Terpenes, which constitute a large class of secondary metabolites in plants, have been divided into the following classes: hemiterpenes (C5); monoterpenes (C10); sesquiterpenes (C15); diterpenes (C20); sesterterpenes (C25); triterpenes (C30); tetraterpenes (C40) and polyterpenes (> C40) (Tholl 2006; Singh and Sharma 2015). Most plant genomes include a medium-sized family of genes encoding terpene synthases (TPSs) (Chen et al. 2011). There are two terpene biosynthesis pathways in plants, namely the chloroplast 2-C-methylerythritol-4-phosphate (MEP) pathway and cytosolic mevalonate (MEV) pathways, both of which require a 5-carbon isoprenoid diphosphate precursor for the production of all terpenes. Based on their phylogenetic relationships, the plant TPS genes are distributed in seven different clades. The angiosperm clades consist of TPS-a, TPS-b, and TPS-g. The TPS-a clade comprises the sesquiterpene synthases, while the TPS-b and TPS-g clades consist mainly of monoterpene synthases and sesquiterpene synthases, respectively. The TPS-d clade includes monoterpene, sesquiterpene, and diterpene synthases. Meanwhile, the TPS-h clade consists of diterpene synthases (Bohlmann et al. 1998; Dudareva et al. 2006; Chen et al. 2011; Li et al. 2012).

The most studied TPS gene family has been that of Arabidopsisthaliana (Sun et al. 1994; Yamaguchi et al. 1998; Bohlmann et al. 2000; Chen et al. 2003; Fäldt et al. 2003; Chen et al. 2004; Tholl et al. 2005; Herde et al. 2008), with only a few TPSs having been isolated in cultivated plants, including rice (Oryza sativa), tomato (Solanum lycopersicum), grape (Vitis vinifera), poplar (Populus trichocarpa), and sorghum (Sorghum bicolor) (Falara et al. 2011; Irmisch et al. 2014; Lee et al. 2015; Yoshitomi et al. 2016; Zhang et al. 2016). However, a detailed analysis of the presence and role of terpenes in these plants has not been published. Monoterpene synthases generally comprise 600-650 amino acid residues, while sesquiterpene synthase have 50-70 fewer amino acids (Martin et al. 2004). All TPS C-terminals contain an aspartate-rich DDxxD domain, which helps coordinate divalent metal ions for a subsequent binding of a substrate (Lesburg et al. 1997; Peterd et al. 2003; Tholl 2006; Tholl et al. 2011). All plant terpenoids are biosynthesized by TPSs, with monoterpene and diterpene synthases localized to the chloroplast via the MEP pathway, and the sesquiterpene synthases present in the cytoplasm via MEV pathway (Aharoni et al. 2003; Singh and Sharma 2015; Chen et al. 2011; Tholl et al. 2011). Tomato TPS are localized in mitochondria, but the in vivo substrates are currently unknown (Falara et al. 2011).

Some plant TPSs effect primary metabolism [e.g., gibberellin biosynthesis], but most TPSs are involved in the biosynthesis of secondary metabolites in response to environmental stimuli (Chen et al. 2011; Cheng et al. 2007). There has been recent progress in the characterization of the biochemistry and molecular genetics underlying terpenoid biosynthesis. Additionally, the biological functions of many terpene compounds associated with phytohormone biosynthesis have been determined. For example, jasmonate-responsive volatile terpenoids are important for defense responses in rice and help protect plant from UV radiation and photo- oxidative stress (Jenkins et al. 2009; Yohitomi et al. 2016). Moreover, terpenes provide protection from heat stress and also contribute to membrane stabilization, resistance to insects and microorganisms, and plant-plant signaling (Loreto et al. 1998; Copolovici et al. 2005; Baldwin et al. 2006; Keeling et al. 2006).

