Sitemap
JPB 로고The Korean Society of Plant Biotechnology｜Contact Us
닫기
Search
Advanced Search +
닫기
Quick links
Most Cited Most Read Archives Go to e-Submission

Research Article

Split Viewer

J Plant Biotechnol 2022; 49(1): 30-38

Published online March 31, 2022

https://doi.org/10.5010/JPB.2022.49.1.030

© The Korean Society of Plant Biotechnology

엽록체 전장유전체 비교를 통한 PCR 기반의 Solanum brevicaule 특이적 분자마커 개발

박태호

대구대학교 원예학과

Received: 7 March 2022; Revised: 18 March 2022; Accepted: 18 March 2022

Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species

Tae-Ho Park

Author Info. +

(Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea)

Correspondence to : thzoo@daegu.ac.kr

Received: 7 March 2022; Revised: 18 March 2022; Accepted: 18 March 2022

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Go to

Solanum brevicaule is one of the tuber-bearing wild Solanum species. Because of its resistance to several important pathogens infecting potatoes during cultivation, it can be used for potato breeding. However, the fact that S. brevicaule used in this study has an EBN value of two causes the sexual reproduction barriers between the species and cultivated potatoes. In this study, specific markers for discriminating S. brevicaule from other Solanum species were developed on the basis of the results of sequence alignments with the whole chloroplast genomes of S. brevicaule and seven other Solanum species. The chloroplast genome of S. brevicaule was completed by next-generation sequencing technology described in other recent studies. The total sequence length of the chloroplast genome of S. brevicaule is 155,531 bp. Its structure and gene composition are similar to those of other Solanum species. Phylogenetic analysis revealed that S. brevicaule was closely grouped with other Solanum species. BLASTN search showed that its genome sequence had 99.99% and 99.89% identity with those of S. spegazzinii (MH021562) and S. kurtzianum (MH021495), respectively. Sequence alignment identified 27 SNPs that were specific to S. brevicaule. Thus, three PCR-based CAPS markers specific to S. brevicaule were developed on the basis of these SNPs. This study will facilitate in further studies on evolutionary and breeding aspects in Solanum species.

Keywords cpDNA, PCR-based marker, Potato, SNPs, Solanum brevicaule

서 론

Go to

재배종 감자(Solanum tuberosum L.)의 야생종인 Solanum brevicaule는 페루 남부지역부터 아르헨티나 북부지역까지 자생하고 있으며 2배체부터 6배체까지 다양한 배수성을 가지고 있다(Hardigan et al. 2015; Miller and Spooner 1999). S. brevicaule는 감자선충 Globodera pallida와 Pectobacterium carotovorum에 의해 발생하는 무름병에 저항성이 있어 감자의 신품종 육성을 위한 중요한 재료로 활용할 수 있다(Chung et al. 2011; Jackson et al. 1988). 하지만, 이 야생종은 다양한 배수성과 함께 분류학적으로 S. brevicaule Bitter complex로 불리는 다소 복잡한 그룹에 속해 있으며(Hardigan et al. 2015; Miller and Spooner 1999), 본 연구에 이용된 S. brevicaule는 2배체이고 EBN (Endosperm Balanced Number)은 2로 4배체이고 EBN이 4인 재배종 감자와 직접적인 교배에 의한 품종 육성은 불가능하다(Cho et al. 1997; Hawkes 1990; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014). 이러한 생리적 불화합성에 의한 장벽을 극복하고 다양한 야생종이 가지고 있는 유용 형질을 재배종 감자에 도입하여 새로운 감자품종을 육성하기 위해서는 순차적 교배(bridge crossing), 형질전환에 의한 유전자 도입(genetic transformation), 체세포 잡종(somatic hybridization) 등의 방법을 이용할 수 있다(Cho and Park 2014). 순차적 교배법의 경우 이용하고자 하는 감자 근연야생종의 배수성과 EBN 등을 고려하여 교잡 가능한 다른 근연야생종과의 반복적 교배를 통해 육성된 계통을 재배종 감자와 교배하는 방법으로 많은 시간과 노력이 소요되며, 형질전환에 의한 유전자 도입은 도입하고자 하는 유전자를 발굴하고 클로닝하는 과정이 필요하고 형질전환에 대한 사회적 인식과 법적인 문제가 있어 실질적으로 이용하기에 어려움이 있어 1970년대에 감자의 원형질체 분리와 배양이 성공적으로 이루어진 이래 체세포 잡종을 이용하는 방법이 현재까지도 많이 이용되고 있다(Cho and Park 2014; Tiwari et al. 2021; Tu et al. 2021).

체세포 잡종을 감자 품종 육성에 이용하기 위해서는 체세포 융합 이후 융합계통이 실질적으로 융합이 이루어졌는지 확인하고 육종에 활용할 수 있는 계통을 선발하는 과정이 필요하며, 이를 위해 다양한 생명공학적 기술들이 이용되고 있다(Cho and Park 2014). 그중 가장 많이 이용되는 것은 분자표지를 이용하는 것으로 핵 내 DNA의 염기서열 정보뿐 만 아니라 세포질의 미토콘드리아나 엽록체에 존재하는 DNA 염기서열 정보를 활용하기도 한다(Patel et al. 2011; Sarkar et al. 2011; Thieme et al. 2010; Wang et al. 2011; Yu et al. 2012). 이 중, 엽록체 DNA의 경우 현재까지 보고된 다양한 감자 야생종의 엽록체 DNA의 유전적 구성, 구조와 크기 등을 고려할 때 매우 유사한 것으로 알려져 있으나(Palmer 1991; Saski et al. 2005; Yurina and Odintosova 1998), 여전히 종 간에 유전자의 재배치에 따른 염기서열에서의 InDel, SNP, SSR 등의 다형성을 보여 이들 정보를 이용한 분자표지 개발이 가능한 것으로 보고되고 있다(Calsa Junior et al. 2004; Jheng et al. 2012; Kim and Park 2019, 2020a, 2020b; Park 2021b; Saski et al. 2005). 이에 본 연구에서는 앞서 Park (2019)에 의해 간략히 보고된 바 있는 S. brevicaule의 엽록체 전장유전체에 대한 상세 정보를 제공하고, 다른 Solanum 종들과의 비교 분석을 통해 PCR 기반의 S. brevicaule 특이적 분자마커를 개발한 결과를 제공하고자 한다.

재료 및 방법

Go to

식물재료 및 DNA 분리

엽록체 전장 유전체 분석에는 S. brevicaule (PI205394) 계통 중 하나인 SB2-1이 이용되었다. S. brevicaule 특이적인 PCR 기반의 분자마커 개발을 위해 엽록체 전장 유전체 분석을 위해 이용된 SB2-1과 더불어 추가로 S. brevicaule 계통 하나(SB2-17)가 추가되었으며, 재배종 감자품종 중 ‘서홍’(SH), ‘하령’(HR), ‘대지’(DJ), 감자품종 육성을 위한 계통 중 하나인 PT56, 그리고 총 15개의 야생종 계통, SA (S. acaule, PI310970), SB1 (S. berthaultii, PI310981), SD (S. demissum, PI218047), SC4 (S. candolleanum, PI210035), SC1 (S. cardiophyllum, PI341233), SC2 (S. commersonii, PI558050), SI (S. iopetalum, PI230459), SK (S. kurtzianum, PI578236), SJ (S. jamesii, PI578326), SM2 (S. microdontum, PI310979), SM1 (S. mochiquense, PI338616), SP (S. pinnatisectum, PI190115), SS (S. stoloniferum, PI160224), SV2 (S. vernei, PI230468), SV1 (S. verrucosum, PI160228)이 이용되었다.

모든 식물재료는 국립식량과학원 고령지농업연구소로부터 분양받아 기내식물체로 증식되어 이용되었으며, 각각의 식물재료를 대상으로 한 DNA는 기내 증식 유식물체 100mg을 채취하여 Genomic DNA Extraction kit (Plants) (RBC, New Taipei City, Taiwan)를 이용하여 추출하였다.

엽록체 전장유전체 분석

S. brevicaule 전장 유전체 분석은 S. brevicaule 계통 SB2-1을 대상으로 진행되었으며 전체 DNA를 추출하고 Macrogen (Macrogen, Seoul, South Korea)의 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA)의 플랫폼을 이용하여 진행되었다. 전체 염기서열(raw data) 정보는 CLC genome assembler package version 4.2.1 (CLC Inc, Rarhus, Denmark) 내의 CLC quality trim 프로그램을 통한 전처리 과정을 거쳐, 이후 Phred score 20 이상의 high-quality 서열만을 분석에 이용하였다. 확보된 염기서열은 같은 패키지 내의 CLC de novo assemble 프로그램을 이용한 dnaLCW 방법으로 de novo assembly하고, 이후 엽록체 유전체 유래의 contig 만을 선별하고, contig 확장 및 통합 그리고 gap-filling 과정을 통해 엽록체 전장 유전체를 완성하였다. 또한, 해당 염기서열을 완성된 엽록체 전장 유전체 서열에 mapping 하여 각 위치의 mapped read depth를 계산하였으며, S. berthaultii의 엽록체 전장 유전체(KY419708, Kim et al. 2018; Park 2017)와 BLASTZ (Schwartz et al. 2003) 분석을 시행하였다.

S. brevicaule 엽록체 전장 유전체 서열의 유전자 분석은 Geseq 프로그램을 이용하여 진행하였으며(Tillich et al. 2017), BLAST search에 기반하여 manual curation을 진행하여 최종 유전자 부위를 확인하였다. S. brevicaule 엽록체 전장 유전체의 유전자 부위는 OGDraw (OrganellarGenomeDRAW; http://ogdraw.mpimp-golm.mpg.de) 프로그램을 이용하여 유전자지도를 작성하여 표시하였다(Lohse et al. 2013).

