하여 UV 상에서 관찰하였다.
Table 1 Primer pairs used in RT-PCR assays for apple virus detection
Virusz | Primer sequences (5’→3’) | Size (bp) | Reference |
---|---|---|---|
ASSVd | Forward : CCCGGTAAACACCGTGCGGT | 337 | Lee et al. 2001 |
ASGV | Forward : ATGAGTTTGGAAGACGTGCTTCAA | 714 | Shim et al. 2004 |
ACLSV | Forward : TTCATGGAAAGACAGGGGCAA | 676 | Menzel et al. 2002 |
ASPV | Forward : ATGTCTGGAACCTCATGCTGC | 365 | Menzel et al. 2002 |
18S rRNAy | Forward : CGCATCATTCAAATATCTGC | 843 | Unpublished (GenBank : DQ341382) |
zASSVd,
y18S rRNA, internal control; rRNA, ribosomal RNA
배지에 치상한 분열조직 절편체들(Fig. 3A-3C)은 배양 1주 후부터 녹색으로 변하고, 2주 차에 3배 이상 크기가 팽창하면서 절편체로부터 캘러스가 형성되기 시작하였다(Fig. 3D-3F). 이 후 캘러스가 발달하고 증식하면서(Fig. 3G-3I) 16주 후에는 직경 10 mm 이상 증식한 캘러스(Fig. 3J-3L) 계통이 확보되었으며, 다양한 분열조직 절편체로부터 캘러스가 형성되었다(Fig. 3M-3N). 총 71개의 분열조직 절편체를 배양한 결과, 배양 16주 후 절편체의 생존율은 68.5%이었고, 직경 10 mm 이상의 캘러스 형성률은 42.5%로 31 계통이 확보되었다(Table 2).
Examples of callus lines obtained by the meristem culture directly from dormant ‘Hongro’ buds co-infected by ASSVd, ACLSV, ASPV and ASGV. Various sizes and developmental stages of the apical meristem and the lateral meristems (A-C, described in Fig. 1) cultured on MS medium supplemented with 3% sucrose, 3.0 mg/L BA and 0.1 mg/L IBA. (A) An apical meristem (0.4 mm) in Stage 1. (B) An apical meristem (0.8 mm) in Stage 2. (C) Apical meristem with lateral meristems (1.0 mm) in Stage 2. (D)-(F) Explants begin to form greenish calli on them after 2-3 weeks from the culture initiation. (G)-(I) calli developed and (J)-(L) proliferated. (M)-(N) Callus lines in culture plates after 16 weeks of culture. Scale bars in (A)-(F) = 1 mm, (G)-(N) = 1 cm
Table 2 Virus elimination efficiency of ASSVd, ASPV, ACLSV and ASGV from callus lines derived from meristem culture directly from dormant buds in apple cultivar Hongroz
Developmental stages of meristem explantsy | No. of explants cultured | Survival rate (%) | Callus formation (10 mm >) (%) | No. of explants forming callus (10 mm >) (A) | No. of explants forming RT-PCR negative callus (B) | Virus elimination efficiency (B/A%) | |||
---|---|---|---|---|---|---|---|---|---|
Stage 1 | Apical meristem | 20 | 60.0 | 45.0 | 9 | ASSVd | 9 | ASSVd | 100 |
ASGV | 3 | ASGV | 33.3 | ||||||
ACLSV | 9 | ACLSV | 100 | ||||||
ASPV | 9 | ASPV | 100 | ||||||
Lateral meristem | 19 | 31.6 | 15.8 | 3 | ASSVd | 3 | ASSVd | 100 | |
ASGV | 1 | ASGV | 33.3 | ||||||
ACLSV | 3 | ACLSV | 100 | ||||||
ASPV | 3 | ASPV | 100 | ||||||
Apical meristem + lateral meristems | 7 | 85.7 | 71.4 | 5 | ASSVd | 5 | ASSVd | 100 | |
ASGV | 3 | ASGV | 60.0 | ||||||
ACLSV | 5 | ACLSV | 100 | ||||||
ASPV | 5 | ASPV | 100 | ||||||
Stage 2 | Apical meristem | 6 | 83.3 | 66.7 | 4 | ASSVd | 3 | ASSVd | 75.0 |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 4 | ACLSV | 100 | ||||||
ASPV | 4 | ASPV | 100 | ||||||
Lateral meristem | 14 | 100 | 42.9 | 6 | ASSVd | 5 | ASSVd | 83.3 | |
ASGV | 1 | ASGV | 16.7 | ||||||
ACLSV | 6 | ACLSV | 100 | ||||||
ASPV | 6 | ASPV | 100 | ||||||
Apical meristem + lateral meristems | 3 | 100 | 33.3 | 1 | ASSVd | 1 | ASSVd | 100 | |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 1 | ACLSV | 100 | ||||||
ASPV | 1 | ASPV | 100 | ||||||
Stage 3 | Apical meristem + lateral meristems + 2-3 bracts | 4 | 100 | 75.0 | 3 | ASSVd | 3 | ASSVd | 100 |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 3 | ACLSV | 100 | ||||||
ASPV | 1 | ASPV | 33.3 | ||||||
Total | 71 | 68.5 | 42.5 | 31 | ASSVd | 29 | ASSVd | 93.5 | |
ASGV | 8 | ASGV | 25.8 | ||||||
ACLSV | 31 | ACLSV | 100 | ||||||
ASPV | 29 | ASPV | 93.5 |
zHongro co-infected by ASSVd, ASPV, ACLSV and ASGV before meristem culture and the virus elimination efficiency was investigated after 16 weeks from the culture initiation
yRefer to Figure 1
ASSVd, ASPV, ACLSV, ASGV 4종의 바이러스가 복합 감염된 사과 ‘홍로’ #7, #8, #11 식물체의 휴면아 분열조직으로부터 형성된 캘러스 31 계통은 RT-PCR을 2회 이상 수행하여 검정한 바이러스 밴드가 나타나지 않은 경우를 RT-PCR negative로 정하고 바이러스 제거를 확인하였다. 휴면아의 분열조직 배양으로 인한 ASSVd 제거는 총 31계통 중 2계통에서 RT-PCR positive, 29계통에서 RT-PCR negative로 나타났고(Fig. 4), ASGV는 23계통에서 positive, 8계통에서 negative로 확인되었다(Fig. 5). ACLSV는 positive 계통이 없이 모든 계통이 negative로 나타났다(Fig. 6). ASPV는 ASSVd와 마찬가지로 31계통 중 2계통에서 positive, 29계통에서 negative로 나타났다(Fig. 7). 결과적으로, 휴면아의 분열조직 배양을 통해 ACLSV의 제거율은 100%, ASPV와 ASSVd는 93.5%의 높은 제거효율을 보였다(Table 2). 반면, ASGV는 캘러스 계통의 25.8%가 제거되어 상대적으로 제거효율이 낮았다(Table 2).
