Research Article

Split Viewer

J Plant Biotechnol 2017; 44(3): 235-242

Published online September 30, 2017

https://doi.org/10.5010/JPB.2017.44.3.235

© The Korean Society of Plant Biotechnology

Molecular markers based on chloroplast and nuclear ribosomal DNA regions which distinguish Korean-specific ecotypes of the medicinal plant Cudrania tricuspidata Bureau

Soo Jin Lee, Yong-Wook Shin, Yun-Hee Kim*, and Shin-Woo Lee*

Department of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Korea,
Department of Biology Education, College of Education, IALS, Gyeongsang National University, Jinju, Korea

Correspondence to : e-mail: shinwlee@gntech.ac.kr
e-mail: cefle@gnu.ac.kr

Received: 28 August 2017; Revised: 7 September 2017; Accepted: 20 September 2017

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Cudrania tricuspidata Bureau is a widely-used, medicinal, perennial and woody plant. Obtaining information about the genetic diversity of plant populations is highly important with regard toconservation and germplasm utilization. Although C. tricuspidata is an important medicinal plant species registered in South Korea, no molecular markers are currently available to distinguish Korean-specific ecotypes from other ecotypes from different countries.

In this study, we developed single nucleotide polymorphism (SNP) markers derived from the chloroplast and nuclear genomic sequences, which serve to to identify distinct Korean- specific ecotypes of C. tricuspidata via amplification refractory mutation system (ARMS)-PCR and high resolution melting (HRM) curve analyses. We performed molecular authentication of twelve C. tricuspidata ecotypes from different regions using DNA sequences in the maturaseK (MatK) chloroplast intergenic region and nuclear ribosomal DNA internal transcribed spacer (ITS) regions. The SNP markers developed in this study are useful for rapidly identifying specific C. tricuspidata ecotypes from different regions.

Keywords ARMS-PCR, chloroplast genome, HRM curve analysis, single nucleotide polymorphisms, nuclear ribosomal DNA internal transcribed spacers

Cudrania tricuspidata Bureau is a deciduous tree found in Korea, China, Japan, and Eastern Russia. The root bark and cortex of C. tricuspidata have long been used as crude drug materials, yielding one of the most ubiquitous traditional herbal medicines in East Asia (Hano et al. 1990). The beneficial effects of these plants primarily include their anti-tumor (Zou et al. 2004), anti-inflammatory (Park et al. 2006), and cytotoxic activities (Park 2005). Understanding the genetic variation, structure, and phylogenetic characteristics of this useful plant species is important for its conservation and sustainable use, but molecular markers to classify the genetic diversity in C. tricuspidata have not yet been reported.

DNA markers based on the chloroplast genome can be used to quickly and reliably classify specific plant species, cultivars, or ecotypes due to their unique features. Chloroplasts are maternally inherited intracellular plant organelles with specific functions that contain their own genomes (Reboud 1994). A plant cell can contain up to 1,000 copies of the chloroplast genome, which is over 100-times greater than the number of copies of the nuclear genome found in plant cells (Pyke 1999). Therefore, a target region in the chloroplast genome can be amplified by PCR more easily than a target region in the nuclear genome using trace amounts of genomic DNA. Most gene sequences are also highly conserved in various plant species, but considerable amounts of nucleotide variation have been identified in chloroplast intergenic spacer regions at the interspecies level and (rarely) at the intraspecies level (Wolfe et al. 2004). In addition, nuclear ribosomal DNA internal transcribed spacer (ITS) sequences have recently been used to develop molecular markers to identify various medicinal plant species originating from Korea and China (Yang et al. 2012; Han et al. 2016). Hybrids may also be produced via cross-fertilization when similar species or ecotypes are cultivated in the same field. Genetic markers based only on chloroplast intergenic sequences are likely to be insufficient for identifying specific species among hybrid plants, since chloroplast genomes are inherited maternally, whereas nuclear genomes are inherited by hybridization; thus ITSs are at the forefront of DNA barcoding research.

Sequence-based DNA markers have practical advantages for authenticating plant species, as they can be used to differentiate similar medicinal plants in a time- and cost-effective manner (Jung et al. 2014). Various DNA markers based on random polymorphic sequences have been used to classify similar medicinal plant species, including single nucleotide polymorphisms (SNPs) (Kim et al. 2013; Han et al. 2016). While the use of highly variable sequences from the plastid and nuclear genomes is important for barcoding, molecular markers to classify genetic diversity in C. tricuspidata have not yet been reported. Sequence analysis of PCR products via amplification refractory mutation system (ARMS) is a simple, timesaving, effective method for SNP genotyping. The main advantage of ARMS is that the amplification and authentication steps are combined, such that the presence of an amplified product indicates the presence of a particular allele. High resolution melting (HRM) curve analysis was recently developed to detect SNPs located on amplicons (Ririe et al. 1997; Gundry et al. 2003; Liu et al. 2012). In this method, amplified DNA strands are melted apart via a gradual increase in temperature, and different melting patterns are detected based on subtle changes in fluorescence generated by double-stranded DNA-binding dyes. The rapid, inexpensive detection of a broad range of SNPs via HRM analysis makes this technique suitable for genotype discrimination (Lehmensiek et al. 2008) and genetic mapping (Chagne et al. 2008); various cultivars have been identified using SNPs via these technique (Mackay et al. 2008).

Therefore, in this study, we developed an effective method for identifying Korean-specific C. tricuspidata ecotypes using markers derived from plastid and nuclear DNA sequences and demonstrated that marker polymorphisms can be efficiently detected by ARMS-PCR and HRM analysis. This is the first report of the development and characterization of Korean-specific C. tricuspidata ecotypes using SNP markers derived from plastid and nuclear DNA sequences. Our data from DNA barcoding analysis using chloroplast and nuclear genomic sequence regions (MatK and ITS) reveal inter- and intraspecific variation among C. tricuspidata ecotypes.

Plant materials

Twelve Cudrania tricuspidata Bureau ecotypes from different regions were used in this study (Table 1 and Fig. 1). Sample identities were confirmed by comparing sequences from the chloroplast MatK and nuclear ITS regions in these samples with those in NCBI GenBank: MatK (accession number JF317421.1) and ITS (accession number JF980330.1). All plant materials were assigned identification numbers and preserved at the Gyeongnam National University of Science and Technology (Jinju, Korea)(Table 1).

Table 1 List of plant materials used in this study

Identification codeScientific nameCultivated regions (sources)Identified originMaterial used
2014-30Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth KoreaLeaves
2014-31Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth KoreaLeaves/stems
2014-33Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2014-34Cudrania tricuspidata BureauSacheon, Gyeongnam, KoreaSouth KoreaLeaves
2014-36Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth KoreaLeaves
2014-37Cudrania tricuspidata BureauUiryeong, Gyeongnam, KoreaSouth KoreaLeaves
2014-38Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2014-39Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth KoreaStems
2014-41Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaChinaLeaves
2014-42Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2016-10Cudrania tricuspidata BureauMiryang, Gyeongnam, KoreaChinaLeaves/stems
2016-47Cudrania tricuspidata BureauCommercial herbsChinaDried stems

Fig. 1.