엽록체 전장유전체의 비교

S. brevicaule의 계통발생학적 분석을 위해 S. brevicaule 엽록체 전장 유전체 염기서열을 NCBI (the National Center for Biotechnology Information)로부터 얻은 Capsicum annuum (JX270811), S. berthaultii (KY419708), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. commersonii (KM489054), S. demissum (MK036508), S. hougasii (MF471372), S. lycopersicum (NC007898), S. nigrum (KM489055), S. stoloniferum (MF471373), S. tuberosum (KM489056 및 NC008096)과 비교하여 계통수를 작성하였다. 엽록체 코딩 서열을 기반으로 Kimura 2-parameter 모델을 적용한 Maximum likelihood 방법이 이용되었으며, 1,000번의 Bootstrap 옵션으로 MEGA 6.0 프로그램을 이용하여 분석이 진행되었다(Tamura et al. 2013).

S. brevicaule 특이적 분자마커 개발을 위해 S. brevicaule 엽록체 전장 유전체 염기서열은 NCBI로부터 얻은 S. acaule (MK036506), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. commersonii (KM489054), S. demissum (MK036508), S. stolonioferum (MF471373), S. tuberosum (KM489056)의 엽록체 전장 유전체 염기서열과 EMBL (http://www.ebi.ac.uk/Tools/msa/clustalw2)의 ClustalW2에 의해 다중 정렬하여 염기서열을 비교 분석하여 S. brevicaule 특이적 영역대를 구명하였다.

PCR 기반의 분자마커 개발

S. brevicaule을 포함한 총 8종의 엽록체 전장 유전체 염기서열을 대상으로 한 다중 정렬의 결과로 구명된 S. brevicaule 특이적 SNP를 대상으로 S. brevicaule 특이성 검증이 수행되었다. 우선, 8종의 다중 정렬 결과로 구명된 SNP를 대상으로 dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html)을 이용하여 S. brevicaule 특이적으로 작용하거나 S. brevicaule를 제외한 다른 Solanum 종들에 특이적으로 작용하는 제한효소를 확인한 후, 각각의 SNP 영역을 포함하는 프라이머를 제작하였고, S. brevicaule와 S. tuberosum을 포함하여 총 21개의 유전자 계통, S. brevicaule (SB2-1 및 SB2-17), S. tuberosum (감자품종 ‘서홍(Seohong)’, ‘하령(Haryeong)’, ‘대지(Daeji)’, 및 감자품종 육성계통 PT56), S. acaule (SA), S. berthaultii (SB1), S. candolleanum (SC4), S. cardiophyllum (SC1), S. commersonii (SC2), S. demissum (SD), S. iopetalum (SI), S. kurtzianum (SK), S. jamesii (SJ), S. microdontum (SM2), S. mochiquense (SM1), S. pinnatisectum (SP), S. stoloniferum (SS), S. vernei (SV2) and S. verrucosum (SV1)을 대상으로 총 25 ul 볼륨(약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany)를 이용하여 PCR을 수행하였다. PCR의 결과는 핵산 염색용액인 RedSafe (Intron Biotechnology, Seongnam, South Korea)를 이용하여 1% agarose gel에서 확인하였으며, PCR 결과물을 대상으로 제한효소를 처리한 후, 동일한 방법으로 agarose gel에서 확인하여 PCR 기반의 S. brevicaule 특이적 분자마커 개발을 진행하였다.

결과 및 고찰

Go to

감자 야생종 S. brevicaule의 엽록체 전장 유전체

S. brevicaule의 엽록체 전장 유전체는 앞서 NGS (Next-Generation Sequencing) 기술에 의해 완성되어 간략히 보고 된 바 있다(Park 2019). 이에 더해, S. brevicaule의 엽록체 전장 유전체에 대한 세부적인 정보를 기술하자면 Illumina의 PE 표준 프로토콜에 의해 얻은 총 염기서열은 약 3,176 Mbp로, 그 평균 길이는 291.5 bp였으며, CLC genome assembler package version 4.2.1 (CLC Inc, Rarhus, Denmark) 내의 CLC quality trim 프로그램을 통한 전처리 과정을 거쳐, 이후 Phred score 20 이상의 high-quality 서열로 평균 길이 258.0 bp인 염기서열 정보 약 2,458 Mbp를 얻을 수 있었다. 이 염기서열을 같은 패키지의 CLC de novo assembler 프로그램을 이용한 dnaLCW 방법으로 de novo assembly하고, 이후 엽록체 유래의 contig만을 선별하고, contig를 확장, 통합, 그리고 gap-filling 과정을 거쳐 엽록체 전장 유전체를 완성하였다. 완성된 전체 염기서열의 길이는 155,531 bp이며(KY419708, Park 2019), aligned read의 수는 약 55만 6천 개로, 엽록체 유전체 평균 coverage는 약 897.9x로 나타났다. 전체 trimmed read를 완성된 유전체 서열에 mapping 하여 확인한 read depth는 최소 400 이상으로 확인되었다. 그 구조는 대부분의 다른 식물의 엽록체 전장 유전체 구조와 같이 원형의 이중가닥 분자로 LSC (Large Single Copy), SSC (Small Single Copy), 그리고 한 쌍의 IRa/IRb (Inverted Repeat a/b)로 이어져 있으며, 영역별로 각각 85,981 bp, 18,352 bp, 25,599 bp의 크기로 나누어져 있었다. 완성된 염기서열을 S. berthaultii 엽록체 전장 유전체 염기서열 (KY419708, Kim et al. 2018; Park 2017)과 비교하고 BLASTZ 분석(Schwartz et al. 2003)을 실시한 결과 유사 구조를 확인할 수 있었다(Fig. 1). S. brevicaule의 엽록체 전장 유전체 전체 염기서열을 NCBI에서 Blastn 분석 결과 S. spegazzinii (MH021562), S. kurtzianum (MH021495)와 각각 99.99%, 99.89%의 높은 유사도를 보였으며, Solanum 속의 다른 종들과 비교해 보면 전체 길이는 모두 유사했고, GC 비율도 37.87%로 거의 비슷하게 나타났다(Table 1).

Table 1 . Comparative analysis of the chloroplast genome sequence of S. brevicaule with those of nine Solanaceae species

SpeciesAccession no.Total Length (bp)GC content (%)Total no. of genesNo. of tRNANo. of rRNAReference
S. brevicauleMK036507155,53137.87135364In this study
S. demissumMK036508155,55837.87135364Cho et al. (2019)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*Data have been partially adopted from Park (2021b).

Fig. 1. Assembly result of the complete chloroplast genome sequence of S. brevicaule (MK036507). Four representative contigs of the chloroplast genome of S. brevicaule and comparison with the corresponding regions of the chloroplast genome of S. berthaultii (KY419708; Kim et al. 2018) are combined. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientations, respectively

S. brevicaule의 엽록체 전장 유전체에는 105개의 단백질 코딩, 45개의 tRNA, 8개의 rRNA를 포함해 총 158개의 유전자가 분포하고 있었으며, 그중 11개의 단백질 코딩 유전자, 9개의 tRNA, 4개의 rRNA를 포함하는 24개가 한 쌍의 IR 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 59.2%가 코딩 영역으로 평균 길이가 약 583.0 bp로, 이 중 단백질 코딩 유전자, tRNA, rRNA가 각각 평균 764.6 bp, 62.1 bp, 1130.8 bp의 크기로 51.6%, 1.8%, 5.8%의 비율로 분포되어 있었으며, Solanum 속의 다른 종들과 비교해 보면 유전자, tRNA, rRNA 등의 개수, 순서 등이 모두 유사한 것으로 나타났다(Table 1)(Cho et al. 2016, 2019; Cho and Park 2016; Kim et al. 2018; Kim and Park, 2019, 2020a, 2020b).

Fig. 2. Gene map of the chloroplast genome of S. brevicaule. Genes on the outside and inside of the map are transcribed in the clockwise and counterclockwise directions, respectively

엽록체 전장유전체 비교 및 계통수

S. brevicaule의 엽록체 전장 유전체는 계통수 작성을 위해 Solanaceae 과에 속하는 다른 11종의 엽록체 전장 유전체의 코딩 서열과 비교 분석되었다(Fig. 3). 분석에 이용된 Maximum likelihood 방법은 체계적인 분류의 결과를 보여주었으며, 높은 bootstrap 값은 계통수의 결과를 뒷받침해 주었다. 결과적으로 S. brevicaule는 계통수에서 S. tuberosum을 포함한 다수의 Solanum 종들과 매우 근접한 수준으로 같은 그룹으로 분류되었다.

Fig. 3. Maximum-likelihood phylogenetic tree of S. brevicaule with 11 species belonging to the Solanaceae family based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. The figure has been partially adopted from Park (2019)

S. brevicaule의 엽록체 전장 유전체의 염기서열 정보를 이용하여 S. brevicaule와 다른 Solanum 속에 속하는 종들을 구분할 수 있는 S. brevicaule 특이적 분자마커를 개발하기 위해 EMBL의 ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 S. brevicaule 및 다른 7개 Solanum 종의 엽록체 전장 유전체 전체를 대상으로 다중 정열을 수행하였다(Fig. 4). 그 결과, 앞서 보고된 바와 같이 다수의 InDel과 SNP 영역을 발견할 수 있었으며(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b, Park 2021b), S. brevicaule 특이적인 InDel은 삽입과 삭제 각각 4개, 2개씩 총 6개의 영역으로 나타났으며, SNP는 총 27개를 확인하였다. InDel 영역 6개 중 5개는 앞서 다른 종들의 InDel에서 주로 확인된 바와 같이 비코딩 영역에 분포하고 있었으며, SNP는 27개 중 13개는 비코딩 영역 14개는 코딩 영역에 분포하고 있었다(Cho and Park 2016; Chung et al. 2006; Kim and Park 2019, 2020b; Park 2021b).