Virus detection of ASSVd by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. Amplified bands of the virus were outlined by the red square
Virus detection of ASGV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant duds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
Virus detection of ACLSV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from infected dormant buds of #7, #8 and #11, respectively. No amplified bands of the virus were present in all callus lines
Virus detection of ASPV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
분열조직 배양(meristem culture)은 여러 식물 종에서 바이러스 제거를 위해 사용되는 방법 중의 하나로 식물체 재생 효율은 배양한 경정의 크기에 비례하나, 바이러스 제거는 그에 반비례하여 경정의 크기가 클수록 제거 효율은 낮아지는데, 일반적으로 0.2~0.4 mm 크기가 바이러스 제거에 효과적이라고 하였다(Faccioli and Marani 1998). 그러나, 그러한 작은 크기의 경정만을 절취하여 감염부위를 제거하는 것은 기계적으로 어려운 일이며, 1.0 mm 이상의 크기에서는 크게 Virus-free 효율이 저하된다고 하였다(Quak 1987; Wang et al. 2008; Wang and Valkonen 2009). Momma and Takahashi T (1983)는
Li et al. (2016)의 보고에 의하면, ASPV와 ASGV에 복합 감염된 사과 ‘M9’과 ‘M26’ 대목의 경정배양에서 1.0 mm 길이의 경정을 사용했을 경우, 신초 재생은 90% 정도로 이루어졌으나 각각의 바이러스는 전혀 제거되지 않아 제거효율이 두 바이러스 모두 0% 이었다고 하였다. 또한, 0.5 mm의 경정을 사용하였을 때는 ASPV는 10% 또는 100%가 제거된 반면, ASGV는 1.0 mm를 사용했을 때와 마찬가지로 제거율이 0% 이었다고 하였다. 본 연구실험의 Table 2의 결과를 보면, ACLSV는 휴면아의 모든 발달단계에서 0.2~1.2 mm 길이의 분열조직을 배양하였을 때 바이러스 제거율은 모두 100%를 나타내었고, ASSVd는 Stage 2의 경정분열조직과 측부 분열조직만을 각각 단독으로 1개 배양하였을 때를 제외하곤, ACLSV와 마찬가지로 0.2~1.2 mm 길이의 모든 분열조직의 배양으로 인해 대부분 바이러스가 제거되었다(93.5%). 또한, ASPV는 경정과 측부 분열조직에 포엽(bracts)을 포함하였을 때 제거율이 저하되었는데, 이 경우를 제외하면 ASPV도 모든 크기의 분열조직에서 대부분의 바이러스가 제거된 것이다(93.5%). 비록 본 실험에서 신초 재생을 유도하지는 않았지만, 기존의 보고된 경정분열조직의 크기 보다 큰 크기인 0.4 mm 이상의 분열조직에서도 상기 기술한 세가지 종류의 바이러스가 휴면아의 발달단계에 크게 영향을 받지 않고 높은 효율로 제거된 것은 상당히 주목할 만한 결과로 판단된다.
바이러스에 감염된 사과 대목을 기내도입 후 초저온보존법(cryopreservation)을 이용하면 상기 기술한 경정배양만을 도입하였을 경우와는 달리, 1.0 mm 이상 크기의 경정배양으로 재생된 신초에서도 상당히 바이러스가 제거되었다는 보고와(Li et al. 2016), 복숭아와 배에서 바이로이드 감염 기내 신초를 일정기간 4°C 한냉처리(cold therapy) 한 후 1~2 mm 크기의 경정을 절취하여 비감염 신초를 획득하였다는 보고(El-Doungdoug et al. 2010)의 결과들을 볼 때 낮은 온도가 정단 분열조직 부위에서 비감염 부위를 증가시키는 것으로 추측된다. 이러한 결과에 착안하여, 본 연구진은 동절기 휴면아를 이용하면 경정조직이 이미 자연상태에서 일정기간 한냉처리를 받은 것이므로 생장중인 신초의 경정을 이용하는 것보다 바이러스 제거 효율이 높을 것이라는 가설을 세우고 본 실험을 추진하게 되었는데, 본 연구실험의 장점은 기존의 연구들과는 달리 감염 식물체의 기내도입이나 별도의 인위적인 무병화 처리 과정을 생략할 수 있다는 것이다. 본 실험에 사용한 휴면아의 분열조직이 꽃눈일 가능성은 있으나, 본 결과의 내용을 바탕으로 분열조직 배양배지의 호르몬 조성을 변경하여 신초를 유도한다면 단순히 휴면아의 분열조직 배양만으로 사과에서 바이러스 무병주 생산이 가능할 것으로 여겨진다.
Table 3 Simultaneous virus elimination of ASSVd, ASPV, ACLSV and ASGV from callus derived from meristem explants based on their developmental stages directly from dormant Hongro buds
Developmental stages of meristem explantsy | No. of callus obtained (> 10 mm) from | No. of callus from which each virus was eliminated | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
#7z | #8 | #11 | Sub total | Virus | #7 | #8 | #11 | Sub total | ||
Stage 1 | Apical meristem | 3 | 3 | 3 | 9 | ASSVd | 3 | 9 | ||
ASGV | 0 | 3 | ||||||||
ACLSV | 3 | 9 | ||||||||
ASPV | 3 | 9 | ||||||||
Lateral meristem | 3 | - | - | 3 | ASSVd | - | - | 3 | ||
ASGV | - | - | 1 | |||||||
ACLSV | - | - | 3 | |||||||
ASPV | - | - | 3 | |||||||
Apical meristem + lateral meristems | 1 | 1 | 3 | 5 | ASSVd | 5 | ||||
ASGV | 3 | |||||||||
ACLSV | 5 | |||||||||
ASPV | 5 | |||||||||
Stage 2 | Apical meristem | 1 | - | 3 | 4 | ASSVd | 0 | - | 3 | 3 |
ASGV | 0 | - | 0 | 0 | ||||||
ACLSV | 1 | - | 3 | 4 | ||||||
ASPV | 1 | - | 3 | 4 | ||||||
Lateral meristem | 1 | 1 | 4 | 6 | ASSVd | 0 | 1 | 4 | 5 | |
ASGV | 1 | 0 | 0 | 1 | ||||||
ACLSV | 1 | 1 | 4 | 6 | ||||||
ASPV | 1 | 1 | 4 | 6 | ||||||
Apical meristem + lateral meristems | - | 1 | - | 1 | ASSVd | - | 1 | - | 1 | |
ASGV | - | 0 | - | 0 | ||||||
ACLSV | - | 1 | - | 1 | ||||||
ASPV | - | 1 | - | 1 | ||||||
Stage 3 | Apical meristem + lateral meristems + 2-3 bracts | 1 | 1 | 1 | 3 | ASSVd | 1 | 1 | 1 | 3 |
ASGV | 0 | 0 | 0 | 0 | ||||||
ACLSV | 1 | 1 | 1 | 3 | ||||||
ASPV | 0 | 1 | 0 | 1 | ||||||
Total | 10 | 7 | 14 | 31 | ASSVd | 8 | 7 | 14 | 29 | |
ASGV | 4 | 1 | 3 | 8 | ||||||
ACLSV | 10 | 7 | 14 | 31 | ||||||
ASPV | 9 | 7 | 13 | 29 |
zName of Hongro plant co-infected by ASSVd, ASPV, ACLSV and ASGV before meristem culture
yBold characters mean ASSVd, ASPV, ACLSV and ASGV were eliminated simultaneously
본 연구에서 휴면아의 경정 분열조직을 사용하게 된 또 하나의 착안점은 식물체내에서의 바이러스의 이동은 광합성 산물의 이동과 동일하다는 점인데, 물론 도관이 아직 분화화지 않은 윗부분인 생장점 부위는 바이러스를 포함하지 않을 것이라고 알려져 있지만(Grout BWW 1999), 지금까지 정단 분열조직의 바이러스 비감염 부위와 식물의 광합성 산물 이동 경로를 연관하여 언급한 적은 없었다. 식물 RNA 바이러스가 식물체 전역으로 이동하는 경로는 식물체의 체관을 통하여, 즉 식물의 동화산물 이동경로와 동일하다(Leisner and Turgeon 1993)고 알려져 있다. 본 실험에 사용한 동절기 휴면아는 광합성을 하지 않는 상태로서 동화산물의 이동이 없을 것이고, 동화산물의 이동이 없다는 것은 그 만큼 동화산물의 통로가 되는 조직이 분화하지 않았을 것이다. 따라서, 바이러스가 식물체 존재하기는 하나, 정체되어 있게 되므로 식물체내에서 비감염 부위는 그 범위가 식물체가 생장 중일 때보다 넓을 것이라고 추측하였다. 본 연구진은 당해 년 8월에 실험에 사용하였던 동일 감염주의 나뭇가지에 있는 액아의 분열조직을 살펴보았는데 그 크기가 실험에 사용했던 동절기 분열조직 크기보다 훨씬 작은 것을 관찰할 수가 있었다(자료 미제시). 그러므로, 본 연구 실험에 사용한 동절기 휴면아는 비 광합성 상태에서 그 내부의 분열조직이 자연적으로 한냉처리된 것으로, 바이러스 비감염 부위 적출을 위한 최적의 식물 재료라고 할 수 있을 것이다.