Sampling locations of 12 Cudrania tricuspidata Bureau ecotypes (Google Maps)


Genomic DNA extraction

Genomic DNA was isolated using a Plant DNA Extraction kit (GeneAll Co. Exgene™, Seoul, Korea) from plant samples that had been snap frozen in liquid nitrogen and ground into a powder. The concentration and purity of the DNA samples were measured using a micro-spectrophotometer (BioPrince, SD-2000, Gangwon, South Korea). All samples had A260/A280 absorbance ratios >1.8 and A234/A260 ratios of 0.5 ~ 0.8.

PCR amplification and nucleotide sequence analyses

Primers were designed based on sequences in the NCBI database to specifically amplify sequences from the MatK and ITS regions of the plastid and nuclear genomes, respectively (Table 2A). The sequences of each primer pair are provided in Table 2A. PCR amplification was performed using i-pfu DNA polymerase from iNtRON Co. (Seoul, Korea), which minimizes the introduction of mutations during the amplification reaction. The amplicons were sent to Solgent Co., Seoul, Korea for sequencing analysis without cloning the amplified fragments to avoid introducing any mutations. Each experiment was repeated at least three times, and all amplified fragments were sequenced in both directions.

Table 2 Primer sequences used in this study

A. SNP analysis
GenePrimers   Sequences (5’–3’)Tm (°C)Size (bp)

MatKMatK forwardATTGCGGTTTTTTCTTCACGACT57.8988
MatK reverseATGATTGACCAGATCGTTGATGC57.4

ITSITS forwardTCCGTAGGTGAACCTGCGG58.0762
ITS reverseGCCGTTACTAGGGGAATCCTTG57.6

B. ARMS-PCR analysis

OriginPrimers   Sequences (5’–3’)Tm (°C)Size (bp)

South KoreaMatk-specific forwardACGATTAACATCTTCTGGTGA55.5537
Matk-specific reverseGATTTCTGCATATACACGCATAG59.3

ITS-specific forwardGCCAAGTGCGTGCCGCTCATC68.7458
ITS-specific reverseCGACAACCACCTTTTGCCTCA60.2

ChinaMatk-specific forwardACGATTAACATCTTCTGGAGG57.4537
Matk-specific reverseGATTTCTGCATATACACGCAGAT59.3

ITS-specific forwardGCCAAGTGCGTGCCGCTCTGT66.2458
ITS-specific reverseCGACAACCACCTTTTGTCACG57.5

C. HRM analysis

GenePrimers   Sequences (5’–3’)Tm (°C)Size (bp)

MatKMatK forwardGTGTGGTCTCAACCAGGAAG57.2197
MatK reverseGCCAACGATCCAATCAGAGG57.7

ITSITS forwardTCCCGTGAACCATCGAGTC58.2205
ITS reverseGCACGTGACAAGGGACTTG58.1

Construction of a dendrogram and genetic distance analysis

A dendrogram describing the genetic distances between the ecotypes based on their MatK and ITS sequences was constructed using the Mega 6.0 statistical program. Pairwise comparisons between species were performed by measuring genetic distances using the Tamura-Nei distance method. A genetic distance matrix was used for cluster analysis via the neighbor-joining method (Tamura et al. 2013).

ARMS-PCR

An ARMS-PCR assay was developed to investigate samples collected from different locations (Table 1). Plastid DNA- specific primer sets for each ecotype were designed based on the intergenic sequence of the MatK region (Table 2B). The relative positions and sizes of the targeted species- specific amplicons are shown in Fig. 3A. Ecotype-specific amplification of the ITS region was performed using a forward primer based on a sequence in ITS I and a reverse primer based on a sequence in ITS II (Table 2B and Fig. 4A). ARMS primers were designed essentially as described by Newton et al. (1989), and PCR analysis was carried out using Exprime Taq Premix (Genet Bio, Seoul, Korea).

HRM curve analysis

A primer set was designed based on the intergenic sequences of the MatK and ITS regions to develop a plastid sequence HRM assay for identifying specific plant ecotypes. HRM analysis was performed to detect polymorphisms in this marker sequence. Since short amplicons usually result in better resolution in HRM analysis, primers were designed to amplify a short region of the intergenic sequence. Specific primer sets were designed for HRM analysis to discriminate between each of the three plant species based on specific SNPs (Table 2C). HRM analysis was conducted using the Mx3005P QPCR System (Agilent Technologies, CA, USA). Briefly, 10 ng of purified DNA, 5 pmoles of each primer, and 10 µl of SsoFast™ EvaGreen® Supermix 172-5200 pre- mixture (Bio-Rad, CA, USA) and reaction buffer (provided by the manufacturer) were combined in a total volume of 20 µl and subjected to the following cycling conditions: denaturation for 2 min at 98°C, followed by 30 cycles of 5 sec at 98°C and 20 sec at 57°C for double-strand annealing and extension. At the end of the final cycle, the temperature was reduced to 40°C, followed by an increase to 95°C, and fluorescence signals were plotted in real time against temperature to produce melting curves. Data were normalized to obtain values between 0% and 100%.

Alignment of DNA sequences from the chloroplast MatK and nuclear ITS regions

PCR products amplified from the MatK region of the chloroplast genome and the ITS region of the nuclear genome were 988 and 762 bp long, respectively. Alignment of sequences from each C. tricuspidata ecotype originating from the same country, such as Korean and China, revealed a very high degree of sequence homology. Phylogenetic analysis using the MatK and ITS sequence regions demonstrated more similarity among ecotypes originating from Korea than among those from China, with 100% sequence homology detected between each Korean ecotype, such as 2014-30, 31, 33, 34, 36, 37, 38, 39, and 42 (Fig. 2). Among Chinese C. tricuspidata ecotypes, phylogenetic analysis using MatK regions demonstrated more similarity between 2016-10 and 2016-47 versus 2014-41 (Fig. 2A), whereas analysis of ITS regions suggested that 2014-41 and 2016-47 are more closely related than 2016-10 (Fig. 2B).

Fig. 2.

Phylogenetic tree showing the genetic diversity of 12 ecotypes of Cudrania tricuspidata Bureau. The tree was produced using the neighbor-joining method based on intergenic sequences of MatK (A) and ITS (B)


ARMS-PCR analysis using ecotype-specific MatK region primers

We performed molecular authentication of Korean and Chinese C. tricuspidata ecotypes via ARMS-PCR using specific forward and reverse primers (Fig. 3A). The combination of specific primers yielded a single band of the correct size for each sample examined. We amplified PCR products from only the target species using specific primers. Analysis of many samples from each ecotype confirmed the accuracy of this assay. As shown in Fig. 3B, Fig. 3 the use of mismatched MatK primer pairs yielded 537 bp amplicons only from Korean C. tricuspidata, whereas, for Chinese C. tricuspidata, no band was detected using a combination of mismatched SNP forward primer and the reverse MatK-specific primer. Chinese C. tricuspidata ecotypes produced specific bands only when using mismatched Chinese ecotype-specific MatK primer pairs (Fig. 3C). Thus, Korean C. tricuspidata could clearly be identified from among different C. tricuspidata ecotypes.