Fig. 4. Multiple alignment of the sequences on the intergenic or intragenic regions containing SNPs used to develop the PCR-based markers. SA11, SB2-1, SD9, Stub, Scmr, Sblb, Scha, and Ssto indicate the chloroplast genome sequences of S. acaule (MK036506; Park 2021a), S. brevicaule (MK036507; In this study), S. demissum (MK036508; Cho et al. 2019), S. tuberosum (KM489056; Cho et al. 2016), S. commersonii (KM489054; Cho et al. 2016), S. bulbocastanum (DQ347958; Daniell et al. 2006), S. chacoense (MF471371; Kim and Park 2019), and S. stoloniferum (MF471373; Kim and Park 2020a), respectively. They are listed from top to bottom in each region of the SNPs. The regions of the SNPs detected on that of S. brevicaule are highlighted and underlined. Restriction sites are indicated in red and bold font

S. brevicaule 특이적 분자마커 개발

앞서 확인된 S. brevicaule 특이적인 InDel과 SNP를 분자마커의 개발에 활용하고자 하였으나, InDel 영역의 경우 InDel 특이적 primer를 제작하여 PCR을 통한 S. brevicaule 특이적인 SCAR (Sequence Characterized Amplified Region) 마커의 개발에 어려움이 있었다. 일반적으로 InDel이 존재하는 영역에서 primer를 제작하여 PCR을 하면 InDel 영역의 염기서열 차이에 의해 발생하는 다형성에 의한 효과적인 분자마커 개발이 가능하나(Cho et al. 2015; Garcia-Lor et al. 2013; Yamaki et al. 2013), 본 연구에서는 삽입 또는 삭제 염기서열의 차이가 크지 않거나 InDel 영역을 포함한 인근 염기서열에서 반복서열이 존재하고 있기 때문인 것으로 추정된다(Kim and Park 2020b). 따라서, 본 연구에서는 앞서 확인된 SNP를 이용하여 SNP 영역 특이적으로 작용할 수 있는 제한효소의 유무를 확인한 후 SNP 영역이 포함되도록 primer를 제작하여 PCR 진행 후 분석 대상의 모든 Solanum 종들에서 PCR로 증폭된 DNA 단편에 제한효소를 처리하여 얻을 수 있는 CAPS (Cleaved Amplified Polymorphism Sequence; Konieczny and Ausubel 1993) 마커를 개발하게 되었다. CAPS 마커는 Solanum 종들을 대상으로 한 종 구분 또는 종 내 유전자형의 선발 등에 많이 활용되고 있으며(Kim and Park 2020a, 2020b; Park et al. 2005; Smilde et al. 2005; van der Voort et al. 1999), 다른 작물에서도 같은 목적으로 많이 이용되고 있다(Caranta et al. 1999; Konovalov et al. 2005; Lee et al. 2008; Pettenkofer et al. 2020; Uncu et al. 2015; Wang et al. 2017). 본 연구에서는 최종적으로 SNP를 이용한 S. brevicaule 특이적인 3개의 CAPS 마커가 개발되었는데, 첫 번째 분자마커(SB2_SNP_3)는 rbcL 유전자 내에 존재하는 SNP가 HpaII 제한효소에 의해 S. brevicaule만을 특이적으로 절단하여 S. brevicaule 특이적인 결과를 나타냈으며(Table 2, Fig. 5A), 두 번째(SB2_SNP_5)와 세 번째(SB2_SNP_8) 분자마커는 각각 rpl36-rps8과 ndhI-ndhA 유전자 간 영역에 존재하는 SNP가 각각 HphI과 HinfI 제한효소에 의해 S. brevicaule 비특이적으로 S. brevicaule를 제외한 다른 Solanum 종들만을 절단하여 S. brevicaule 특이적, 그리고 S. brevicaule 비특이적인 결과를 모두 나타냈다(Table 2, Fig. 5B, Fig. 5C).

Table 2 . Primers and restriction enzymes for generating S. brevicaule-specific markers

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SB2_SNP_3rbcL(Intragenic)FAATACCATGGTCTAATAATC688HpaII
RTAATAGTACATCCCAACAGG
SB2_SNP_5rpl36-rps8(Intergenic)FAATAACTCCCTTTGGTATTC653HphI
RTGTGTTATATCTGGTAATCC
SB2_SNP_8ndhI-ndhA(Intergenic)FTACGGAATAGAAAGATTCC680HinfI
RATTCATGAACTAATGTACTC

aF and R indicate forward and reverse strand of primers.

bThe expected size of PCR fragments is measured on the basis of the sequence of S. brevicaule.

cRestriction enzymes generating S. brevicaule-specific markers.

Fig. 5. PCR-based markers for the discrimination of S. brevicaule from other Solanum species. A: SB2_SNP_3. B: SB2_SNP_5. C: SB2_SNP_8. The three markers all generated bands positively and/or negatively specific to S. brevicaule. Red and yellow allows indicate positive and negative bands on S. brevicaule, respectively. SB2-1 and SB2-17 indicate two different lines of S. brevicaule (PI205394). M, SH, HR, DJ, PT56, SA, SB1, SD, SC4, SC1, SC2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate a size marker ladder, the potato varieties ‘Seohong’, ‘Haryeong’, ‘Daeji’, a potato breeding line ‘PT56’, S. acaule (PI310970), S. berthaultii (PI310981), S. demissum (PI218047), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S. microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively

다양한 Solanum 종들을 대상으로 분자마커를 이용하여 유전자형을 확인하는 것은 다양한 야생종들을 이용한 감자의 신품종 육성뿐 만 아니라 진화학적 연구에도 유용하게 활용될 수 있다(Bohs and Olmstead 1997; Hosaka and Sanetomo 2012). 특히, 감자의 신품종 육성에 이용할 수 있는 야생종들의 배수성과 EBN의 다양성으로 인한 교잡불친화성을 극복하기 위해 체세포잡종이 이용될 경우 체세포잡종 과정에서 핵 내 염색체의 새로운 조합이나 세포질의 엽록체와 미토콘드리아 게놈의 무작위적 배분이 발생하여 효율적인 육종의 진행을 위해서는 체세포잡종 개체들을 대상으로 분자마커를 이용한 효율적인 유전자형의 선발이 필요하다(Aversano et al. 2009; Bastia et al. 2000; Cho et al. 2016; Kim et al. 2018; Scotti et al. 2003). 대체로, 체세포잡종에 의해 핵 내 게놈과 미토콘드리아 게놈의 경우 높은 빈도의 재조합이 발생하는 것으로 알려져 있으며, 엽록체 게놈의 경우 재조합 빈도가 매우 낮거나 무작위로 한쪽친만의 게놈이 전달되는 것으로 알려져 있다(Lössl et al. 2000). 이러한 특성은 Solanum 종에서도 일반적으로 관찰되고 있으며(Chen et al. 2013; Cho et al. 2016; Smyda-Dajmund et al. 2016), 다른 식물종에서도 나타나는 현상으로 알려져 있다(Mohapatra et al. 1998; Xiang et al. 2004). 하지만, 엽록체 게놈의 경우에도 양친의 게놈이 모두 전달되는 경우도 있어 정확한 유전자형의 구별이 필요하다(Wang et al. 2011). 따라서, 본 연구에서 개발된 SNP 기반의 CAPS 마커는 S. brevicaule와 S. tuberosum을 구별하는데 이용될 수 있을 뿐만 아니라, 체세포잡종을 이용한 육종에서 엽록체 게놈의 유전자형을 구별하고 선발하는데 이용되어 S. brevicaule을 이용한 감자의 신품종 육성에 기여할 것이다.

적 요

Go to

Solanum brevicaule는 괴경을 형성하는 감자 야생종 중의 하나로 감자재배에서 문제가 되는 중요한 몇 가지 병에 대해 저항성 보여 감자의 신품종 육성을 위한 재료로 이용될 수 있다. 하지만, 본 연구에서 이용된 S. brevicaule의 EBN이 2인 사실로 인하여 재배종 감자와의 생식에 의한 종자생산에 장벽이 되고 있다. 본 연구에서는 차세대 유전체 기술에 의해 완성된 S. brevicaule의 엽록체 전장 유전체와 다른 7개 Solanum 종의 엽록체 전장 유전체를 비교하여 S. brevicaule를 다른 Solanum 종과 구별할 수 있는 Solanum 종 특이적인 분자마커를 개발하였다. S. brevicaule의 엽록체 전장 유전체의 총길이는 155,531 bp였으며, Blastn을 통해 S. spegazzinii 및 S. kurtzianum과 각각 99.99% 및 99.89%의 유사도를 확인할 수 있었다. 또한, 그 구조와 유전자의 구성이 다른 Solanum 종과 매우 유사하였으며, 계통수 분석에서도 다른 Solanum 종들과 매우 가까운 유연관계를 가지는 것으로 확인되었다. 엽록체 전장 유전체 다중 정렬에서는 총 27개의 S. brevicaule 특이적인 SNP 영역이 확인되었으며, 이들 중 세 개의 SNP 영역을 대상으로 최종적으로 S. brevicaule 특이적인 PCR 기반의 CAPS 분자마커를 개발하였다. 본 연구를 통해 얻은 S. brevicaule의 엽록체 전장 유전체와 S. brevicaule 특이적인 분자마커의 결과는 향후 Solanum 종을 대상으로 한 진화와 S. brevicaule를 이용한 감자품종 육성 연구에 기여를 할 수 있을 것이다.

사 사

Go to

이 성과는 정부(과학기술정보통신부)의 재원으로 한국연구재단의 지원을 받아 수행된 연구임(No. NRF-2021R1F1A1045981).