본 연구 실험 결과에서 ASGV가 다른 바이러스 제거효율에 비해 상대적으로 25.8%의낮은 제거효율을 보인 것과, Li et al. (2016)이 초저온보존법을 병행한 경정배양을 통해서도 ASGV가 전혀 제거되지 않은 점은 ASGV가 경정분열 조직 내에 존재한다는 것을 의미하는데, 실제로 immunolocalization 분석을 통해 경정분열 조직 내에서 그 존재가 확인되었다(Li et al. 2016). 그럼에도 불구하고, 본 실험결과의 Table 1을 보면 Stage 1 단계의 휴면아에서 절취한 분열조직에서 ASGV가 약 40% 제거된 것을 볼 수 있는데, 이러한 효율은 상기 기술한 기존의 보고(Li et al. 2016)와 대조해 볼 때 상대적으로 상당히 효과적이라고 볼 수 있다. Table 2에서 보듯이, 감염되었던 4종의 모든 바이러스가 제거된 캘러스(총 31 계통 캘러스 중 7 계통)를 생산한 분열조직 절편체의 발달단계를 확인한 결과, Stage 1의 휴면아에서만 절취된 것으로 나타났는데, 그 원인은 ASGV가 이 단계에서만 주로 제거되었기 때문이었다. 그러므로, 많은 종류의 바이러스를 효과적으로 제거하기 위해서는 발달단계가 어린 분열조직을 사용하는 것이 바람직할 것으로 보인다.
본 연구는 사과 ‘홍로’ 에서 휴면아의 분열조직을 배양하여 바이러스가 제거됨을 보여주었는데, 차후 다른 사과 품종이나, 또는, 다른 과종에도 적용하여 실험 결과들을 대조해 볼 필요가 있다. 본 연구결과는 아직 세계적으로 보고된 바가 없는 것으로서, 향 후 사과를 포함한 과수의 무병묘 생산에 매우 유용한 자료로 활용될 수 있을 것으로 전망된다.
본 연구는 농촌진흥청 연구과제(세부과제번호:PJ0102280 62017)의 지원에 의해 이루어진 것임.
J Plant Biotechnol 2017; 44(4): 379-387
Published online December 31, 2017 https://doi.org/10.5010/JPB.2017.44.4.379
Copyright © The Korean Society of Plant Biotechnology.
김미영, 천재안, 조강희, 박서준, 김세희, 이한찬
농촌진흥청 국립원예특작과학원 과수과
Mi Young Kim, Jae An Chun, Kang Hee Cho, Seo Jun Park, Se Hee Kim, and Han Chan Lee
Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wanju 55365, Korea
Correspondence to: e-mail: l0hc0811@korea.kr
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Various sizes (0.2~1.2 mm) and developmental stages (referred to as Stage 1~3) of apical and lateral meristems were excised, together or separately, directly from dormant buds of apple ‘Hongro’. They were mixed infected by
Keywords: Tissue culture, Meristem excision, Apple tree, Virus detection, RT-PCR
사과는 세계적으로 가장 광범위 하게 재배되고 있는 과수 중의 하나로, 우리나라에서 대표적인 과수 작물이다. 사과에 발생하는 주요 바이러스는
사과에서의 바이러스 제거기술은 기내 또는 기외에서 식물체를 열처리한(thermotherapy) 후, 경정배양(shoot-tip culture)을 병행하는 방법이 주로 사용되었다(Lee et al. 2013; Paprstein et al. 2008). 또한, 항바이러스 약품(antiviral drugs)을 이용한 화학처리법(chemotherapy)(Hansen and Lane 1985; Hu et al. 2015), 초저온보존 처리법(cryopreservation)(Li et al. 2016)등이 보고되었다. 하지만, 기존의 바이러스 제거방법은 감염식물체를 도입한 후 인위적인 무병화 처리를 시도한 것으로 처리과정에 따라 시간과 인력소모가 많은 편이다. 본 연구진은 이러한 점을 해결하고 사과 바이러스 제거에 대한 새로운 방법을 제시하고자, 바이러스에 감염된 동절기 휴면아(측아)를 식물재료로 사용하여 본 연구실험을 수행하였다. 본 연구진이 착안한 점은 노지의 동절기 휴면아 속의 분열조직은 식물체가 비 광합성 상태로 자연 조건 하에서 한냉처리를 받은 것으로 간주할 수 있고, 따라서, 인위적인 무병화 처리를 회피할 수 있다는 점을 염두에 둔 것이다. 본 실험의 내용은 휴면아의 발달단계에 따라 분열 조직을 절취하여 캘러스를 유도한 후 RT-PCR 분석을 통해 절취한 분열조직에서 감염되었던 바이러스가 제거되었는지를 조사한 것으로, 기존에 보고되지 않은 내용이며, 바이러스 제거 방법에 대한 새로운 접근으로 향 후 사과의 무병묘 생산에 매우 유용한 자료로 활용될 수 있을 것이다.