Development of ecotype identification markers using nuclear DNA sequences

Fig. 3.

Sequence alignment and products of ARMS-PCR using the MatK (GenBank accession number JF317421.1) chloroplast intergenic regions in various ecotypes of Cudrania tricuspidata Bureau. (A) Sequence alignment of the MatK chloroplast intergenic region in each ecotype. The gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. Arrows indicate the positions of the MatK primers developed in this study. (B) PCR results using Korean ecotype-specific primers; (C) PCR results using Chinese ecotype-specific primers. M, marker; NC, negative control; PC, positive control; KOR, ecotype originating from Korea; CHI, ecotype originating from China


We designed Korean and Chinese C. tricuspidata-specific primer sets based on the intergenic sequences flanking the 5.8S rDNA gene, ITS 1 and ITS II, to develop markers derived from nuclear sequences that can be used to identify each C. tricuspidata ecotype by ARMS-PCR (Table 2B). For ARMS-PCR analysis, we used specific forward and reverse primers in the ITS I and ITS II regions, respectively. The forward and reverse primers contained G → T and T → A substitutions in the Korean C. tricuspidata sequence relative to that of Chinese C. tricuspidata, whereas no substitutions were present in the forward and reverse primers for Chinese C. tricuspidata. As expected, a specific PCR product was amplified from each ecotype using the ecotype-specific primers (Fig. 4B and 4C). This result indicates that ARMS-PCR analysis of nuclear ribosomal DNA using highly specific primers can be used to identify hybrid C. tricuspidata ecotypes.

Fig. 4.

Sequence alignment and products of ARMS-PCR using the ITS (GenBank accession number JF980330.1) nuclear intergenic regions in various Cudrania tricuspidata Bureau ecotypes. (A) Sequence alignment of the ITS nuclear intergenic regions in each ecotype. Gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. Arrows indicate the positions of the ITS primers developed in this study. (B) PCR results using Korean ecotype-specific primers; (C) PCR results using Chinese ecotype-specific primers. M, marker; NC, negative control; PC, positive control; KOR, ecotype originating from Korea; CHI, ecotype originating from China


Development of a chloroplast and nuclear DNA-based HRM assay

Based on the results of nucleotide sequence alignment of each C. tricuspidata ecotype, we designed a primer set to amplify a short fragment of each sequence (MatK, 197 bp and ITS, 205 bp) and to locate the SNP site in the middle of each amplicon for HRM curve analysis (Fig. 5A). When we performed HRM analysis of the MatK plastid sequences and the ITS nuclear sequences using DNA from each plant sample, two different melting curve patterns were detected (Fig. 5B): the melting curve patterns exactly corresponded with the classification of each ecotype of Korean and Chinese C. tricuspidata. When we subjected C. tricuspidata plants to HRM curve analysis of the intergenic regions of plastid MatK and nuclear ITS using the appropriate primer set, a typical melting curve pattern was generated for each ecotype, allowing the various Korean and Chinese C. tricuspidata ecotypes to be readily differentiated.

Fig. 5.

PCR products and HRM curve analysis using the MatK (GenBank accession number JF317421.1) chloroplast intergenic regions and the ITS (GenBank accession number JF980330.1) nuclear intergenic regions in Cudrania tricuspidata Bureau ecotypes originating from Korea and China. (A) PCR results using ecotype-specific primers. M, marker; KOR, ecotype originating from Korea; CHI, ecotype originating from China. (B) Melting curves of MatK and ITS from various samples using ecotypespecific primers


Sequence analysis of highly variable DNA is commonly used for species identification and phylogenetic analysis. In this study, we demonstrated that ARMS-PCR and HRM analysis could be used to detect polymorphic SNPs and to discriminate among ecotypes of C. tricuspidata collected from different locations in South Korea. The main advantage of ARMS is that the amplification and authentication steps are combined, in that the presence of an amplified product indicates the presence of a particular allele and vice versa. HRM analysis has several advantages over direct sequencing for both marker development and polymorphism detection (Mackay et al. 2008). HRM analysis is also a highly sensitive method for detecting SNPs, allowing sequence differences between species to be readily detected without the need for direct sequencing. ARMS-PCR and HRM analyses were recently used to discriminate among various medicinal plants, such as members of the diverse Panax genus and similar plant species Cynanchum wilfordii, C. auriculatum, and Polygonum multiflorum (Kim et al. 2013; Han et al. 2016). In the current study, we showed that SNPs in the MatK regions of plastid sequences and the ITS regions of nuclear sequences are effective, reliable tools for discriminating among C. tricuspidata ecotypes originating from the same country, such as Korea and China (Fig. 3 and 4). HRM curve analysis of specific markers in the plastid MatK region and the nuclear ITS region using DNA samples from C. tricuspidata ecotypes originating from Korea and China resulted in melting curve patterns consistent with the nucleotide differences determined by sequence analysis (Fig. 5). As expected, the melting curve patterns differed between Korean- and Chinese-specific C. tricuspidata ecotypes based on MatK and ITS markers. Therefore, the results demonstrate that, even though the ecotypes investigated in this study are related and share morphological characteristics, ARMS-PCR and HRM curve analysis using the plastid marker MatK and nuclear marker ITS are sufficient for providing an ecotype-specific DNA barcode to distinguish between ecotypes with different countries of origin.

In conclusion, we performed molecular genetic identification of C. tricuspidata ecotypes collected from different locations using SNP-based ARMS-PCR and HRM analysis with specific primers. The results suggest that it is possible to identify plant materials using assays based on the chloroplast MatK and nuclear ITS region. Compared with other methods involving the use of molecular markers, our method is reliable, efficient, and scalable for testing large numbers of ecotypes collected from different locations. The results demonstrate that the plastid DNA region MatK and the nuclear DNA ITS can be used for intraspecific polymorphism studies and that they represent useful tools for marker- assisted identification and selection of specific C. tricuspidata ecotypes or cultivars.

This research was supported by the Agro & Bio-industry Technology Development Program (Grant no. 314021-3-1- SB050), Ministry of Agriculture, Food and Rural Affairs, South Korea.