REFERENCES

Go to
  1. Aversano R, Savarese S, De Nova JM, Frusciante L, Punzo M, Carputo D (2009) Genetic stability at nuclear and plastid DNA level in regenerated plants of Solanum species and hybrids. Euphytica 165: 353-361
    CrossRef
  2. Bastia T, Carotenuto N, Basile B, Zoina A, Cardi T (2000) Induction of novel organelle DNA variation and transfer of resistance to frost and Verticillium wilt in Solanum tuberosum through somatic hybridization with 1EBN S. commersonii. Euphytica 116: 1-10
  3. Bohs L, Olmstead RG (1997) Phylogenetic relationships in Solanum (Solanaceae) based on ndhF sequences. Syst Bot 22: 5-17
    CrossRef
  4. Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46: 366-373
    Pubmed CrossRef
  5. Caranta C, Thabuis A, Palloix A (1999) Development of a CAPS marker for the Pvr4 locus: A tool for pyramiding potyvirus resistance genes in pepper. Genome 42: 1111-1116
    Pubmed
  6. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126: 1861-1872
    Pubmed CrossRef
  7. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35: 2113-2123
    Pubmed CrossRef
  8. Cho K-S, Cho J-H, Park Y-E, Park T-H (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4: 1800-1802
  9. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29: 154-161
  10. Cho K-S, Park T-H (2014) Potato breeding via protoplast fusion. J Plant Biotechnol 41: 65-72
    CrossRef
  11. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57: 69-78
    CrossRef
  12. Cho K-S, Yun B-K, Yoon Y-H, Hong S-Y, Mekapogu M, Kim K-H, Yang T-J (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10
    Pubmed KoreaMed CrossRef
  13. Chung YS, Holmquist K, Spooner DM, Jansky SH (2011) A test of taxonomic and biogeographic predictivity: resistance to soft rot in wild relatives of cultivated potato. Ecol Epidemiol 101: 205-212
    Pubmed CrossRef
  14. Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25: 1369-1379
  15. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112: 1503-1518
    Pubmed CrossRef
  16. Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111: 1-19
  17. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005). The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop, pp 107
  18. Hardigan MA, Bamberg J, Buell CR, Douches DS (2015) Taxonomy and genetic differentiation among wild and cultivated germplasm of Solanum sect. Petota. Plant Genome 8: 1
    Pubmed CrossRef
  19. Hawkes JG (1990). The potato: Evolution, biodiversity and genetic resources. Belhaven Press, London, UK
  20. Hosaka K, Sanetomo R (2012) Development of a rapid identification method for potato cytoplasm and its use for evaluating Japanese collections. Theor Appl Genet 125: 1237-1251
    Pubmed CrossRef
  21. Jackson MT, Hawkes JG, Male-Kayiwa BS, Wanyera N (1988) The importance of the Bolivian wild potato species in breeding for Globodera pallida resistance. Plant Breed 101: 261-268
    CrossRef
  22. Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C (2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids. Plant Sci 190: 62-73
    Pubmed CrossRef
  23. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45: 207-216
  24. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46: 79-87
  25. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47: 131-140
  26. Kim S, Park T-H (2020b) Development of Solanum hougasii-specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47: 141-149
  27. Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4: 403-410
    Pubmed CrossRef
  28. Konovalov F, Toshchakova E, Gostimsky S (2005) A CAPS marker set for mapping in linkage group III of pea (Pisum sativum L.). Cell Mol Biol Lett 10: 163-171
    Pubmed
  29. Lee J, Yoon JB, Park HG (2008) A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol Breeding 21: 95-104
    CrossRef
  30. Lohse M, Drechsel O, Kahlau S, Bock R (2013) Organellar GenomeDRAW - a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41: W575-W581
    Pubmed KoreaMed CrossRef
  31. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116: 221-230
  32. Miller JT, Spooner DM (1999) Collapse of species boundaries in the wild potato Solanum brevicaule complex (Solanaceae, S. sect. Petota): molecular data. Pl Syst Evol 214: 103-130
  33. Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17: 814-818
    Pubmed CrossRef
  34. Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60: 105-113
  35. Palmer JD (1991) Plastid chromosomes: structure and evolution. In: Bogorad K. Vasil (ed) The molecular biology of plastids. Academic Press, San Diego, USA, pp 5-53
    CrossRef
  36. Park T-H (2017) The complete chloroplast genome of Solanum berthaultii, one of the potato wild relative species. Mitochondr DNA Part B 2: 88-89
    Pubmed KoreaMed CrossRef
  37. Park T-H (2019) Complete chloroplast genome of the wild diploid potato relative, Solanum brevicaule. Mitochondr DNA Part B 4: 4159-4160
  38. Park T-H (2021a) Complete chloroplast genome of the wild diploid potato relative, Solanum acaule. Mitochondr DNA Part B 6: 1189-1191
  39. Park T-H (2021b) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48: 18-25
  40. Park T-H, Gros J, Sikkema A, Vleeshouwers VGAA, Muskens M, Allefs S, Jacobsen E, Visser RGF, van der Vossen EAG (2005) The late blight resistance locus Rpi-blb3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on chromosome 4 of potato. Mol Plant-Microb Interact 18: 722-729
  41. Patel D, Power J, Anthony P, Badakshi F, Heslop-Harrison J, Davey M (2011) Somatic hybrid plants of Nicotiana x sanderae + N. debneyi with fungal resistance to Peronospora tabacina. Ann Bot 108: 809-819
    Pubmed KoreaMed CrossRef
  42. Pettenkofer T, Finkeldey R, Müller M, Krutovsky KV, Vornam B, Leinemann L, Gailing O (2020) Development of novel Quercus rubra chloroplast genome CAPS markers for haplotype indentification. Silvae Genetica 69: 78-85
  43. Sarkar D, Tiwari J, Sharma S, Sharma Poonam S, Gopal J, Singh B, Luthra S, Pandey S, Pattanayak D (2011) Production and characterization of somatic hybrids between Solanum tuberosum L. and S. pinnatisectum Dun. Plant Cell Tiss Org Cult 107: 427-440
    CrossRef
  44. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59: 309-322
    CrossRef
  45. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13: 103-107
    Pubmed KoreaMed CrossRef
  46. Scotti N, Monti L, Cardi T (2003) Organelle DNA variation in parental Solanum spp. genotypes and nuclear-cytoplasmic interactions in Solanum tuberosum (+) S. commersonii somatic hybrid-backcross progeny. Theor Appl Genet 108: 87-94
    Pubmed CrossRef
  47. Smilde WD, Brigneti G, Jagger L, Perkins S, Jones JDG (2005) Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theor Appl Genet 110: 252-258
    Pubmed CrossRef
  48. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35: 1345-1358
    Pubmed KoreaMed CrossRef
  49. Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot Rev 80: 283-383
    CrossRef
  50. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30: 2725-2729
  51. Thieme R, Rakosy-Tican E, Nachtigall M, Schubert J, Hammann T, Antonova O, Gavrilenko T, Heimbach U, Thieme T (2010) Characterization of the multiple resistance traits of somatic hybrids between Solanum cardiophyllum Lindl. and two commercial potato cultivars. Plant Cell Rep 29: 1187-1201
    Pubmed CrossRef
  52. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45: W6-W11
    Pubmed KoreaMed CrossRef
  53. Tiwari JK, Rawat S, Luthra SK, Zinta R, Sahu S, Varshney S, Kumar V, Dalamu D, Mandadi N, Kumar M, Chakrabarti SK, Rao AR, Rai A (2021) Genome sequence analysis provides insights on genomic variation and late blight resistance genes in potato somatic hybrid (parents and progeny). Mol Biol Rep 48: 623-635
    Pubmed CrossRef
  54. Tu W, Dong J, Zou Y, Zhao Q, Wang H, Ying J, Wu J, Du J, Cai X, Song B (2021) Interspecific potato somatic hybrids between Solanum malmeanum and S. tuberosum provide valuable resources for freezing-tolerance breeding. Plant Cell Tiss Organ Cult 147: 73-83
    CrossRef
  55. Uncu AT, Celik I, Devran Z, Ozkaynak E, Frary A, Frary A, Doganlar S (2015) Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper. Euphytica 206: 393-399
    CrossRef
  56. van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Klein-Lankhorst R, Stiekema W, Baulcombe D, Bakker J (1999) Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol Plant-Microb Interact 18: 722-729
  57. Wang Y, Liu W, Xu L, Wang Y, Chen Y, Luo X, Tang M, Liu L (2017) Development of SNP markers based on transcriptome sequences and their application in germplasm identification in radish (Raphanus sativus L.). Mol Breeding 37: 26
    CrossRef
  58. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30: 1811-1821
    Pubmed CrossRef
  59. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47: 680-688
    Pubmed CrossRef
  60. Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T, Kubo T, Kurata N, Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63: 246-254
    Pubmed KoreaMed CrossRef
  61. Yu Y, Li Z, Wang P, Xiang F (2012) Genetic and biochemical characterization of somatic hybrids between Bupleurum scorzonerifolium and Gentianopsis paludosa. Protoplasma 249: 1029-1035
    Pubmed CrossRef
  62. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34: 5-22

Article

Research Article

J Plant Biotechnol 2022; 49(1): 30-38

Published online March 31, 2022 https://doi.org/10.5010/JPB.2022.49.1.030

Copyright © The Korean Society of Plant Biotechnology.

엽록체 전장유전체 비교를 통한 PCR 기반의 Solanum brevicaule 특이적 분자마커 개발

박태호

대구대학교 원예학과

Received: 7 March 2022; Revised: 18 March 2022; Accepted: 18 March 2022

Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species

Tae-Ho Park

(Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea)

Correspondence to:thzoo@daegu.ac.kr

Received: 7 March 2022; Revised: 18 March 2022; Accepted: 18 March 2022

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Solanum brevicaule is one of the tuber-bearing wild Solanum species. Because of its resistance to several important pathogens infecting potatoes during cultivation, it can be used for potato breeding. However, the fact that S. brevicaule used in this study has an EBN value of two causes the sexual reproduction barriers between the species and cultivated potatoes. In this study, specific markers for discriminating S. brevicaule from other Solanum species were developed on the basis of the results of sequence alignments with the whole chloroplast genomes of S. brevicaule and seven other Solanum species. The chloroplast genome of S. brevicaule was completed by next-generation sequencing technology described in other recent studies. The total sequence length of the chloroplast genome of S. brevicaule is 155,531 bp. Its structure and gene composition are similar to those of other Solanum species. Phylogenetic analysis revealed that S. brevicaule was closely grouped with other Solanum species. BLASTN search showed that its genome sequence had 99.99% and 99.89% identity with those of S. spegazzinii (MH021562) and S. kurtzianum (MH021495), respectively. Sequence alignment identified 27 SNPs that were specific to S. brevicaule. Thus, three PCR-based CAPS markers specific to S. brevicaule were developed on the basis of these SNPs. This study will facilitate in further studies on evolutionary and breeding aspects in Solanum species.