본 연구실험에서는 농촌진흥청 국립원예특작과학원 연구포장에 재식된 사과 ‘홍로’ 식물체 중 ASSVd, ASPV, ACLSV, ASGV의 4종 사과 바이러스 복합 감염을 확인한 #7, #8, #11 (Fig. 1)의 동절기 휴면아를 식물재료로 사용하였다. 1월 말경 각 식물체의 나뭇가지 끝부분을 약 20 ~ 30 cm 길이로 잘라 채취한 후(Fig. 2A), 측아 휴면아를 조직배양용 메스로 도려내었다(Fig. 2B). 휴면아의 바깥부분 포엽(bracts)들을 제거하고, 안쪽 포엽을 약 3 ~ 4 mm 의 길이로 남긴 후, 70% 에탄올에 침지하여 약 40초간 표면살균 한 다음 멸균수로 1회 세척하였다. 이후, 클린벤치 안에서 1% 차아염소산나트륨(sodium hypochlorite)에 2~3분간 침지하여 2차 표면살균 후, 멸균수로 3회 세척하였다. 실체 현미경 하에서 조직배양용 핀셋과 메스, 그리고 일회용 주사기(5 ml)를 이용하여 표면 살균한 재료로부터 분열조직(meristem)을 절취하였다.
Virus detection of ASSVd, ASGV, ACLSV and ASPV by RT-PCR in infected ‘Hongro’ plants before meristem culture. PCR amplification of (A) ASSVd, (B) ASGV, (C) ACLSV and (D) ASPV. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers (#6~#11), ‘Hongro’ plants tested. The plants #7, #8 and #11 were found to be co-infected by ASSVd, ASGV, ACLSV and ASPV, and were used in this study
Meristem excision from dormant buds of apple cultivar Hongro mixed infected by
분열조직의 절취 부위는 휴면아의 발달단계에 따라 Stage 1, Stage 2, Stage 3의 3단계로 분류하였으며(Fig. 2), 중앙 정단 분열조직(apical meristem, 0.4~0.8 mm)만을 절취하거나, 측부 분열조직(lateral meristem) 중 한 개(0.2~0.4 mm)를 선택하거나, 또는 정단 분열조직과 측부 분열조직을 동시에 절취하여(0.8~1.2 mm) 절편체로 사용하였는데(Fig. 2C), 이때 분열조직을 에워싼 포엽을 2~3매 포함하기도 하였다(Fig. 2E). 분열조직 절편체는 휴면아의 발달단계와 절취 부위에 따라 그 크기와 모양이 다양하였다(Fig. 2C-2E). 절편체로부터 캘러스를 유도하기 위하여 절편체는 배양용기(model 310100, SPL Life Sciences, Korea) (100 mm × 40 mm)안에 50 ml 씩 분주된 캘러스 유도 배지에 10~20개 씩 치상하여 배양하였다. 캘러스 유도 배지는 MS 배지(Murashige and Skoog 1962) 4.4 g, sucrose 30 g/L, benzyladenine (BA) 3.0 mg/L, 3-indolebutyric acid (IBA) 0.1 mg/L을 첨가하여 pH를 5.8로 조정한 후, plant agar 7 g/L를 첨가하여 autoclave에서 121℃로 20분간 고압 증기 살균하여 제조하였다. 배양환경은 낮 16/ 밤 8시간의 광주기 조건에 온도 25±2°C, 광도 50 ~ 100 μmol・m-2・s-1 하에서 16주 동안 배양하였으며, 4~8주마다 동일배지에 계대배양 하였다.
ASSVd, ASPV, ACLSV, ASGV 4종의 바이러스가 복합 감염된 사과 ‘홍로’ #7, #8, #11 식물체의 동절기 휴면아로부터 절취한 분열조직 절편체들은 배양 16주 후에 분열조직의 발달단계 따라 절편체의 생존율, 캘러스 형성률, 바이러스 제거효율을 조사하였다. 캘러스는 RT-PCR에 사용되어야 하므로 직경 10 mm 이상 증식한 계통만 형성률에 포함시켰고, 분열조직 절편체로부터의 바이러스 제거효율은 직경 10 mm 이상의 캘러스를 형성한 절편체 수에 대한, 각 사과 바이러스의 RT-PCR negative 캘러스를 생산한 절편체 수의 백분율로 표시하였다.
분석에 사용할 식물 시료 100mg을 CTAB 방법(Gambino et al. 2008)을 변형하여 total RNA를 추출하였으며, 추출된 RNA는 M-MLV reverse transcriptase (Invitrogen, USA)를 이용하여 cDNA 합성에 사용하였다. cDNA를 주형으로 각 바이러스 특이 primer sets (Table 1)를 PCR 반응에 사용하였다. PCR에 사용한 총 20 μL의 반응액은 0.2 μM primer 1 μL, 2.5 mM dNTPs l.6 μL, 5 U TaKaRa Ex Taq polymerase (Takara Bio Inc., Japan) 0.1 μL, 10X Taq Buffer 2 μL, cDNA 1 μL, RNAase-free water 13.3 μL을 혼합하여 사용하였다. PCR 조건은 초기변성을 위해 94°C에서 2분간 반응시킨 뒤, DNA 증폭을 위한 반응(95°C에서 40초간 DNA 변성, 60°C에서 30초간 primer 접합, 72°C에서 30초간 DNA 신장)을 35회 반복하였다. 최종 신장을 위해 72°C에서 5분간 반응시킨 후 종료하였으며, 18S rRNA를 내부 대조구(internal control) 사용하여 합성된 cDNA가 RT-PCR 반응에 제대로 사용되었는지를 확인하였다. 반응이 증폭된 DNA는 1.3% agarose gel 상에서 100 V에서 30분간 전기영동 한 후, ethidium bromide로 염색하여 UV 상에서 관찰하였다.
Table 1 . Primer pairs used in RT-PCR assays for apple virus detection.
Virusz | Primer sequences (5’→3’) | Size (bp) | Reference |
---|---|---|---|
ASSVd | Forward : CCCGGTAAACACCGTGCGGT | 337 | Lee et al. 2001 |
ASGV | Forward : ATGAGTTTGGAAGACGTGCTTCAA | 714 | Shim et al. 2004 |
ACLSV | Forward : TTCATGGAAAGACAGGGGCAA | 676 | Menzel et al. 2002 |
ASPV | Forward : ATGTCTGGAACCTCATGCTGC | 365 | Menzel et al. 2002 |
18S rRNAy | Forward : CGCATCATTCAAATATCTGC | 843 | Unpublished (GenBank : DQ341382) |
zASSVd,
y18S rRNA, internal control; rRNA, ribosomal RNA
배지에 치상한 분열조직 절편체들(Fig. 3A-3C)은 배양 1주 후부터 녹색으로 변하고, 2주 차에 3배 이상 크기가 팽창하면서 절편체로부터 캘러스가 형성되기 시작하였다(Fig. 3D-3F). 이 후 캘러스가 발달하고 증식하면서(Fig. 3G-3I) 16주 후에는 직경 10 mm 이상 증식한 캘러스(Fig. 3J-3L) 계통이 확보되었으며, 다양한 분열조직 절편체로부터 캘러스가 형성되었다(Fig. 3M-3N). 총 71개의 분열조직 절편체를 배양한 결과, 배양 16주 후 절편체의 생존율은 68.5%이었고, 직경 10 mm 이상의 캘러스 형성률은 42.5%로 31 계통이 확보되었다(Table 2).