  1. Chagne D, Gasic K, Crowhurst RN, Han Y, Bassett HC, Bowatte DR, Lawrence TJ, Rikkerink EH, Gardiner SE, and Korban SS. (2008) Development of a set of SNP markers present in expressed genes of the apple. Genomics 92, 353-358.
    Pubmed CrossRef
  2. Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, and Wittwer CT. (2003) Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes. Clin Chem 49, 396-406.
    Pubmed CrossRef
  3. Han EH, Cho KM, Goo YM, Kim MB, Shin YW, Kim YH, and Lee SW. (2016) Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species Cynanchum wilfordii, Cynanchum auriculatum and Polygonum multiflorum. Mol Biol Rep 43, 323-332.
    Pubmed CrossRef
  4. Hano Y, Matsumoto Y, Sun JY, and Nomura T. (1990) Structures of three new isoprenylated xanthones, cudraxanthones E, F and G. Planta Med 56, 478-481.
  5. Jung J, Kim KH, Yang K, Bang KH, and Yang TJ. (2014) Practical application of DNA markers for high-throughput authentication of Panax ginseng and Panax quinquefolius from commercial ginseng products. J Ginseng Res 38, 123-129.
    Pubmed KoreaMed CrossRef
  6. Kim MK, Wang H, Kim YJ, Sathiyamoorthy S, Kwon WS, and Yang DC. (2013) Molecular authentication by multiplex-PCR of three similar medicinal plant species Cynanchum wilfordii, Cynanchum auriculatum and Polygonum multiflorum(Fallopia multiflorum). J Med Plant Res 35, 2854-2589.
  7. Lehmensiek A, Sutherland MW, and McNamara RB. (2008) The use of high resolution melting (HRM) to map single nucleotide polymorphism markers linked to a covered smut resistance gene in barley. Theor Appl Genet 117, 721-728.
    Pubmed CrossRef
  8. Liu J, Huang S, Sun M, Liu S, Liu Y, Wang W, Zhang X, Wang H, and Hua W. (2012) An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Meth 8, 34.
    Pubmed KoreaMed CrossRef
  9. Mackay JF, Wright CD, and Bonfiglioli RG. (2008) A new approach to varietal identification in plants by microsatellite high resolution melting analysis: application to the verification of grapevine and olive cultivars. Plant Meth 4, 8.
    Pubmed KoreaMed CrossRef
  10. Newton CR, Graham A, and Heptinstall LE. (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucl Acids Res 17, 2503-2516.
    Pubmed KoreaMed CrossRef
  11. Park KH. (2005) Antioxidant and cytotoxic activities of xanthones from Cudrania tricuspidata. Bioorg Med Chem Lett 15, 5548-5552.
    Pubmed CrossRef
  12. Park KH, Park YD, Han JM, Im KR, Lee BW, and Jeong IY. (2006) Antiatheroclerotic and anti-inflammatory activities of catecholic xanthones and flavonoids isolated from Cudrania tricuspidata. Bioorg Med Chem Lett 16, 5580-5583.
    Pubmed CrossRef
  13. Pyke KA. (1999) Plastid division and development. Plant Cell 11, 549-556.
    Pubmed KoreaMed CrossRef
  14. Reboud X, and Zeyl C. (1994) Organelle inheritance in plants. Heredity 72, 132-140.
    CrossRef
  15. Ririe KM, Rasmussen RP, and Wittwer CT. (1997) Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem 245, 154-160.
    Pubmed CrossRef
  16. Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S. (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30, 2725-2729.
    Pubmed KoreaMed CrossRef
  17. Wolfe AD, and Randle CP. (2004) Recombination, heteroplasmy, haplotype polymorphism, and paralogy in plastid genes: implications for plant molecular systematics. Syst Bot 29, 1011-1120.
    CrossRef
  18. Yang JY, Jang SY, Kim HK, and Park SJ. (2012) Development of a molecular marker to discriminate Korean Rubus species medicinal plants based on the nuclear ribosomal DNA internal transcribed spacer and chloroplast trnL-F intergenic region sequences. J Kor Soc Appl Biol Chem 55, 281-289.
    CrossRef
  19. Zou YS, Hou AJ, Zhu GF, Chen YF, Sun HD, and Zhao QS. (2004) Cytotoxic isoprenylated xanthones from Cudrania tricuspidata. Bioorg Med Chem 12, 1947-1953.
    Pubmed CrossRef

Article

Research Article

J Plant Biotechnol 2017; 44(3): 235-242

Published online September 30, 2017 https://doi.org/10.5010/JPB.2017.44.3.235

Copyright © The Korean Society of Plant Biotechnology.

Molecular markers based on chloroplast and nuclear ribosomal DNA regions which distinguish Korean-specific ecotypes of the medicinal plant Cudrania tricuspidata Bureau

Soo Jin Lee, Yong-Wook Shin, Yun-Hee Kim*, and Shin-Woo Lee*

Department of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Korea,
Department of Biology Education, College of Education, IALS, Gyeongsang National University, Jinju, Korea

Correspondence to: e-mail: shinwlee@gntech.ac.kr
e-mail: cefle@gnu.ac.kr

Received: 28 August 2017; Revised: 7 September 2017; Accepted: 20 September 2017

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Cudrania tricuspidata Bureau is a widely-used, medicinal, perennial and woody plant. Obtaining information about the genetic diversity of plant populations is highly important with regard toconservation and germplasm utilization. Although C. tricuspidata is an important medicinal plant species registered in South Korea, no molecular markers are currently available to distinguish Korean-specific ecotypes from other ecotypes from different countries.

In this study, we developed single nucleotide polymorphism (SNP) markers derived from the chloroplast and nuclear genomic sequences, which serve to to identify distinct Korean- specific ecotypes of C. tricuspidata via amplification refractory mutation system (ARMS)-PCR and high resolution melting (HRM) curve analyses. We performed molecular authentication of twelve C. tricuspidata ecotypes from different regions using DNA sequences in the maturaseK (MatK) chloroplast intergenic region and nuclear ribosomal DNA internal transcribed spacer (ITS) regions. The SNP markers developed in this study are useful for rapidly identifying specific C. tricuspidata ecotypes from different regions.

Keywords: ARMS-PCR, chloroplast genome, HRM curve analysis, single nucleotide polymorphisms, nuclear ribosomal DNA internal transcribed spacers

Introduction

Cudrania tricuspidata Bureau is a deciduous tree found in Korea, China, Japan, and Eastern Russia. The root bark and cortex of C. tricuspidata have long been used as crude drug materials, yielding one of the most ubiquitous traditional herbal medicines in East Asia (Hano et al. 1990). The beneficial effects of these plants primarily include their anti-tumor (Zou et al. 2004), anti-inflammatory (Park et al. 2006), and cytotoxic activities (Park 2005). Understanding the genetic variation, structure, and phylogenetic characteristics of this useful plant species is important for its conservation and sustainable use, but molecular markers to classify the genetic diversity in C. tricuspidata have not yet been reported.