Keywords: cpDNA, PCR-based marker, Potato, SNPs, Solanum brevicaule

서 론

재배종 감자(Solanum tuberosum L.)의 야생종인 Solanum brevicaule는 페루 남부지역부터 아르헨티나 북부지역까지 자생하고 있으며 2배체부터 6배체까지 다양한 배수성을 가지고 있다(Hardigan et al. 2015; Miller and Spooner 1999). S. brevicaule는 감자선충 Globodera pallida와 Pectobacterium carotovorum에 의해 발생하는 무름병에 저항성이 있어 감자의 신품종 육성을 위한 중요한 재료로 활용할 수 있다(Chung et al. 2011; Jackson et al. 1988). 하지만, 이 야생종은 다양한 배수성과 함께 분류학적으로 S. brevicaule Bitter complex로 불리는 다소 복잡한 그룹에 속해 있으며(Hardigan et al. 2015; Miller and Spooner 1999), 본 연구에 이용된 S. brevicaule는 2배체이고 EBN (Endosperm Balanced Number)은 2로 4배체이고 EBN이 4인 재배종 감자와 직접적인 교배에 의한 품종 육성은 불가능하다(Cho et al. 1997; Hawkes 1990; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014). 이러한 생리적 불화합성에 의한 장벽을 극복하고 다양한 야생종이 가지고 있는 유용 형질을 재배종 감자에 도입하여 새로운 감자품종을 육성하기 위해서는 순차적 교배(bridge crossing), 형질전환에 의한 유전자 도입(genetic transformation), 체세포 잡종(somatic hybridization) 등의 방법을 이용할 수 있다(Cho and Park 2014). 순차적 교배법의 경우 이용하고자 하는 감자 근연야생종의 배수성과 EBN 등을 고려하여 교잡 가능한 다른 근연야생종과의 반복적 교배를 통해 육성된 계통을 재배종 감자와 교배하는 방법으로 많은 시간과 노력이 소요되며, 형질전환에 의한 유전자 도입은 도입하고자 하는 유전자를 발굴하고 클로닝하는 과정이 필요하고 형질전환에 대한 사회적 인식과 법적인 문제가 있어 실질적으로 이용하기에 어려움이 있어 1970년대에 감자의 원형질체 분리와 배양이 성공적으로 이루어진 이래 체세포 잡종을 이용하는 방법이 현재까지도 많이 이용되고 있다(Cho and Park 2014; Tiwari et al. 2021; Tu et al. 2021).

체세포 잡종을 감자 품종 육성에 이용하기 위해서는 체세포 융합 이후 융합계통이 실질적으로 융합이 이루어졌는지 확인하고 육종에 활용할 수 있는 계통을 선발하는 과정이 필요하며, 이를 위해 다양한 생명공학적 기술들이 이용되고 있다(Cho and Park 2014). 그중 가장 많이 이용되는 것은 분자표지를 이용하는 것으로 핵 내 DNA의 염기서열 정보뿐 만 아니라 세포질의 미토콘드리아나 엽록체에 존재하는 DNA 염기서열 정보를 활용하기도 한다(Patel et al. 2011; Sarkar et al. 2011; Thieme et al. 2010; Wang et al. 2011; Yu et al. 2012). 이 중, 엽록체 DNA의 경우 현재까지 보고된 다양한 감자 야생종의 엽록체 DNA의 유전적 구성, 구조와 크기 등을 고려할 때 매우 유사한 것으로 알려져 있으나(Palmer 1991; Saski et al. 2005; Yurina and Odintosova 1998), 여전히 종 간에 유전자의 재배치에 따른 염기서열에서의 InDel, SNP, SSR 등의 다형성을 보여 이들 정보를 이용한 분자표지 개발이 가능한 것으로 보고되고 있다(Calsa Junior et al. 2004; Jheng et al. 2012; Kim and Park 2019, 2020a, 2020b; Park 2021b; Saski et al. 2005). 이에 본 연구에서는 앞서 Park (2019)에 의해 간략히 보고된 바 있는 S. brevicaule의 엽록체 전장유전체에 대한 상세 정보를 제공하고, 다른 Solanum 종들과의 비교 분석을 통해 PCR 기반의 S. brevicaule 특이적 분자마커를 개발한 결과를 제공하고자 한다.

재료 및 방법

식물재료 및 DNA 분리

엽록체 전장 유전체 분석에는 S. brevicaule (PI205394) 계통 중 하나인 SB2-1이 이용되었다. S. brevicaule 특이적인 PCR 기반의 분자마커 개발을 위해 엽록체 전장 유전체 분석을 위해 이용된 SB2-1과 더불어 추가로 S. brevicaule 계통 하나(SB2-17)가 추가되었으며, 재배종 감자품종 중 ‘서홍’(SH), ‘하령’(HR), ‘대지’(DJ), 감자품종 육성을 위한 계통 중 하나인 PT56, 그리고 총 15개의 야생종 계통, SA (S. acaule, PI310970), SB1 (S. berthaultii, PI310981), SD (S. demissum, PI218047), SC4 (S. candolleanum, PI210035), SC1 (S. cardiophyllum, PI341233), SC2 (S. commersonii, PI558050), SI (S. iopetalum, PI230459), SK (S. kurtzianum, PI578236), SJ (S. jamesii, PI578326), SM2 (S. microdontum, PI310979), SM1 (S. mochiquense, PI338616), SP (S. pinnatisectum, PI190115), SS (S. stoloniferum, PI160224), SV2 (S. vernei, PI230468), SV1 (S. verrucosum, PI160228)이 이용되었다.

모든 식물재료는 국립식량과학원 고령지농업연구소로부터 분양받아 기내식물체로 증식되어 이용되었으며, 각각의 식물재료를 대상으로 한 DNA는 기내 증식 유식물체 100mg을 채취하여 Genomic DNA Extraction kit (Plants) (RBC, New Taipei City, Taiwan)를 이용하여 추출하였다.

엽록체 전장유전체 분석

S. brevicaule 전장 유전체 분석은 S. brevicaule 계통 SB2-1을 대상으로 진행되었으며 전체 DNA를 추출하고 Macrogen (Macrogen, Seoul, South Korea)의 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA)의 플랫폼을 이용하여 진행되었다. 전체 염기서열(raw data) 정보는 CLC genome assembler package version 4.2.1 (CLC Inc, Rarhus, Denmark) 내의 CLC quality trim 프로그램을 통한 전처리 과정을 거쳐, 이후 Phred score 20 이상의 high-quality 서열만을 분석에 이용하였다. 확보된 염기서열은 같은 패키지 내의 CLC de novo assemble 프로그램을 이용한 dnaLCW 방법으로 de novo assembly하고, 이후 엽록체 유전체 유래의 contig 만을 선별하고, contig 확장 및 통합 그리고 gap-filling 과정을 통해 엽록체 전장 유전체를 완성하였다. 또한, 해당 염기서열을 완성된 엽록체 전장 유전체 서열에 mapping 하여 각 위치의 mapped read depth를 계산하였으며, S. berthaultii의 엽록체 전장 유전체(KY419708, Kim et al. 2018; Park 2017)와 BLASTZ (Schwartz et al. 2003) 분석을 시행하였다.

S. brevicaule 엽록체 전장 유전체 서열의 유전자 분석은 Geseq 프로그램을 이용하여 진행하였으며(Tillich et al. 2017), BLAST search에 기반하여 manual curation을 진행하여 최종 유전자 부위를 확인하였다. S. brevicaule 엽록체 전장 유전체의 유전자 부위는 OGDraw (OrganellarGenomeDRAW; http://ogdraw.mpimp-golm.mpg.de) 프로그램을 이용하여 유전자지도를 작성하여 표시하였다(Lohse et al. 2013).

엽록체 전장유전체의 비교

S. brevicaule의 계통발생학적 분석을 위해 S. brevicaule 엽록체 전장 유전체 염기서열을 NCBI (the National Center for Biotechnology Information)로부터 얻은 Capsicum annuum (JX270811), S. berthaultii (KY419708), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. commersonii (KM489054), S. demissum (MK036508), S. hougasii (MF471372), S. lycopersicum (NC007898), S. nigrum (KM489055), S. stoloniferum (MF471373), S. tuberosum (KM489056 및 NC008096)과 비교하여 계통수를 작성하였다. 엽록체 코딩 서열을 기반으로 Kimura 2-parameter 모델을 적용한 Maximum likelihood 방법이 이용되었으며, 1,000번의 Bootstrap 옵션으로 MEGA 6.0 프로그램을 이용하여 분석이 진행되었다(Tamura et al. 2013).

S. brevicaule 특이적 분자마커 개발을 위해 S. brevicaule 엽록체 전장 유전체 염기서열은 NCBI로부터 얻은 S. acaule (MK036506), S. bulbocastanum (DQ347958), S. chacoense (MF471371), S. commersonii (KM489054), S. demissum (MK036508), S. stolonioferum (MF471373), S. tuberosum (KM489056)의 엽록체 전장 유전체 염기서열과 EMBL (http://www.ebi.ac.uk/Tools/msa/clustalw2)의 ClustalW2에 의해 다중 정렬하여 염기서열을 비교 분석하여 S. brevicaule 특이적 영역대를 구명하였다.

PCR 기반의 분자마커 개발

S. brevicaule을 포함한 총 8종의 엽록체 전장 유전체 염기서열을 대상으로 한 다중 정렬의 결과로 구명된 S. brevicaule 특이적 SNP를 대상으로 S. brevicaule 특이성 검증이 수행되었다. 우선, 8종의 다중 정렬 결과로 구명된 SNP를 대상으로 dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html)을 이용하여 S. brevicaule 특이적으로 작용하거나 S. brevicaule를 제외한 다른 Solanum 종들에 특이적으로 작용하는 제한효소를 확인한 후, 각각의 SNP 영역을 포함하는 프라이머를 제작하였고, S. brevicaule와 S. tuberosum을 포함하여 총 21개의 유전자 계통, S. brevicaule (SB2-1 및 SB2-17), S. tuberosum (감자품종 ‘서홍(Seohong)’, ‘하령(Haryeong)’, ‘대지(Daeji)’, 및 감자품종 육성계통 PT56), S. acaule (SA), S. berthaultii (SB1), S. candolleanum (SC4), S. cardiophyllum (SC1), S. commersonii (SC2), S. demissum (SD), S. iopetalum (SI), S. kurtzianum (SK), S. jamesii (SJ), S. microdontum (SM2), S. mochiquense (SM1), S. pinnatisectum (SP), S. stoloniferum (SS), S. vernei (SV2) and S. verrucosum (SV1)을 대상으로 총 25 ul 볼륨(약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany)를 이용하여 PCR을 수행하였다. PCR의 결과는 핵산 염색용액인 RedSafe (Intron Biotechnology, Seongnam, South Korea)를 이용하여 1% agarose gel에서 확인하였으며, PCR 결과물을 대상으로 제한효소를 처리한 후, 동일한 방법으로 agarose gel에서 확인하여 PCR 기반의 S. brevicaule 특이적 분자마커 개발을 진행하였다.