Examples of callus lines obtained by the meristem culture directly from dormant ‘Hongro’ buds co-infected by ASSVd, ACLSV, ASPV and ASGV. Various sizes and developmental stages of the apical meristem and the lateral meristems (A-C, described in Fig. 1) cultured on MS medium supplemented with 3% sucrose, 3.0 mg/L BA and 0.1 mg/L IBA. (A) An apical meristem (0.4 mm) in Stage 1. (B) An apical meristem (0.8 mm) in Stage 2. (C) Apical meristem with lateral meristems (1.0 mm) in Stage 2. (D)-(F) Explants begin to form greenish calli on them after 2-3 weeks from the culture initiation. (G)-(I) calli developed and (J)-(L) proliferated. (M)-(N) Callus lines in culture plates after 16 weeks of culture. Scale bars in (A)-(F) = 1 mm, (G)-(N) = 1 cm
Table 2 . Virus elimination efficiency of ASSVd, ASPV, ACLSV and ASGV from callus lines derived from meristem culture directly from dormant buds in apple cultivar Hongroz.
Developmental stages of meristem explantsy | No. of explants cultured | Survival rate (%) | Callus formation (10 mm >) (%) | No. of explants forming callus (10 mm >) (A) | No. of explants forming RT-PCR negative callus (B) | Virus elimination efficiency (B/A%) | |||
---|---|---|---|---|---|---|---|---|---|
Stage 1 | Apical meristem | 20 | 60.0 | 45.0 | 9 | ASSVd | 9 | ASSVd | 100 |
ASGV | 3 | ASGV | 33.3 | ||||||
ACLSV | 9 | ACLSV | 100 | ||||||
ASPV | 9 | ASPV | 100 | ||||||
Lateral meristem | 19 | 31.6 | 15.8 | 3 | ASSVd | 3 | ASSVd | 100 | |
ASGV | 1 | ASGV | 33.3 | ||||||
ACLSV | 3 | ACLSV | 100 | ||||||
ASPV | 3 | ASPV | 100 | ||||||
Apical meristem + lateral meristems | 7 | 85.7 | 71.4 | 5 | ASSVd | 5 | ASSVd | 100 | |
ASGV | 3 | ASGV | 60.0 | ||||||
ACLSV | 5 | ACLSV | 100 | ||||||
ASPV | 5 | ASPV | 100 | ||||||
Stage 2 | Apical meristem | 6 | 83.3 | 66.7 | 4 | ASSVd | 3 | ASSVd | 75.0 |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 4 | ACLSV | 100 | ||||||
ASPV | 4 | ASPV | 100 | ||||||
Lateral meristem | 14 | 100 | 42.9 | 6 | ASSVd | 5 | ASSVd | 83.3 | |
ASGV | 1 | ASGV | 16.7 | ||||||
ACLSV | 6 | ACLSV | 100 | ||||||
ASPV | 6 | ASPV | 100 | ||||||
Apical meristem + lateral meristems | 3 | 100 | 33.3 | 1 | ASSVd | 1 | ASSVd | 100 | |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 1 | ACLSV | 100 | ||||||
ASPV | 1 | ASPV | 100 | ||||||
Stage 3 | Apical meristem + lateral meristems + 2-3 bracts | 4 | 100 | 75.0 | 3 | ASSVd | 3 | ASSVd | 100 |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 3 | ACLSV | 100 | ||||||
ASPV | 1 | ASPV | 33.3 | ||||||
Total | 71 | 68.5 | 42.5 | 31 | ASSVd | 29 | ASSVd | 93.5 | |
ASGV | 8 | ASGV | 25.8 | ||||||
ACLSV | 31 | ACLSV | 100 | ||||||
ASPV | 29 | ASPV | 93.5 |
zHongro co-infected by ASSVd, ASPV, ACLSV and ASGV before meristem culture and the virus elimination efficiency was investigated after 16 weeks from the culture initiation
yRefer to Figure 1
ASSVd, ASPV, ACLSV, ASGV 4종의 바이러스가 복합 감염된 사과 ‘홍로’ #7, #8, #11 식물체의 휴면아 분열조직으로부터 형성된 캘러스 31 계통은 RT-PCR을 2회 이상 수행하여 검정한 바이러스 밴드가 나타나지 않은 경우를 RT-PCR negative로 정하고 바이러스 제거를 확인하였다. 휴면아의 분열조직 배양으로 인한 ASSVd 제거는 총 31계통 중 2계통에서 RT-PCR positive, 29계통에서 RT-PCR negative로 나타났고(Fig. 4), ASGV는 23계통에서 positive, 8계통에서 negative로 확인되었다(Fig. 5). ACLSV는 positive 계통이 없이 모든 계통이 negative로 나타났다(Fig. 6). ASPV는 ASSVd와 마찬가지로 31계통 중 2계통에서 positive, 29계통에서 negative로 나타났다(Fig. 7). 결과적으로, 휴면아의 분열조직 배양을 통해 ACLSV의 제거율은 100%, ASPV와 ASSVd는 93.5%의 높은 제거효율을 보였다(Table 2). 반면, ASGV는 캘러스 계통의 25.8%가 제거되어 상대적으로 제거효율이 낮았다(Table 2).
Virus detection of ASSVd by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. Amplified bands of the virus were outlined by the red square
Virus detection of ASGV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant duds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
Virus detection of ACLSV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from infected dormant buds of #7, #8 and #11, respectively. No amplified bands of the virus were present in all callus lines
Virus detection of ASPV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
분열조직 배양(meristem culture)은 여러 식물 종에서 바이러스 제거를 위해 사용되는 방법 중의 하나로 식물체 재생 효율은 배양한 경정의 크기에 비례하나, 바이러스 제거는 그에 반비례하여 경정의 크기가 클수록 제거 효율은 낮아지는데, 일반적으로 0.2~0.4 mm 크기가 바이러스 제거에 효과적이라고 하였다(Faccioli and Marani 1998). 그러나, 그러한 작은 크기의 경정만을 절취하여 감염부위를 제거하는 것은 기계적으로 어려운 일이며, 1.0 mm 이상의 크기에서는 크게 Virus-free 효율이 저하된다고 하였다(Quak 1987; Wang et al. 2008; Wang and Valkonen 2009). Momma and Takahashi T (1983)는
Li et al. (2016)의 보고에 의하면, ASPV와 ASGV에 복합 감염된 사과 ‘M9’과 ‘M26’ 대목의 경정배양에서 1.0 mm 길이의 경정을 사용했을 경우, 신초 재생은 90% 정도로 이루어졌으나 각각의 바이러스는 전혀 제거되지 않아 제거효율이 두 바이러스 모두 0% 이었다고 하였다. 또한, 0.5 mm의 경정을 사용하였을 때는 ASPV는 10% 또는 100%가 제거된 반면, ASGV는 1.0 mm를 사용했을 때와 마찬가지로 제거율이 0% 이었다고 하였다. 본 연구실험의 Table 2의 결과를 보면, ACLSV는 휴면아의 모든 발달단계에서 0.2~1.2 mm 길이의 분열조직을 배양하였을 때 바이러스 제거율은 모두 100%를 나타내었고, ASSVd는 Stage 2의 경정분열조직과 측부 분열조직만을 각각 단독으로 1개 배양하였을 때를 제외하곤, ACLSV와 마찬가지로 0.2~1.2 mm 길이의 모든 분열조직의 배양으로 인해 대부분 바이러스가 제거되었다(93.5%). 또한, ASPV는 경정과 측부 분열조직에 포엽(bracts)을 포함하였을 때 제거율이 저하되었는데, 이 경우를 제외하면 ASPV도 모든 크기의 분열조직에서 대부분의 바이러스가 제거된 것이다(93.5%). 비록 본 실험에서 신초 재생을 유도하지는 않았지만, 기존의 보고된 경정분열조직의 크기 보다 큰 크기인 0.4 mm 이상의 분열조직에서도 상기 기술한 세가지 종류의 바이러스가 휴면아의 발달단계에 크게 영향을 받지 않고 높은 효율로 제거된 것은 상당히 주목할 만한 결과로 판단된다.