DNA markers based on the chloroplast genome can be used to quickly and reliably classify specific plant species, cultivars, or ecotypes due to their unique features. Chloroplasts are maternally inherited intracellular plant organelles with specific functions that contain their own genomes (Reboud 1994). A plant cell can contain up to 1,000 copies of the chloroplast genome, which is over 100-times greater than the number of copies of the nuclear genome found in plant cells (Pyke 1999). Therefore, a target region in the chloroplast genome can be amplified by PCR more easily than a target region in the nuclear genome using trace amounts of genomic DNA. Most gene sequences are also highly conserved in various plant species, but considerable amounts of nucleotide variation have been identified in chloroplast intergenic spacer regions at the interspecies level and (rarely) at the intraspecies level (Wolfe et al. 2004). In addition, nuclear ribosomal DNA internal transcribed spacer (ITS) sequences have recently been used to develop molecular markers to identify various medicinal plant species originating from Korea and China (Yang et al. 2012; Han et al. 2016). Hybrids may also be produced via cross-fertilization when similar species or ecotypes are cultivated in the same field. Genetic markers based only on chloroplast intergenic sequences are likely to be insufficient for identifying specific species among hybrid plants, since chloroplast genomes are inherited maternally, whereas nuclear genomes are inherited by hybridization; thus ITSs are at the forefront of DNA barcoding research.

Sequence-based DNA markers have practical advantages for authenticating plant species, as they can be used to differentiate similar medicinal plants in a time- and cost-effective manner (Jung et al. 2014). Various DNA markers based on random polymorphic sequences have been used to classify similar medicinal plant species, including single nucleotide polymorphisms (SNPs) (Kim et al. 2013; Han et al. 2016). While the use of highly variable sequences from the plastid and nuclear genomes is important for barcoding, molecular markers to classify genetic diversity in C. tricuspidata have not yet been reported. Sequence analysis of PCR products via amplification refractory mutation system (ARMS) is a simple, timesaving, effective method for SNP genotyping. The main advantage of ARMS is that the amplification and authentication steps are combined, such that the presence of an amplified product indicates the presence of a particular allele. High resolution melting (HRM) curve analysis was recently developed to detect SNPs located on amplicons (Ririe et al. 1997; Gundry et al. 2003; Liu et al. 2012). In this method, amplified DNA strands are melted apart via a gradual increase in temperature, and different melting patterns are detected based on subtle changes in fluorescence generated by double-stranded DNA-binding dyes. The rapid, inexpensive detection of a broad range of SNPs via HRM analysis makes this technique suitable for genotype discrimination (Lehmensiek et al. 2008) and genetic mapping (Chagne et al. 2008); various cultivars have been identified using SNPs via these technique (Mackay et al. 2008).

Therefore, in this study, we developed an effective method for identifying Korean-specific C. tricuspidata ecotypes using markers derived from plastid and nuclear DNA sequences and demonstrated that marker polymorphisms can be efficiently detected by ARMS-PCR and HRM analysis. This is the first report of the development and characterization of Korean-specific C. tricuspidata ecotypes using SNP markers derived from plastid and nuclear DNA sequences. Our data from DNA barcoding analysis using chloroplast and nuclear genomic sequence regions (MatK and ITS) reveal inter- and intraspecific variation among C. tricuspidata ecotypes.

Materials and Methods

Plant materials

Twelve Cudrania tricuspidata Bureau ecotypes from different regions were used in this study (Table 1 and Fig. 1). Sample identities were confirmed by comparing sequences from the chloroplast MatK and nuclear ITS regions in these samples with those in NCBI GenBank: MatK (accession number JF317421.1) and ITS (accession number JF980330.1). All plant materials were assigned identification numbers and preserved at the Gyeongnam National University of Science and Technology (Jinju, Korea)(Table 1).

Table 1 . List of plant materials used in this study.

Identification codeScientific nameCultivated regions (sources)Identified originMaterial used
2014-30Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth KoreaLeaves
2014-31Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth KoreaLeaves/stems
2014-33Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2014-34Cudrania tricuspidata BureauSacheon, Gyeongnam, KoreaSouth KoreaLeaves
2014-36Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth KoreaLeaves
2014-37Cudrania tricuspidata BureauUiryeong, Gyeongnam, KoreaSouth KoreaLeaves
2014-38Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2014-39Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth KoreaStems
2014-41Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaChinaLeaves
2014-42Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2016-10Cudrania tricuspidata BureauMiryang, Gyeongnam, KoreaChinaLeaves/stems
2016-47Cudrania tricuspidata BureauCommercial herbsChinaDried stems

Figure 1.

Sampling locations of 12 Cudrania tricuspidata Bureau ecotypes (Google Maps)


Genomic DNA extraction

Genomic DNA was isolated using a Plant DNA Extraction kit (GeneAll Co. Exgene™, Seoul, Korea) from plant samples that had been snap frozen in liquid nitrogen and ground into a powder. The concentration and purity of the DNA samples were measured using a micro-spectrophotometer (BioPrince, SD-2000, Gangwon, South Korea). All samples had A260/A280 absorbance ratios >1.8 and A234/A260 ratios of 0.5 ~ 0.8.

PCR amplification and nucleotide sequence analyses

Primers were designed based on sequences in the NCBI database to specifically amplify sequences from the MatK and ITS regions of the plastid and nuclear genomes, respectively (Table 2A). The sequences of each primer pair are provided in Table 2A. PCR amplification was performed using i-pfu DNA polymerase from iNtRON Co. (Seoul, Korea), which minimizes the introduction of mutations during the amplification reaction. The amplicons were sent to Solgent Co., Seoul, Korea for sequencing analysis without cloning the amplified fragments to avoid introducing any mutations. Each experiment was repeated at least three times, and all amplified fragments were sequenced in both directions.

Table 2 . Primer sequences used in this study.

A. SNP analysis
GenePrimers   Sequences (5’–3’)Tm (°C)Size (bp)

MatKMatK forwardATTGCGGTTTTTTCTTCACGACT57.8988
MatK reverseATGATTGACCAGATCGTTGATGC57.4

ITSITS forwardTCCGTAGGTGAACCTGCGG58.0762
ITS reverseGCCGTTACTAGGGGAATCCTTG57.6

B. ARMS-PCR analysis

OriginPrimers   Sequences (5’–3’)Tm (°C)Size (bp)

South KoreaMatk-specific forwardACGATTAACATCTTCTGGTGA55.5537
Matk-specific reverseGATTTCTGCATATACACGCATAG59.3

ITS-specific forwardGCCAAGTGCGTGCCGCTCATC68.7458
ITS-specific reverseCGACAACCACCTTTTGCCTCA60.2

ChinaMatk-specific forwardACGATTAACATCTTCTGGAGG57.4537
Matk-specific reverseGATTTCTGCATATACACGCAGAT59.3

ITS-specific forwardGCCAAGTGCGTGCCGCTCTGT66.2458
ITS-specific reverseCGACAACCACCTTTTGTCACG57.5

C. HRM analysis

GenePrimers   Sequences (5’–3’)Tm (°C)Size (bp)

MatKMatK forwardGTGTGGTCTCAACCAGGAAG57.2197
MatK reverseGCCAACGATCCAATCAGAGG57.7

ITSITS forwardTCCCGTGAACCATCGAGTC58.2205
ITS reverseGCACGTGACAAGGGACTTG58.1

Construction of a dendrogram and genetic distance analysis

A dendrogram describing the genetic distances between the ecotypes based on their MatK and ITS sequences was constructed using the Mega 6.0 statistical program. Pairwise comparisons between species were performed by measuring genetic distances using the Tamura-Nei distance method. A genetic distance matrix was used for cluster analysis via the neighbor-joining method (Tamura et al. 2013).