결과 및 고찰

감자 야생종 S. brevicaule의 엽록체 전장 유전체

S. brevicaule의 엽록체 전장 유전체는 앞서 NGS (Next-Generation Sequencing) 기술에 의해 완성되어 간략히 보고 된 바 있다(Park 2019). 이에 더해, S. brevicaule의 엽록체 전장 유전체에 대한 세부적인 정보를 기술하자면 Illumina의 PE 표준 프로토콜에 의해 얻은 총 염기서열은 약 3,176 Mbp로, 그 평균 길이는 291.5 bp였으며, CLC genome assembler package version 4.2.1 (CLC Inc, Rarhus, Denmark) 내의 CLC quality trim 프로그램을 통한 전처리 과정을 거쳐, 이후 Phred score 20 이상의 high-quality 서열로 평균 길이 258.0 bp인 염기서열 정보 약 2,458 Mbp를 얻을 수 있었다. 이 염기서열을 같은 패키지의 CLC de novo assembler 프로그램을 이용한 dnaLCW 방법으로 de novo assembly하고, 이후 엽록체 유래의 contig만을 선별하고, contig를 확장, 통합, 그리고 gap-filling 과정을 거쳐 엽록체 전장 유전체를 완성하였다. 완성된 전체 염기서열의 길이는 155,531 bp이며(KY419708, Park 2019), aligned read의 수는 약 55만 6천 개로, 엽록체 유전체 평균 coverage는 약 897.9x로 나타났다. 전체 trimmed read를 완성된 유전체 서열에 mapping 하여 확인한 read depth는 최소 400 이상으로 확인되었다. 그 구조는 대부분의 다른 식물의 엽록체 전장 유전체 구조와 같이 원형의 이중가닥 분자로 LSC (Large Single Copy), SSC (Small Single Copy), 그리고 한 쌍의 IRa/IRb (Inverted Repeat a/b)로 이어져 있으며, 영역별로 각각 85,981 bp, 18,352 bp, 25,599 bp의 크기로 나누어져 있었다. 완성된 염기서열을 S. berthaultii 엽록체 전장 유전체 염기서열 (KY419708, Kim et al. 2018; Park 2017)과 비교하고 BLASTZ 분석(Schwartz et al. 2003)을 실시한 결과 유사 구조를 확인할 수 있었다(Fig. 1). S. brevicaule의 엽록체 전장 유전체 전체 염기서열을 NCBI에서 Blastn 분석 결과 S. spegazzinii (MH021562), S. kurtzianum (MH021495)와 각각 99.99%, 99.89%의 높은 유사도를 보였으며, Solanum 속의 다른 종들과 비교해 보면 전체 길이는 모두 유사했고, GC 비율도 37.87%로 거의 비슷하게 나타났다(Table 1).

Table 1 . Comparative analysis of the chloroplast genome sequence of S. brevicaule with those of nine Solanaceae species.

SpeciesAccession no.Total Length (bp)GC content (%)Total no. of genesNo. of tRNANo. of rRNAReference
S. brevicauleMK036507155,53137.87135364In this study
S. demissumMK036508155,55837.87135364Cho et al. (2019)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*Data have been partially adopted from Park (2021b)..

Figure 1. Assembly result of the complete chloroplast genome sequence of S. brevicaule (MK036507). Four representative contigs of the chloroplast genome of S. brevicaule and comparison with the corresponding regions of the chloroplast genome of S. berthaultii (KY419708; Kim et al. 2018) are combined. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientations, respectively

S. brevicaule의 엽록체 전장 유전체에는 105개의 단백질 코딩, 45개의 tRNA, 8개의 rRNA를 포함해 총 158개의 유전자가 분포하고 있었으며, 그중 11개의 단백질 코딩 유전자, 9개의 tRNA, 4개의 rRNA를 포함하는 24개가 한 쌍의 IR 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 59.2%가 코딩 영역으로 평균 길이가 약 583.0 bp로, 이 중 단백질 코딩 유전자, tRNA, rRNA가 각각 평균 764.6 bp, 62.1 bp, 1130.8 bp의 크기로 51.6%, 1.8%, 5.8%의 비율로 분포되어 있었으며, Solanum 속의 다른 종들과 비교해 보면 유전자, tRNA, rRNA 등의 개수, 순서 등이 모두 유사한 것으로 나타났다(Table 1)(Cho et al. 2016, 2019; Cho and Park 2016; Kim et al. 2018; Kim and Park, 2019, 2020a, 2020b).

Figure 2. Gene map of the chloroplast genome of S. brevicaule. Genes on the outside and inside of the map are transcribed in the clockwise and counterclockwise directions, respectively

엽록체 전장유전체 비교 및 계통수

S. brevicaule의 엽록체 전장 유전체는 계통수 작성을 위해 Solanaceae 과에 속하는 다른 11종의 엽록체 전장 유전체의 코딩 서열과 비교 분석되었다(Fig. 3). 분석에 이용된 Maximum likelihood 방법은 체계적인 분류의 결과를 보여주었으며, 높은 bootstrap 값은 계통수의 결과를 뒷받침해 주었다. 결과적으로 S. brevicaule는 계통수에서 S. tuberosum을 포함한 다수의 Solanum 종들과 매우 근접한 수준으로 같은 그룹으로 분류되었다.

Figure 3. Maximum-likelihood phylogenetic tree of S. brevicaule with 11 species belonging to the Solanaceae family based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. The figure has been partially adopted from Park (2019)

S. brevicaule의 엽록체 전장 유전체의 염기서열 정보를 이용하여 S. brevicaule와 다른 Solanum 속에 속하는 종들을 구분할 수 있는 S. brevicaule 특이적 분자마커를 개발하기 위해 EMBL의 ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 S. brevicaule 및 다른 7개 Solanum 종의 엽록체 전장 유전체 전체를 대상으로 다중 정열을 수행하였다(Fig. 4). 그 결과, 앞서 보고된 바와 같이 다수의 InDel과 SNP 영역을 발견할 수 있었으며(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b, Park 2021b), S. brevicaule 특이적인 InDel은 삽입과 삭제 각각 4개, 2개씩 총 6개의 영역으로 나타났으며, SNP는 총 27개를 확인하였다. InDel 영역 6개 중 5개는 앞서 다른 종들의 InDel에서 주로 확인된 바와 같이 비코딩 영역에 분포하고 있었으며, SNP는 27개 중 13개는 비코딩 영역 14개는 코딩 영역에 분포하고 있었다(Cho and Park 2016; Chung et al. 2006; Kim and Park 2019, 2020b; Park 2021b).

Figure 4. Multiple alignment of the sequences on the intergenic or intragenic regions containing SNPs used to develop the PCR-based markers. SA11, SB2-1, SD9, Stub, Scmr, Sblb, Scha, and Ssto indicate the chloroplast genome sequences of S. acaule (MK036506; Park 2021a), S. brevicaule (MK036507; In this study), S. demissum (MK036508; Cho et al. 2019), S. tuberosum (KM489056; Cho et al. 2016), S. commersonii (KM489054; Cho et al. 2016), S. bulbocastanum (DQ347958; Daniell et al. 2006), S. chacoense (MF471371; Kim and Park 2019), and S. stoloniferum (MF471373; Kim and Park 2020a), respectively. They are listed from top to bottom in each region of the SNPs. The regions of the SNPs detected on that of S. brevicaule are highlighted and underlined. Restriction sites are indicated in red and bold font

S. brevicaule 특이적 분자마커 개발

앞서 확인된 S. brevicaule 특이적인 InDel과 SNP를 분자마커의 개발에 활용하고자 하였으나, InDel 영역의 경우 InDel 특이적 primer를 제작하여 PCR을 통한 S. brevicaule 특이적인 SCAR (Sequence Characterized Amplified Region) 마커의 개발에 어려움이 있었다. 일반적으로 InDel이 존재하는 영역에서 primer를 제작하여 PCR을 하면 InDel 영역의 염기서열 차이에 의해 발생하는 다형성에 의한 효과적인 분자마커 개발이 가능하나(Cho et al. 2015; Garcia-Lor et al. 2013; Yamaki et al. 2013), 본 연구에서는 삽입 또는 삭제 염기서열의 차이가 크지 않거나 InDel 영역을 포함한 인근 염기서열에서 반복서열이 존재하고 있기 때문인 것으로 추정된다(Kim and Park 2020b). 따라서, 본 연구에서는 앞서 확인된 SNP를 이용하여 SNP 영역 특이적으로 작용할 수 있는 제한효소의 유무를 확인한 후 SNP 영역이 포함되도록 primer를 제작하여 PCR 진행 후 분석 대상의 모든 Solanum 종들에서 PCR로 증폭된 DNA 단편에 제한효소를 처리하여 얻을 수 있는 CAPS (Cleaved Amplified Polymorphism Sequence; Konieczny and Ausubel 1993) 마커를 개발하게 되었다. CAPS 마커는 Solanum 종들을 대상으로 한 종 구분 또는 종 내 유전자형의 선발 등에 많이 활용되고 있으며(Kim and Park 2020a, 2020b; Park et al. 2005; Smilde et al. 2005; van der Voort et al. 1999), 다른 작물에서도 같은 목적으로 많이 이용되고 있다(Caranta et al. 1999; Konovalov et al. 2005; Lee et al. 2008; Pettenkofer et al. 2020; Uncu et al. 2015; Wang et al. 2017). 본 연구에서는 최종적으로 SNP를 이용한 S. brevicaule 특이적인 3개의 CAPS 마커가 개발되었는데, 첫 번째 분자마커(SB2_SNP_3)는 rbcL 유전자 내에 존재하는 SNP가 HpaII 제한효소에 의해 S. brevicaule만을 특이적으로 절단하여 S. brevicaule 특이적인 결과를 나타냈으며(Table 2, Fig. 5A), 두 번째(SB2_SNP_5)와 세 번째(SB2_SNP_8) 분자마커는 각각 rpl36-rps8과 ndhI-ndhA 유전자 간 영역에 존재하는 SNP가 각각 HphI과 HinfI 제한효소에 의해 S. brevicaule 비특이적으로 S. brevicaule를 제외한 다른 Solanum 종들만을 절단하여 S. brevicaule 특이적, 그리고 S. brevicaule 비특이적인 결과를 모두 나타냈다(Table 2, Fig. 5B, Fig. 5C).