바이러스에 감염된 사과 대목을 기내도입 후 초저온보존법(cryopreservation)을 이용하면 상기 기술한 경정배양만을 도입하였을 경우와는 달리, 1.0 mm 이상 크기의 경정배양으로 재생된 신초에서도 상당히 바이러스가 제거되었다는 보고와(Li et al. 2016), 복숭아와 배에서 바이로이드 감염 기내 신초를 일정기간 4°C 한냉처리(cold therapy) 한 후 1~2 mm 크기의 경정을 절취하여 비감염 신초를 획득하였다는 보고(El-Doungdoug et al. 2010)의 결과들을 볼 때 낮은 온도가 정단 분열조직 부위에서 비감염 부위를 증가시키는 것으로 추측된다. 이러한 결과에 착안하여, 본 연구진은 동절기 휴면아를 이용하면 경정조직이 이미 자연상태에서 일정기간 한냉처리를 받은 것이므로 생장중인 신초의 경정을 이용하는 것보다 바이러스 제거 효율이 높을 것이라는 가설을 세우고 본 실험을 추진하게 되었는데, 본 연구실험의 장점은 기존의 연구들과는 달리 감염 식물체의 기내도입이나 별도의 인위적인 무병화 처리 과정을 생략할 수 있다는 것이다. 본 실험에 사용한 휴면아의 분열조직이 꽃눈일 가능성은 있으나, 본 결과의 내용을 바탕으로 분열조직 배양배지의 호르몬 조성을 변경하여 신초를 유도한다면 단순히 휴면아의 분열조직 배양만으로 사과에서 바이러스 무병주 생산이 가능할 것으로 여겨진다.
Table 3 . Simultaneous virus elimination of ASSVd, ASPV, ACLSV and ASGV from callus derived from meristem explants based on their developmental stages directly from dormant Hongro buds.
Developmental stages of meristem explantsy | No. of callus obtained (> 10 mm) from | No. of callus from which each virus was eliminated | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
#7z | #8 | #11 | Sub total | Virus | #7 | #8 | #11 | Sub total | ||
Stage 1 | Apical meristem | 3 | 3 | 3 | 9 | ASSVd | 3 | 9 | ||
ASGV | 0 | 3 | ||||||||
ACLSV | 3 | 9 | ||||||||
ASPV | 3 | 9 | ||||||||
Lateral meristem | 3 | - | - | 3 | ASSVd | - | - | 3 | ||
ASGV | - | - | 1 | |||||||
ACLSV | - | - | 3 | |||||||
ASPV | - | - | 3 | |||||||
Apical meristem + lateral meristems | 1 | 1 | 3 | 5 | ASSVd | 5 | ||||
ASGV | 3 | |||||||||
ACLSV | 5 | |||||||||
ASPV | 5 | |||||||||
Stage 2 | Apical meristem | 1 | - | 3 | 4 | ASSVd | 0 | - | 3 | 3 |
ASGV | 0 | - | 0 | 0 | ||||||
ACLSV | 1 | - | 3 | 4 | ||||||
ASPV | 1 | - | 3 | 4 | ||||||
Lateral meristem | 1 | 1 | 4 | 6 | ASSVd | 0 | 1 | 4 | 5 | |
ASGV | 1 | 0 | 0 | 1 | ||||||
ACLSV | 1 | 1 | 4 | 6 | ||||||
ASPV | 1 | 1 | 4 | 6 | ||||||
Apical meristem + lateral meristems | - | 1 | - | 1 | ASSVd | - | 1 | - | 1 | |
ASGV | - | 0 | - | 0 | ||||||
ACLSV | - | 1 | - | 1 | ||||||
ASPV | - | 1 | - | 1 | ||||||
Stage 3 | Apical meristem + lateral meristems + 2-3 bracts | 1 | 1 | 1 | 3 | ASSVd | 1 | 1 | 1 | 3 |
ASGV | 0 | 0 | 0 | 0 | ||||||
ACLSV | 1 | 1 | 1 | 3 | ||||||
ASPV | 0 | 1 | 0 | 1 | ||||||
Total | 10 | 7 | 14 | 31 | ASSVd | 8 | 7 | 14 | 29 | |
ASGV | 4 | 1 | 3 | 8 | ||||||
ACLSV | 10 | 7 | 14 | 31 | ||||||
ASPV | 9 | 7 | 13 | 29 |
zName of Hongro plant co-infected by ASSVd, ASPV, ACLSV and ASGV before meristem culture
yBold characters mean ASSVd, ASPV, ACLSV and ASGV were eliminated simultaneously
본 연구에서 휴면아의 경정 분열조직을 사용하게 된 또 하나의 착안점은 식물체내에서의 바이러스의 이동은 광합성 산물의 이동과 동일하다는 점인데, 물론 도관이 아직 분화화지 않은 윗부분인 생장점 부위는 바이러스를 포함하지 않을 것이라고 알려져 있지만(Grout BWW 1999), 지금까지 정단 분열조직의 바이러스 비감염 부위와 식물의 광합성 산물 이동 경로를 연관하여 언급한 적은 없었다. 식물 RNA 바이러스가 식물체 전역으로 이동하는 경로는 식물체의 체관을 통하여, 즉 식물의 동화산물 이동경로와 동일하다(Leisner and Turgeon 1993)고 알려져 있다. 본 실험에 사용한 동절기 휴면아는 광합성을 하지 않는 상태로서 동화산물의 이동이 없을 것이고, 동화산물의 이동이 없다는 것은 그 만큼 동화산물의 통로가 되는 조직이 분화하지 않았을 것이다. 따라서, 바이러스가 식물체 존재하기는 하나, 정체되어 있게 되므로 식물체내에서 비감염 부위는 그 범위가 식물체가 생장 중일 때보다 넓을 것이라고 추측하였다. 본 연구진은 당해 년 8월에 실험에 사용하였던 동일 감염주의 나뭇가지에 있는 액아의 분열조직을 살펴보았는데 그 크기가 실험에 사용했던 동절기 분열조직 크기보다 훨씬 작은 것을 관찰할 수가 있었다(자료 미제시). 그러므로, 본 연구 실험에 사용한 동절기 휴면아는 비 광합성 상태에서 그 내부의 분열조직이 자연적으로 한냉처리된 것으로, 바이러스 비감염 부위 적출을 위한 최적의 식물 재료라고 할 수 있을 것이다.