ARMS-PCR

An ARMS-PCR assay was developed to investigate samples collected from different locations (Table 1). Plastid DNA- specific primer sets for each ecotype were designed based on the intergenic sequence of the MatK region (Table 2B). The relative positions and sizes of the targeted species- specific amplicons are shown in Fig. 3A. Ecotype-specific amplification of the ITS region was performed using a forward primer based on a sequence in ITS I and a reverse primer based on a sequence in ITS II (Table 2B and Fig. 4A). ARMS primers were designed essentially as described by Newton et al. (1989), and PCR analysis was carried out using Exprime Taq Premix (Genet Bio, Seoul, Korea).

HRM curve analysis

A primer set was designed based on the intergenic sequences of the MatK and ITS regions to develop a plastid sequence HRM assay for identifying specific plant ecotypes. HRM analysis was performed to detect polymorphisms in this marker sequence. Since short amplicons usually result in better resolution in HRM analysis, primers were designed to amplify a short region of the intergenic sequence. Specific primer sets were designed for HRM analysis to discriminate between each of the three plant species based on specific SNPs (Table 2C). HRM analysis was conducted using the Mx3005P QPCR System (Agilent Technologies, CA, USA). Briefly, 10 ng of purified DNA, 5 pmoles of each primer, and 10 µl of SsoFast™ EvaGreen® Supermix 172-5200 pre- mixture (Bio-Rad, CA, USA) and reaction buffer (provided by the manufacturer) were combined in a total volume of 20 µl and subjected to the following cycling conditions: denaturation for 2 min at 98°C, followed by 30 cycles of 5 sec at 98°C and 20 sec at 57°C for double-strand annealing and extension. At the end of the final cycle, the temperature was reduced to 40°C, followed by an increase to 95°C, and fluorescence signals were plotted in real time against temperature to produce melting curves. Data were normalized to obtain values between 0% and 100%.

Results and Discussion

Alignment of DNA sequences from the chloroplast MatK and nuclear ITS regions

PCR products amplified from the MatK region of the chloroplast genome and the ITS region of the nuclear genome were 988 and 762 bp long, respectively. Alignment of sequences from each C. tricuspidata ecotype originating from the same country, such as Korean and China, revealed a very high degree of sequence homology. Phylogenetic analysis using the MatK and ITS sequence regions demonstrated more similarity among ecotypes originating from Korea than among those from China, with 100% sequence homology detected between each Korean ecotype, such as 2014-30, 31, 33, 34, 36, 37, 38, 39, and 42 (Fig. 2). Among Chinese C. tricuspidata ecotypes, phylogenetic analysis using MatK regions demonstrated more similarity between 2016-10 and 2016-47 versus 2014-41 (Fig. 2A), whereas analysis of ITS regions suggested that 2014-41 and 2016-47 are more closely related than 2016-10 (Fig. 2B).

Figure 2.

Phylogenetic tree showing the genetic diversity of 12 ecotypes of Cudrania tricuspidata Bureau. The tree was produced using the neighbor-joining method based on intergenic sequences of MatK (A) and ITS (B)


ARMS-PCR analysis using ecotype-specific MatK region primers

We performed molecular authentication of Korean and Chinese C. tricuspidata ecotypes via ARMS-PCR using specific forward and reverse primers (Fig. 3A). The combination of specific primers yielded a single band of the correct size for each sample examined. We amplified PCR products from only the target species using specific primers. Analysis of many samples from each ecotype confirmed the accuracy of this assay. As shown in Fig. 3B, Fig. 3 the use of mismatched MatK primer pairs yielded 537 bp amplicons only from Korean C. tricuspidata, whereas, for Chinese C. tricuspidata, no band was detected using a combination of mismatched SNP forward primer and the reverse MatK-specific primer. Chinese C. tricuspidata ecotypes produced specific bands only when using mismatched Chinese ecotype-specific MatK primer pairs (Fig. 3C). Thus, Korean C. tricuspidata could clearly be identified from among different C. tricuspidata ecotypes.

Development of ecotype identification markers using nuclear DNA sequences

Figure 3.

Sequence alignment and products of ARMS-PCR using the MatK (GenBank accession number JF317421.1) chloroplast intergenic regions in various ecotypes of Cudrania tricuspidata Bureau. (A) Sequence alignment of the MatK chloroplast intergenic region in each ecotype. The gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. Arrows indicate the positions of the MatK primers developed in this study. (B) PCR results using Korean ecotype-specific primers; (C) PCR results using Chinese ecotype-specific primers. M, marker; NC, negative control; PC, positive control; KOR, ecotype originating from Korea; CHI, ecotype originating from China


We designed Korean and Chinese C. tricuspidata-specific primer sets based on the intergenic sequences flanking the 5.8S rDNA gene, ITS 1 and ITS II, to develop markers derived from nuclear sequences that can be used to identify each C. tricuspidata ecotype by ARMS-PCR (Table 2B). For ARMS-PCR analysis, we used specific forward and reverse primers in the ITS I and ITS II regions, respectively. The forward and reverse primers contained G → T and T → A substitutions in the Korean C. tricuspidata sequence relative to that of Chinese C. tricuspidata, whereas no substitutions were present in the forward and reverse primers for Chinese C. tricuspidata. As expected, a specific PCR product was amplified from each ecotype using the ecotype-specific primers (Fig. 4B and 4C). This result indicates that ARMS-PCR analysis of nuclear ribosomal DNA using highly specific primers can be used to identify hybrid C. tricuspidata ecotypes.

Figure 4.