Table 2 . Primers and restriction enzymes for generating S. brevicaule-specific markers.

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SB2_SNP_3rbcL(Intragenic)FAATACCATGGTCTAATAATC688HpaII
RTAATAGTACATCCCAACAGG
SB2_SNP_5rpl36-rps8(Intergenic)FAATAACTCCCTTTGGTATTC653HphI
RTGTGTTATATCTGGTAATCC
SB2_SNP_8ndhI-ndhA(Intergenic)FTACGGAATAGAAAGATTCC680HinfI
RATTCATGAACTAATGTACTC

aF and R indicate forward and reverse strand of primers..

bThe expected size of PCR fragments is measured on the basis of the sequence of S. brevicaule..

cRestriction enzymes generating S. brevicaule-specific markers..

Figure 5. PCR-based markers for the discrimination of S. brevicaule from other Solanum species. A: SB2_SNP_3. B: SB2_SNP_5. C: SB2_SNP_8. The three markers all generated bands positively and/or negatively specific to S. brevicaule. Red and yellow allows indicate positive and negative bands on S. brevicaule, respectively. SB2-1 and SB2-17 indicate two different lines of S. brevicaule (PI205394). M, SH, HR, DJ, PT56, SA, SB1, SD, SC4, SC1, SC2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate a size marker ladder, the potato varieties ‘Seohong’, ‘Haryeong’, ‘Daeji’, a potato breeding line ‘PT56’, S. acaule (PI310970), S. berthaultii (PI310981), S. demissum (PI218047), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S. microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively

다양한 Solanum 종들을 대상으로 분자마커를 이용하여 유전자형을 확인하는 것은 다양한 야생종들을 이용한 감자의 신품종 육성뿐 만 아니라 진화학적 연구에도 유용하게 활용될 수 있다(Bohs and Olmstead 1997; Hosaka and Sanetomo 2012). 특히, 감자의 신품종 육성에 이용할 수 있는 야생종들의 배수성과 EBN의 다양성으로 인한 교잡불친화성을 극복하기 위해 체세포잡종이 이용될 경우 체세포잡종 과정에서 핵 내 염색체의 새로운 조합이나 세포질의 엽록체와 미토콘드리아 게놈의 무작위적 배분이 발생하여 효율적인 육종의 진행을 위해서는 체세포잡종 개체들을 대상으로 분자마커를 이용한 효율적인 유전자형의 선발이 필요하다(Aversano et al. 2009; Bastia et al. 2000; Cho et al. 2016; Kim et al. 2018; Scotti et al. 2003). 대체로, 체세포잡종에 의해 핵 내 게놈과 미토콘드리아 게놈의 경우 높은 빈도의 재조합이 발생하는 것으로 알려져 있으며, 엽록체 게놈의 경우 재조합 빈도가 매우 낮거나 무작위로 한쪽친만의 게놈이 전달되는 것으로 알려져 있다(Lössl et al. 2000). 이러한 특성은 Solanum 종에서도 일반적으로 관찰되고 있으며(Chen et al. 2013; Cho et al. 2016; Smyda-Dajmund et al. 2016), 다른 식물종에서도 나타나는 현상으로 알려져 있다(Mohapatra et al. 1998; Xiang et al. 2004). 하지만, 엽록체 게놈의 경우에도 양친의 게놈이 모두 전달되는 경우도 있어 정확한 유전자형의 구별이 필요하다(Wang et al. 2011). 따라서, 본 연구에서 개발된 SNP 기반의 CAPS 마커는 S. brevicaule와 S. tuberosum을 구별하는데 이용될 수 있을 뿐만 아니라, 체세포잡종을 이용한 육종에서 엽록체 게놈의 유전자형을 구별하고 선발하는데 이용되어 S. brevicaule을 이용한 감자의 신품종 육성에 기여할 것이다.

적 요

Solanum brevicaule는 괴경을 형성하는 감자 야생종 중의 하나로 감자재배에서 문제가 되는 중요한 몇 가지 병에 대해 저항성 보여 감자의 신품종 육성을 위한 재료로 이용될 수 있다. 하지만, 본 연구에서 이용된 S. brevicaule의 EBN이 2인 사실로 인하여 재배종 감자와의 생식에 의한 종자생산에 장벽이 되고 있다. 본 연구에서는 차세대 유전체 기술에 의해 완성된 S. brevicaule의 엽록체 전장 유전체와 다른 7개 Solanum 종의 엽록체 전장 유전체를 비교하여 S. brevicaule를 다른 Solanum 종과 구별할 수 있는 Solanum 종 특이적인 분자마커를 개발하였다. S. brevicaule의 엽록체 전장 유전체의 총길이는 155,531 bp였으며, Blastn을 통해 S. spegazzinii 및 S. kurtzianum과 각각 99.99% 및 99.89%의 유사도를 확인할 수 있었다. 또한, 그 구조와 유전자의 구성이 다른 Solanum 종과 매우 유사하였으며, 계통수 분석에서도 다른 Solanum 종들과 매우 가까운 유연관계를 가지는 것으로 확인되었다. 엽록체 전장 유전체 다중 정렬에서는 총 27개의 S. brevicaule 특이적인 SNP 영역이 확인되었으며, 이들 중 세 개의 SNP 영역을 대상으로 최종적으로 S. brevicaule 특이적인 PCR 기반의 CAPS 분자마커를 개발하였다. 본 연구를 통해 얻은 S. brevicaule의 엽록체 전장 유전체와 S. brevicaule 특이적인 분자마커의 결과는 향후 Solanum 종을 대상으로 한 진화와 S. brevicaule를 이용한 감자품종 육성 연구에 기여를 할 수 있을 것이다.

사 사

이 성과는 정부(과학기술정보통신부)의 재원으로 한국연구재단의 지원을 받아 수행된 연구임(No. NRF-2021R1F1A1045981).

Fig 1.

Download
Figure 1.Assembly result of the complete chloroplast genome sequence of S. brevicaule (MK036507). Four representative contigs of the chloroplast genome of S. brevicaule and comparison with the corresponding regions of the chloroplast genome of S. berthaultii (KY419708; Kim et al. 2018) are combined. Blue and yellow bars indicate contig matching with the reference sequence in forward and reverse orientations, respectively
Journal of Plant Biotechnology 2022; 49: 30-38https://doi.org/10.5010/JPB.2022.49.1.030

Fig 2.

Download
Figure 2.Gene map of the chloroplast genome of S. brevicaule. Genes on the outside and inside of the map are transcribed in the clockwise and counterclockwise directions, respectively
Journal of Plant Biotechnology 2022; 49: 30-38https://doi.org/10.5010/JPB.2022.49.1.030

Fig 3.

Download
Figure 3.Maximum-likelihood phylogenetic tree of S. brevicaule with 11 species belonging to the Solanaceae family based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. The figure has been partially adopted from Park (2019)
Journal of Plant Biotechnology 2022; 49: 30-38https://doi.org/10.5010/JPB.2022.49.1.030

Fig 4.

Download
Figure 4.Multiple alignment of the sequences on the intergenic or intragenic regions containing SNPs used to develop the PCR-based markers. SA11, SB2-1, SD9, Stub, Scmr, Sblb, Scha, and Ssto indicate the chloroplast genome sequences of S. acaule (MK036506; Park 2021a), S. brevicaule (MK036507; In this study), S. demissum (MK036508; Cho et al. 2019), S. tuberosum (KM489056; Cho et al. 2016), S. commersonii (KM489054; Cho et al. 2016), S. bulbocastanum (DQ347958; Daniell et al. 2006), S. chacoense (MF471371; Kim and Park 2019), and S. stoloniferum (MF471373; Kim and Park 2020a), respectively. They are listed from top to bottom in each region of the SNPs. The regions of the SNPs detected on that of S. brevicaule are highlighted and underlined. Restriction sites are indicated in red and bold font
Journal of Plant Biotechnology 2022; 49: 30-38https://doi.org/10.5010/JPB.2022.49.1.030

Fig 5.

Download
Figure 5.PCR-based markers for the discrimination of S. brevicaule from other Solanum species. A: SB2_SNP_3. B: SB2_SNP_5. C: SB2_SNP_8. The three markers all generated bands positively and/or negatively specific to S. brevicaule. Red and yellow allows indicate positive and negative bands on S. brevicaule, respectively. SB2-1 and SB2-17 indicate two different lines of S. brevicaule (PI205394). M, SH, HR, DJ, PT56, SA, SB1, SD, SC4, SC1, SC2, SI, SK, SJ, SM2, SM1, SP, SS, SV2, and SV1 indicate a size marker ladder, the potato varieties ‘Seohong’, ‘Haryeong’, ‘Daeji’, a potato breeding line ‘PT56’, S. acaule (PI310970), S. berthaultii (PI310981), S. demissum (PI218047), S. candolleanum (PI210035), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. iopetalum (PI230459), S. kurtzianum (PI578236), S. jamesii (PI578326), S. microdontum (PI310979), S. mochiquense (PI338616), S. pinnatisectum (PI190115), S. stoloniferum (PI160224), S. vernei (PI230468) and S. verrucosum (PI160228), respectively
Journal of Plant Biotechnology 2022; 49: 30-38https://doi.org/10.5010/JPB.2022.49.1.030

Table 1 . Comparative analysis of the chloroplast genome sequence of S. brevicaule with those of nine Solanaceae species.