본 연구 실험 결과에서 ASGV가 다른 바이러스 제거효율에 비해 상대적으로 25.8%의낮은 제거효율을 보인 것과, Li et al. (2016)이 초저온보존법을 병행한 경정배양을 통해서도 ASGV가 전혀 제거되지 않은 점은 ASGV가 경정분열 조직 내에 존재한다는 것을 의미하는데, 실제로 immunolocalization 분석을 통해 경정분열 조직 내에서 그 존재가 확인되었다(Li et al. 2016). 그럼에도 불구하고, 본 실험결과의 Table 1을 보면 Stage 1 단계의 휴면아에서 절취한 분열조직에서 ASGV가 약 40% 제거된 것을 볼 수 있는데, 이러한 효율은 상기 기술한 기존의 보고(Li et al. 2016)와 대조해 볼 때 상대적으로 상당히 효과적이라고 볼 수 있다. Table 2에서 보듯이, 감염되었던 4종의 모든 바이러스가 제거된 캘러스(총 31 계통 캘러스 중 7 계통)를 생산한 분열조직 절편체의 발달단계를 확인한 결과, Stage 1의 휴면아에서만 절취된 것으로 나타났는데, 그 원인은 ASGV가 이 단계에서만 주로 제거되었기 때문이었다. 그러므로, 많은 종류의 바이러스를 효과적으로 제거하기 위해서는 발달단계가 어린 분열조직을 사용하는 것이 바람직할 것으로 보인다.
본 연구는 사과 ‘홍로’ 에서 휴면아의 분열조직을 배양하여 바이러스가 제거됨을 보여주었는데, 차후 다른 사과 품종이나, 또는, 다른 과종에도 적용하여 실험 결과들을 대조해 볼 필요가 있다. 본 연구결과는 아직 세계적으로 보고된 바가 없는 것으로서, 향 후 사과를 포함한 과수의 무병묘 생산에 매우 유용한 자료로 활용될 수 있을 것으로 전망된다.
본 연구는 농촌진흥청 연구과제(세부과제번호:PJ0102280 62017)의 지원에 의해 이루어진 것임.
Virus detection of ASSVd, ASGV, ACLSV and ASPV by RT-PCR in infected ‘Hongro’ plants before meristem culture. PCR amplification of (A) ASSVd, (B) ASGV, (C) ACLSV and (D) ASPV. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers (#6~#11), ‘Hongro’ plants tested. The plants #7, #8 and #11 were found to be co-infected by ASSVd, ASGV, ACLSV and ASPV, and were used in this study
Meristem excision from dormant buds of apple cultivar Hongro mixed infected by
Examples of callus lines obtained by the meristem culture directly from dormant ‘Hongro’ buds co-infected by ASSVd, ACLSV, ASPV and ASGV. Various sizes and developmental stages of the apical meristem and the lateral meristems (A-C, described in Fig. 1) cultured on MS medium supplemented with 3% sucrose, 3.0 mg/L BA and 0.1 mg/L IBA. (A) An apical meristem (0.4 mm) in Stage 1. (B) An apical meristem (0.8 mm) in Stage 2. (C) Apical meristem with lateral meristems (1.0 mm) in Stage 2. (D)-(F) Explants begin to form greenish calli on them after 2-3 weeks from the culture initiation. (G)-(I) calli developed and (J)-(L) proliferated. (M)-(N) Callus lines in culture plates after 16 weeks of culture. Scale bars in (A)-(F) = 1 mm, (G)-(N) = 1 cm
Virus detection of ASSVd by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. Amplified bands of the virus were outlined by the red square
Virus detection of ASGV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant duds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
Virus detection of ACLSV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from infected dormant buds of #7, #8 and #11, respectively. No amplified bands of the virus were present in all callus lines
Virus detection of ASPV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
Table 1 . Primer pairs used in RT-PCR assays for apple virus detection.
Virusz | Primer sequences (5’→3’) | Size (bp) | Reference |
---|---|---|---|
ASSVd | Forward : CCCGGTAAACACCGTGCGGT | 337 | Lee et al. 2001 |
ASGV | Forward : ATGAGTTTGGAAGACGTGCTTCAA | 714 | Shim et al. 2004 |
ACLSV | Forward : TTCATGGAAAGACAGGGGCAA | 676 | Menzel et al. 2002 |
ASPV | Forward : ATGTCTGGAACCTCATGCTGC | 365 | Menzel et al. 2002 |
18S rRNAy | Forward : CGCATCATTCAAATATCTGC | 843 | Unpublished (GenBank : DQ341382) |
zASSVd,
y18S rRNA, internal control; rRNA, ribosomal RNA
Table 2 . Virus elimination efficiency of ASSVd, ASPV, ACLSV and ASGV from callus lines derived from meristem culture directly from dormant buds in apple cultivar Hongroz.