Sequence alignment and products of ARMS-PCR using the ITS (GenBank accession number JF980330.1) nuclear intergenic regions in various Cudrania tricuspidata Bureau ecotypes. (A) Sequence alignment of the ITS nuclear intergenic regions in each ecotype. Gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. Arrows indicate the positions of the ITS primers developed in this study. (B) PCR results using Korean ecotype-specific primers; (C) PCR results using Chinese ecotype-specific primers. M, marker; NC, negative control; PC, positive control; KOR, ecotype originating from Korea; CHI, ecotype originating from China


Development of a chloroplast and nuclear DNA-based HRM assay

Based on the results of nucleotide sequence alignment of each C. tricuspidata ecotype, we designed a primer set to amplify a short fragment of each sequence (MatK, 197 bp and ITS, 205 bp) and to locate the SNP site in the middle of each amplicon for HRM curve analysis (Fig. 5A). When we performed HRM analysis of the MatK plastid sequences and the ITS nuclear sequences using DNA from each plant sample, two different melting curve patterns were detected (Fig. 5B): the melting curve patterns exactly corresponded with the classification of each ecotype of Korean and Chinese C. tricuspidata. When we subjected C. tricuspidata plants to HRM curve analysis of the intergenic regions of plastid MatK and nuclear ITS using the appropriate primer set, a typical melting curve pattern was generated for each ecotype, allowing the various Korean and Chinese C. tricuspidata ecotypes to be readily differentiated.

Figure 5.

PCR products and HRM curve analysis using the MatK (GenBank accession number JF317421.1) chloroplast intergenic regions and the ITS (GenBank accession number JF980330.1) nuclear intergenic regions in Cudrania tricuspidata Bureau ecotypes originating from Korea and China. (A) PCR results using ecotype-specific primers. M, marker; KOR, ecotype originating from Korea; CHI, ecotype originating from China. (B) Melting curves of MatK and ITS from various samples using ecotypespecific primers


Sequence analysis of highly variable DNA is commonly used for species identification and phylogenetic analysis. In this study, we demonstrated that ARMS-PCR and HRM analysis could be used to detect polymorphic SNPs and to discriminate among ecotypes of C. tricuspidata collected from different locations in South Korea. The main advantage of ARMS is that the amplification and authentication steps are combined, in that the presence of an amplified product indicates the presence of a particular allele and vice versa. HRM analysis has several advantages over direct sequencing for both marker development and polymorphism detection (Mackay et al. 2008). HRM analysis is also a highly sensitive method for detecting SNPs, allowing sequence differences between species to be readily detected without the need for direct sequencing. ARMS-PCR and HRM analyses were recently used to discriminate among various medicinal plants, such as members of the diverse Panax genus and similar plant species Cynanchum wilfordii, C. auriculatum, and Polygonum multiflorum (Kim et al. 2013; Han et al. 2016). In the current study, we showed that SNPs in the MatK regions of plastid sequences and the ITS regions of nuclear sequences are effective, reliable tools for discriminating among C. tricuspidata ecotypes originating from the same country, such as Korea and China (Fig. 3 and 4). HRM curve analysis of specific markers in the plastid MatK region and the nuclear ITS region using DNA samples from C. tricuspidata ecotypes originating from Korea and China resulted in melting curve patterns consistent with the nucleotide differences determined by sequence analysis (Fig. 5). As expected, the melting curve patterns differed between Korean- and Chinese-specific C. tricuspidata ecotypes based on MatK and ITS markers. Therefore, the results demonstrate that, even though the ecotypes investigated in this study are related and share morphological characteristics, ARMS-PCR and HRM curve analysis using the plastid marker MatK and nuclear marker ITS are sufficient for providing an ecotype-specific DNA barcode to distinguish between ecotypes with different countries of origin.

In conclusion, we performed molecular genetic identification of C. tricuspidata ecotypes collected from different locations using SNP-based ARMS-PCR and HRM analysis with specific primers. The results suggest that it is possible to identify plant materials using assays based on the chloroplast MatK and nuclear ITS region. Compared with other methods involving the use of molecular markers, our method is reliable, efficient, and scalable for testing large numbers of ecotypes collected from different locations. The results demonstrate that the plastid DNA region MatK and the nuclear DNA ITS can be used for intraspecific polymorphism studies and that they represent useful tools for marker- assisted identification and selection of specific C. tricuspidata ecotypes or cultivars.

Acknowledgements

This research was supported by the Agro & Bio-industry Technology Development Program (Grant no. 314021-3-1- SB050), Ministry of Agriculture, Food and Rural Affairs, South Korea.

Fig 1.

Figure 1.

Sampling locations of 12 Cudrania tricuspidata Bureau ecotypes (Google Maps)

Journal of Plant Biotechnology 2017; 44: 235-242https://doi.org/10.5010/JPB.2017.44.3.235

Fig 2.

Figure 2.

Phylogenetic tree showing the genetic diversity of 12 ecotypes of Cudrania tricuspidata Bureau. The tree was produced using the neighbor-joining method based on intergenic sequences of MatK (A) and ITS (B)

Journal of Plant Biotechnology 2017; 44: 235-242https://doi.org/10.5010/JPB.2017.44.3.235

Fig 3.

Figure 3.

Sequence alignment and products of ARMS-PCR using the MatK (GenBank accession number JF317421.1) chloroplast intergenic regions in various ecotypes of Cudrania tricuspidata Bureau. (A) Sequence alignment of the MatK chloroplast intergenic region in each ecotype. The gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. Arrows indicate the positions of the MatK primers developed in this study. (B) PCR results using Korean ecotype-specific primers; (C) PCR results using Chinese ecotype-specific primers. M, marker; NC, negative control; PC, positive control; KOR, ecotype originating from Korea; CHI, ecotype originating from China

Journal of Plant Biotechnology 2017; 44: 235-242https://doi.org/10.5010/JPB.2017.44.3.235

Fig 4.

Figure 4.

Sequence alignment and products of ARMS-PCR using the ITS (GenBank accession number JF980330.1) nuclear intergenic regions in various Cudrania tricuspidata Bureau ecotypes. (A) Sequence alignment of the ITS nuclear intergenic regions in each ecotype. Gray box indicates the same sequences in two or three ecotypes, while the black box indicates the same sequence in all ecotypes. ▲ indicates polymorphisms. Arrows indicate the positions of the ITS primers developed in this study. (B) PCR results using Korean ecotype-specific primers; (C) PCR results using Chinese ecotype-specific primers. M, marker; NC, negative control; PC, positive control; KOR, ecotype originating from Korea; CHI, ecotype originating from China

Journal of Plant Biotechnology 2017; 44: 235-242https://doi.org/10.5010/JPB.2017.44.3.235

Fig 5.

Figure 5.

PCR products and HRM curve analysis using the MatK (GenBank accession number JF317421.1) chloroplast intergenic regions and the ITS (GenBank accession number JF980330.1) nuclear intergenic regions in Cudrania tricuspidata Bureau ecotypes originating from Korea and China. (A) PCR results using ecotype-specific primers. M, marker; KOR, ecotype originating from Korea; CHI, ecotype originating from China. (B) Melting curves of MatK and ITS from various samples using ecotypespecific primers

Journal of Plant Biotechnology 2017; 44: 235-242https://doi.org/10.5010/JPB.2017.44.3.235

Table 1 . List of plant materials used in this study.