SpeciesAccession no.Total Length (bp)GC content (%)Total no. of genesNo. of tRNANo. of rRNAReference
S. brevicauleMK036507155,53137.87135364In this study
S. demissumMK036508155,55837.87135364Cho et al. (2019)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*Data have been partially adopted from Park (2021b)..

Table 2 . Primers and restriction enzymes for generating S. brevicaule-specific markers.

Marker nameRegionSaPrimer sequenceSize (bp)bREc
SB2_SNP_3rbcL(Intragenic)FAATACCATGGTCTAATAATC688HpaII
RTAATAGTACATCCCAACAGG
SB2_SNP_5rpl36-rps8(Intergenic)FAATAACTCCCTTTGGTATTC653HphI
RTGTGTTATATCTGGTAATCC
SB2_SNP_8ndhI-ndhA(Intergenic)FTACGGAATAGAAAGATTCC680HinfI
RATTCATGAACTAATGTACTC

aF and R indicate forward and reverse strand of primers..

bThe expected size of PCR fragments is measured on the basis of the sequence of S. brevicaule..

cRestriction enzymes generating S. brevicaule-specific markers..

References

  1. Aversano R, Savarese S, De Nova JM, Frusciante L, Punzo M, Carputo D (2009) Genetic stability at nuclear and plastid DNA level in regenerated plants of Solanum species and hybrids. Euphytica 165: 353-361
    CrossRef
  2. Bastia T, Carotenuto N, Basile B, Zoina A, Cardi T (2000) Induction of novel organelle DNA variation and transfer of resistance to frost and Verticillium wilt in Solanum tuberosum through somatic hybridization with 1EBN S. commersonii. Euphytica 116: 1-10
  3. Bohs L, Olmstead RG (1997) Phylogenetic relationships in Solanum (Solanaceae) based on ndhF sequences. Syst Bot 22: 5-17
    CrossRef
  4. Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46: 366-373
    Pubmed CrossRef
  5. Caranta C, Thabuis A, Palloix A (1999) Development of a CAPS marker for the Pvr4 locus: A tool for pyramiding potyvirus resistance genes in pepper. Genome 42: 1111-1116
    Pubmed
  6. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126: 1861-1872
    Pubmed CrossRef
  7. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35: 2113-2123
    Pubmed CrossRef
  8. Cho K-S, Cho J-H, Park Y-E, Park T-H (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4: 1800-1802
  9. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29: 154-161
  10. Cho K-S, Park T-H (2014) Potato breeding via protoplast fusion. J Plant Biotechnol 41: 65-72
    CrossRef
  11. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57: 69-78
    CrossRef
  12. Cho K-S, Yun B-K, Yoon Y-H, Hong S-Y, Mekapogu M, Kim K-H, Yang T-J (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10
    Pubmed KoreaMed CrossRef
  13. Chung YS, Holmquist K, Spooner DM, Jansky SH (2011) A test of taxonomic and biogeographic predictivity: resistance to soft rot in wild relatives of cultivated potato. Ecol Epidemiol 101: 205-212
    Pubmed CrossRef
  14. Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25: 1369-1379
  15. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112: 1503-1518
    Pubmed CrossRef
  16. Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111: 1-19
  17. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005). The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop, pp 107
  18. Hardigan MA, Bamberg J, Buell CR, Douches DS (2015) Taxonomy and genetic differentiation among wild and cultivated germplasm of Solanum sect. Petota. Plant Genome 8: 1
    Pubmed CrossRef
  19. Hawkes JG (1990). The potato: Evolution, biodiversity and genetic resources. Belhaven Press, London, UK
  20. Hosaka K, Sanetomo R (2012) Development of a rapid identification method for potato cytoplasm and its use for evaluating Japanese collections. Theor Appl Genet 125: 1237-1251
    Pubmed CrossRef
  21. Jackson MT, Hawkes JG, Male-Kayiwa BS, Wanyera N (1988) The importance of the Bolivian wild potato species in breeding for Globodera pallida resistance. Plant Breed 101: 261-268
    CrossRef
  22. Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C (2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids. Plant Sci 190: 62-73
    Pubmed CrossRef
  23. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45: 207-216
  24. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46: 79-87
  25. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47: 131-140
  26. Kim S, Park T-H (2020b) Development of Solanum hougasii-specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47: 141-149
  27. Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4: 403-410
    Pubmed CrossRef
  28. Konovalov F, Toshchakova E, Gostimsky S (2005) A CAPS marker set for mapping in linkage group III of pea (Pisum sativum L.). Cell Mol Biol Lett 10: 163-171
    Pubmed
  29. Lee J, Yoon JB, Park HG (2008) A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol Breeding 21: 95-104
    CrossRef
  30. Lohse M, Drechsel O, Kahlau S, Bock R (2013) Organellar GenomeDRAW - a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic Acids Res 41: W575-W581
    Pubmed KoreaMed CrossRef
  31. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116: 221-230
  32. Miller JT, Spooner DM (1999) Collapse of species boundaries in the wild potato Solanum brevicaule complex (Solanaceae, S. sect. Petota): molecular data. Pl Syst Evol 214: 103-130
  33. Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17: 814-818
    Pubmed CrossRef
  34. Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60: 105-113
  35. Palmer JD (1991) Plastid chromosomes: structure and evolution. In: Bogorad K. Vasil (ed) The molecular biology of plastids. Academic Press, San Diego, USA, pp 5-53
    CrossRef
  36. Park T-H (2017) The complete chloroplast genome of Solanum berthaultii, one of the potato wild relative species. Mitochondr DNA Part B 2: 88-89
    Pubmed KoreaMed CrossRef
  37. Park T-H (2019) Complete chloroplast genome of the wild diploid potato relative, Solanum brevicaule. Mitochondr DNA Part B 4: 4159-4160
  38. Park T-H (2021a) Complete chloroplast genome of the wild diploid potato relative, Solanum acaule. Mitochondr DNA Part B 6: 1189-1191
  39. Park T-H (2021b) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48: 18-25
  40. Park T-H, Gros J, Sikkema A, Vleeshouwers VGAA, Muskens M, Allefs S, Jacobsen E, Visser RGF, van der Vossen EAG (2005) The late blight resistance locus Rpi-blb3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on chromosome 4 of potato. Mol Plant-Microb Interact 18: 722-729
  41. Patel D, Power J, Anthony P, Badakshi F, Heslop-Harrison J, Davey M (2011) Somatic hybrid plants of Nicotiana x sanderae + N. debneyi with fungal resistance to Peronospora tabacina. Ann Bot 108: 809-819
    Pubmed KoreaMed CrossRef
  42. Pettenkofer T, Finkeldey R, Müller M, Krutovsky KV, Vornam B, Leinemann L, Gailing O (2020) Development of novel Quercus rubra chloroplast genome CAPS markers for haplotype indentification. Silvae Genetica 69: 78-85
  43. Sarkar D, Tiwari J, Sharma S, Sharma Poonam S, Gopal J, Singh B, Luthra S, Pandey S, Pattanayak D (2011) Production and characterization of somatic hybrids between Solanum tuberosum L. and S. pinnatisectum Dun. Plant Cell Tiss Org Cult 107: 427-440
    CrossRef
  44. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59: 309-322
    CrossRef
  45. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13: 103-107
    Pubmed KoreaMed CrossRef
  46. Scotti N, Monti L, Cardi T (2003) Organelle DNA variation in parental Solanum spp. genotypes and nuclear-cytoplasmic interactions in Solanum tuberosum (+) S. commersonii somatic hybrid-backcross progeny. Theor Appl Genet 108: 87-94
    Pubmed CrossRef
  47. Smilde WD, Brigneti G, Jagger L, Perkins S, Jones JDG (2005) Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theor Appl Genet 110: 252-258
    Pubmed CrossRef
  48. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35: 1345-1358
    Pubmed KoreaMed CrossRef
  49. Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot Rev 80: 283-383
    CrossRef
  50. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30: 2725-2729
  51. Thieme R, Rakosy-Tican E, Nachtigall M, Schubert J, Hammann T, Antonova O, Gavrilenko T, Heimbach U, Thieme T (2010) Characterization of the multiple resistance traits of somatic hybrids between Solanum cardiophyllum Lindl. and two commercial potato cultivars. Plant Cell Rep 29: 1187-1201
    Pubmed CrossRef
  52. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45: W6-W11
    Pubmed KoreaMed CrossRef
  53. Tiwari JK, Rawat S, Luthra SK, Zinta R, Sahu S, Varshney S, Kumar V, Dalamu D, Mandadi N, Kumar M, Chakrabarti SK, Rao AR, Rai A (2021) Genome sequence analysis provides insights on genomic variation and late blight resistance genes in potato somatic hybrid (parents and progeny). Mol Biol Rep 48: 623-635
    Pubmed CrossRef
  54. Tu W, Dong J, Zou Y, Zhao Q, Wang H, Ying J, Wu J, Du J, Cai X, Song B (2021) Interspecific potato somatic hybrids between Solanum malmeanum and S. tuberosum provide valuable resources for freezing-tolerance breeding. Plant Cell Tiss Organ Cult 147: 73-83
    CrossRef
  55. Uncu AT, Celik I, Devran Z, Ozkaynak E, Frary A, Frary A, Doganlar S (2015) Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper. Euphytica 206: 393-399
    CrossRef
  56. van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Klein-Lankhorst R, Stiekema W, Baulcombe D, Bakker J (1999) Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol Plant-Microb Interact 18: 722-729
  57. Wang Y, Liu W, Xu L, Wang Y, Chen Y, Luo X, Tang M, Liu L (2017) Development of SNP markers based on transcriptome sequences and their application in germplasm identification in radish (Raphanus sativus L.). Mol Breeding 37: 26
    CrossRef
  58. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30: 1811-1821
    Pubmed CrossRef
  59. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47: 680-688
    Pubmed CrossRef
  60. Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T, Kubo T, Kurata N, Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63: 246-254
    Pubmed KoreaMed CrossRef
  61. Yu Y, Li Z, Wang P, Xiang F (2012) Genetic and biochemical characterization of somatic hybrids between Bupleurum scorzonerifolium and Gentianopsis paludosa. Protoplasma 249: 1029-1035
    Pubmed CrossRef
  62. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34: 5-22
JPB
Vol 51. 2024
Current Issue Archives

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download