Developmental stages of meristem explantsy | No. of explants cultured | Survival rate (%) | Callus formation (10 mm >) (%) | No. of explants forming callus (10 mm >) (A) | No. of explants forming RT-PCR negative callus (B) | Virus elimination efficiency (B/A%) | |||
---|---|---|---|---|---|---|---|---|---|
Stage 1 | Apical meristem | 20 | 60.0 | 45.0 | 9 | ASSVd | 9 | ASSVd | 100 |
ASGV | 3 | ASGV | 33.3 | ||||||
ACLSV | 9 | ACLSV | 100 | ||||||
ASPV | 9 | ASPV | 100 | ||||||
Lateral meristem | 19 | 31.6 | 15.8 | 3 | ASSVd | 3 | ASSVd | 100 | |
ASGV | 1 | ASGV | 33.3 | ||||||
ACLSV | 3 | ACLSV | 100 | ||||||
ASPV | 3 | ASPV | 100 | ||||||
Apical meristem + lateral meristems | 7 | 85.7 | 71.4 | 5 | ASSVd | 5 | ASSVd | 100 | |
ASGV | 3 | ASGV | 60.0 | ||||||
ACLSV | 5 | ACLSV | 100 | ||||||
ASPV | 5 | ASPV | 100 | ||||||
Stage 2 | Apical meristem | 6 | 83.3 | 66.7 | 4 | ASSVd | 3 | ASSVd | 75.0 |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 4 | ACLSV | 100 | ||||||
ASPV | 4 | ASPV | 100 | ||||||
Lateral meristem | 14 | 100 | 42.9 | 6 | ASSVd | 5 | ASSVd | 83.3 | |
ASGV | 1 | ASGV | 16.7 | ||||||
ACLSV | 6 | ACLSV | 100 | ||||||
ASPV | 6 | ASPV | 100 | ||||||
Apical meristem + lateral meristems | 3 | 100 | 33.3 | 1 | ASSVd | 1 | ASSVd | 100 | |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 1 | ACLSV | 100 | ||||||
ASPV | 1 | ASPV | 100 | ||||||
Stage 3 | Apical meristem + lateral meristems + 2-3 bracts | 4 | 100 | 75.0 | 3 | ASSVd | 3 | ASSVd | 100 |
ASGV | 0 | ASGV | 0 | ||||||
ACLSV | 3 | ACLSV | 100 | ||||||
ASPV | 1 | ASPV | 33.3 | ||||||
Total | 71 | 68.5 | 42.5 | 31 | ASSVd | 29 | ASSVd | 93.5 | |
ASGV | 8 | ASGV | 25.8 | ||||||
ACLSV | 31 | ACLSV | 100 | ||||||
ASPV | 29 | ASPV | 93.5 |
zHongro co-infected by ASSVd, ASPV, ACLSV and ASGV before meristem culture and the virus elimination efficiency was investigated after 16 weeks from the culture initiation
yRefer to Figure 1
Table 3 . Simultaneous virus elimination of ASSVd, ASPV, ACLSV and ASGV from callus derived from meristem explants based on their developmental stages directly from dormant Hongro buds.
Developmental stages of meristem explantsy | No. of callus obtained (> 10 mm) from | No. of callus from which each virus was eliminated | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
#7z | #8 | #11 | Sub total | Virus | #7 | #8 | #11 | Sub total | ||
Stage 1 | Apical meristem | 3 | 3 | 3 | 9 | ASSVd | 3 | 9 | ||
ASGV | 0 | 3 | ||||||||
ACLSV | 3 | 9 | ||||||||
ASPV | 3 | 9 | ||||||||
Lateral meristem | 3 | - | - | 3 | ASSVd | - | - | 3 | ||
ASGV | - | - | 1 | |||||||
ACLSV | - | - | 3 | |||||||
ASPV | - | - | 3 | |||||||
Apical meristem + lateral meristems | 1 | 1 | 3 | 5 | ASSVd | 5 | ||||
ASGV | 3 | |||||||||
ACLSV | 5 | |||||||||
ASPV | 5 | |||||||||
Stage 2 | Apical meristem | 1 | - | 3 | 4 | ASSVd | 0 | - | 3 | 3 |
ASGV | 0 | - | 0 | 0 | ||||||
ACLSV | 1 | - | 3 | 4 | ||||||
ASPV | 1 | - | 3 | 4 | ||||||
Lateral meristem | 1 | 1 | 4 | 6 | ASSVd | 0 | 1 | 4 | 5 | |
ASGV | 1 | 0 | 0 | 1 | ||||||
ACLSV | 1 | 1 | 4 | 6 | ||||||
ASPV | 1 | 1 | 4 | 6 | ||||||
Apical meristem + lateral meristems | - | 1 | - | 1 | ASSVd | - | 1 | - | 1 | |
ASGV | - | 0 | - | 0 | ||||||
ACLSV | - | 1 | - | 1 | ||||||
ASPV | - | 1 | - | 1 | ||||||
Stage 3 | Apical meristem + lateral meristems + 2-3 bracts | 1 | 1 | 1 | 3 | ASSVd | 1 | 1 | 1 | 3 |
ASGV | 0 | 0 | 0 | 0 | ||||||
ACLSV | 1 | 1 | 1 | 3 | ||||||
ASPV | 0 | 1 | 0 | 1 | ||||||
Total | 10 | 7 | 14 | 31 | ASSVd | 8 | 7 | 14 | 29 | |
ASGV | 4 | 1 | 3 | 8 | ||||||
ACLSV | 10 | 7 | 14 | 31 | ||||||
ASPV | 9 | 7 | 13 | 29 |
zName of Hongro plant co-infected by ASSVd, ASPV, ACLSV and ASGV before meristem culture
yBold characters mean ASSVd, ASPV, ACLSV and ASGV were eliminated simultaneously
Mi Young Kim, Kang Hee Cho, Jae An Chun, Seo Jun Park, Se Hee Kim, and Han Chan Lee
J Plant Biotechnol 2017; 44(4): 401-408Jungmok Kang · Daeho Choi · Eun-Suk Jung · Yong-Woo Park
J Plant Biotechnol 2024; 51(1): 228-236Fatma H. Kiruwa ・Emanuel Epathra Mlinga ・Agatha Amnaay Aloyce ・Mpoki Mathew Shimwela
J Plant Biotechnol 2024; 51(1): 55-62
Journal of
Plant BiotechnologyVirus detection of ASSVd, ASGV, ACLSV and ASPV by RT-PCR in infected ‘Hongro’ plants before meristem culture. PCR amplification of (A) ASSVd, (B) ASGV, (C) ACLSV and (D) ASPV. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers (#6~#11), ‘Hongro’ plants tested. The plants #7, #8 and #11 were found to be co-infected by ASSVd, ASGV, ACLSV and ASPV, and were used in this study
|@|~(^,^)~|@|Meristem excision from dormant buds of apple cultivar Hongro mixed infected by
Examples of callus lines obtained by the meristem culture directly from dormant ‘Hongro’ buds co-infected by ASSVd, ACLSV, ASPV and ASGV. Various sizes and developmental stages of the apical meristem and the lateral meristems (A-C, described in Fig. 1) cultured on MS medium supplemented with 3% sucrose, 3.0 mg/L BA and 0.1 mg/L IBA. (A) An apical meristem (0.4 mm) in Stage 1. (B) An apical meristem (0.8 mm) in Stage 2. (C) Apical meristem with lateral meristems (1.0 mm) in Stage 2. (D)-(F) Explants begin to form greenish calli on them after 2-3 weeks from the culture initiation. (G)-(I) calli developed and (J)-(L) proliferated. (M)-(N) Callus lines in culture plates after 16 weeks of culture. Scale bars in (A)-(F) = 1 mm, (G)-(N) = 1 cm
|@|~(^,^)~|@|Virus detection of ASSVd by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. Amplified bands of the virus were outlined by the red square
|@|~(^,^)~|@|Virus detection of ASGV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant duds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square
|@|~(^,^)~|@|Virus detection of ACLSV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from infected dormant buds of #7, #8 and #11, respectively. No amplified bands of the virus were present in all callus lines
|@|~(^,^)~|@|Virus detection of ASPV by RT-PCR in callus lines after meristem culture directly from dormant buds of apple ‘Hongro’. M, molecular DNA marker (100 bp); N, negative control; P, positive control; Numbers of #7:1-10, #8:1-7 and #11:1-14, callus lines obtained by meristem culture from the infected dormant buds of #7, #8 and #11, respectively. The amplified bands of the virus were outlined by the red square