Identification codeScientific nameCultivated regions (sources)Identified originMaterial used
2014-30Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth KoreaLeaves
2014-31Cudrania tricuspidata BureauHaenam, Jeonam, KoreaSouth KoreaLeaves/stems
2014-33Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2014-34Cudrania tricuspidata BureauSacheon, Gyeongnam, KoreaSouth KoreaLeaves
2014-36Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth KoreaLeaves
2014-37Cudrania tricuspidata BureauUiryeong, Gyeongnam, KoreaSouth KoreaLeaves
2014-38Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2014-39Cudrania tricuspidata BureauJinju, Gyeongnam, KoreaSouth KoreaStems
2014-41Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaChinaLeaves
2014-42Cudrania tricuspidata BureauSancheong, Gyeongnam, KoreaSouth KoreaLeaves
2016-10Cudrania tricuspidata BureauMiryang, Gyeongnam, KoreaChinaLeaves/stems
2016-47Cudrania tricuspidata BureauCommercial herbsChinaDried stems

Table 2 . Primer sequences used in this study.

A. SNP analysis
GenePrimers   Sequences (5’–3’)Tm (°C)Size (bp)

MatKMatK forwardATTGCGGTTTTTTCTTCACGACT57.8988
MatK reverseATGATTGACCAGATCGTTGATGC57.4

ITSITS forwardTCCGTAGGTGAACCTGCGG58.0762
ITS reverseGCCGTTACTAGGGGAATCCTTG57.6

B. ARMS-PCR analysis

OriginPrimers   Sequences (5’–3’)Tm (°C)Size (bp)

South KoreaMatk-specific forwardACGATTAACATCTTCTGGTGA55.5537
Matk-specific reverseGATTTCTGCATATACACGCATAG59.3

ITS-specific forwardGCCAAGTGCGTGCCGCTCATC68.7458
ITS-specific reverseCGACAACCACCTTTTGCCTCA60.2

ChinaMatk-specific forwardACGATTAACATCTTCTGGAGG57.4537
Matk-specific reverseGATTTCTGCATATACACGCAGAT59.3

ITS-specific forwardGCCAAGTGCGTGCCGCTCTGT66.2458
ITS-specific reverseCGACAACCACCTTTTGTCACG57.5

C. HRM analysis

GenePrimers   Sequences (5’–3’)Tm (°C)Size (bp)

MatKMatK forwardGTGTGGTCTCAACCAGGAAG57.2197
MatK reverseGCCAACGATCCAATCAGAGG57.7

ITSITS forwardTCCCGTGAACCATCGAGTC58.2205
ITS reverseGCACGTGACAAGGGACTTG58.1

References

  1. Chagne D, Gasic K, Crowhurst RN, Han Y, Bassett HC, Bowatte DR, Lawrence TJ, Rikkerink EH, Gardiner SE, and Korban SS. (2008) Development of a set of SNP markers present in expressed genes of the apple. Genomics 92, 353-358.
    Pubmed CrossRef
  2. Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, and Wittwer CT. (2003) Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes. Clin Chem 49, 396-406.
    Pubmed CrossRef
  3. Han EH, Cho KM, Goo YM, Kim MB, Shin YW, Kim YH, and Lee SW. (2016) Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species Cynanchum wilfordii, Cynanchum auriculatum and Polygonum multiflorum. Mol Biol Rep 43, 323-332.
    Pubmed CrossRef
  4. Hano Y, Matsumoto Y, Sun JY, and Nomura T. (1990) Structures of three new isoprenylated xanthones, cudraxanthones E, F and G. Planta Med 56, 478-481.
  5. Jung J, Kim KH, Yang K, Bang KH, and Yang TJ. (2014) Practical application of DNA markers for high-throughput authentication of Panax ginseng and Panax quinquefolius from commercial ginseng products. J Ginseng Res 38, 123-129.
    Pubmed KoreaMed CrossRef
  6. Kim MK, Wang H, Kim YJ, Sathiyamoorthy S, Kwon WS, and Yang DC. (2013) Molecular authentication by multiplex-PCR of three similar medicinal plant species Cynanchum wilfordii, Cynanchum auriculatum and Polygonum multiflorum(Fallopia multiflorum). J Med Plant Res 35, 2854-2589.
  7. Lehmensiek A, Sutherland MW, and McNamara RB. (2008) The use of high resolution melting (HRM) to map single nucleotide polymorphism markers linked to a covered smut resistance gene in barley. Theor Appl Genet 117, 721-728.
    Pubmed CrossRef
  8. Liu J, Huang S, Sun M, Liu S, Liu Y, Wang W, Zhang X, Wang H, and Hua W. (2012) An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Meth 8, 34.
    Pubmed KoreaMed CrossRef
  9. Mackay JF, Wright CD, and Bonfiglioli RG. (2008) A new approach to varietal identification in plants by microsatellite high resolution melting analysis: application to the verification of grapevine and olive cultivars. Plant Meth 4, 8.
    Pubmed KoreaMed CrossRef
  10. Newton CR, Graham A, and Heptinstall LE. (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucl Acids Res 17, 2503-2516.
    Pubmed KoreaMed CrossRef
  11. Park KH. (2005) Antioxidant and cytotoxic activities of xanthones from Cudrania tricuspidata. Bioorg Med Chem Lett 15, 5548-5552.
    Pubmed CrossRef
  12. Park KH, Park YD, Han JM, Im KR, Lee BW, and Jeong IY. (2006) Antiatheroclerotic and anti-inflammatory activities of catecholic xanthones and flavonoids isolated from Cudrania tricuspidata. Bioorg Med Chem Lett 16, 5580-5583.
    Pubmed CrossRef
  13. Pyke KA. (1999) Plastid division and development. Plant Cell 11, 549-556.
    Pubmed KoreaMed CrossRef
  14. Reboud X, and Zeyl C. (1994) Organelle inheritance in plants. Heredity 72, 132-140.
    CrossRef
  15. Ririe KM, Rasmussen RP, and Wittwer CT. (1997) Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem 245, 154-160.
    Pubmed CrossRef
  16. Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S. (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30, 2725-2729.
    Pubmed KoreaMed CrossRef
  17. Wolfe AD, and Randle CP. (2004) Recombination, heteroplasmy, haplotype polymorphism, and paralogy in plastid genes: implications for plant molecular systematics. Syst Bot 29, 1011-1120.
    CrossRef
  18. Yang JY, Jang SY, Kim HK, and Park SJ. (2012) Development of a molecular marker to discriminate Korean Rubus species medicinal plants based on the nuclear ribosomal DNA internal transcribed spacer and chloroplast trnL-F intergenic region sequences. J Kor Soc Appl Biol Chem 55, 281-289.
    CrossRef
  19. Zou YS, Hou AJ, Zhu GF, Chen YF, Sun HD, and Zhao QS. (2004) Cytotoxic isoprenylated xanthones from Cudrania tricuspidata. Bioorg Med Chem 12, 1947-1953.
    Pubmed CrossRef
JPB
Vol 52. 2025

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download