The rice genome has 33 TPS genes. OsTPS18 has localized in the cytoplasm and synthesized sesquiterpenes (E)- nerolidol and (E)-β-farnesene (Kiryu et al. 2018). OsTPS19 acts as an (S)-lemonine synthetase in rice and defends against Magnaporthe oryzae by inhibiting spore germination (Chen et al. 2018). OsTPS20 plays a major role in producing terpene volatiles during abiotic stress (Lee et al. 2015). OsTPS46 plays an important role in rice defense against Rhopalosiphum padi. (Sun et al. 2017). Additionally, a previous study revealed that the gamma irradiation of rice seedlings upregulated the expression of OsTPS19, OsTPS20, OsTPS25, OsTPS26, and OsTPS30, although the effect on OsTPS30 was inconclusive (Lee et al. 2015). In this study, we analyzed molecular and physiological function of OsTPS30 by gamma irradiation.

Plant materials and gamma irradiation

Rice plants (Oryza sativa spp. japonica cv. Ilpoom) were grown in half-strength Murashige and Skoog (MS) agar medium (Duchefa Biochemie, Haarlem, Netherlands) and cultured aseptically in a growth chamber at 28°C under a 16-h light/8-h dark cycle. The WT and OX OsTPS30 plants in A. thaliana were sown in plates containing half-strength MS agar medium with 1.5% of sucrose (Sigma-Aldrich, St. Louis, USA). The plates were incubated for 3 days at 4°C in darkness, and then transferred to a growth chamber for a subsequent incubation at 22°C with a 16-h light/8-h dark cycle and 70% of humidity. For the gamma-ray treatment, rice seeds were exposed to 100, 200, or 400 Gy for 24 h using a ⁶⁰Co gamma irradiator (150 TBq capacity; Atomic Energy of Canada Limited, Ottawa, Canada) at the Korea Atomic Energy Research Institute. A. thaliana plants during the vegetative stage and plants with fully expanded rosette leaves were independently irradiated 18 days after seeding. Plants were exposed to gamma-rays at 100, 200, 300, 400, or 500 Gy for 24 h, and the resulting phenotypes were evaluated after 14 days.

RNA isolation and quantitative real time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from the leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), after which the concentration and quality were assessed with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA). The RNA was then used as the template to synthesize first-strand cDNA using the ReverTra Ace-α- kit (Toyobo, Osaka, Japan). The qRT-PCR was conducted using the iQ™ SYBR^® Green Supermix (Bio-Rad, Hercules, USA), and the CFX96 Touch Real-Time PCR Detection System (Bio- Rad, Hercules, USA). Details regarding the qRT-PCR primers are listed in Table 1.

Table 1 . Primers used for the qRT-PCR analysis.

Gene	Primer name	Sequence (5‘ to 3‘)
OsTPS30	OsTPS30-F	ATGAAAGAACGGGTTCAAGTTGTGA
	OsTPS30-R	AATGTTATACGGCTCCATATAGAGCGAT
	OsTPS30-qRT-F	ACCACCACCATGCTTCTACA
	OsTPS30-qRT-R	ACTCCTTTATCCCAACGCAT
OsNAC10	OsNAC10-qRT-F	TACACAACACCTCATCCAA
	OsNAC10-qRT-R	ATGATCTAGGCGTGACTC
OsActin	OsACT-qRT-F	TGAAGTGCGACGTGGATATTAG
	OsACT-qRT-R	CAGTGATCTCCTTGCTCATCC
AtActin2	AtACT2-qRT-F	GCCATCCAAGCTGTTCTCTC
	AtACT2-qRT-R	GCTCGTAGTCAACAGCAACAA

Cloning of OsTPS30 and the production of transgenic plants

The OsTPS30 gene was amplified by PCR using gene- specific primers. The PCR product was inserted into the pCR™8/GW/TOPO^® vector (Invitrogen, Carlsbad, USA) and sequenced. After the sequence was verified, it was integrated into the pMDC83 destination vector using the recombination-based Gateway Cloning System (Invitrogen, Carlsbad, USA). The CaMV35S:OsTPS30-green fluorescence protein (GFP) construct was inserted into A. thaliana cells using an Agrobacterium tumefaciens-mediated (strain GV3101) floral dip method (Clough et al. 1998).

Total terpenoids of transgenic plants

The harvested plant material was immediately frozen in liquid nitrogen. To homogenize the tissue, one glass bead and cold 95% methanol was added to each sample tube and homogenized with QIAGEN. Remove glass beads and incubate the sample at room temperature for 48 h in dark. Samples were centrifuged to collect the supernatant. 1.5 mL chloroform was added to each and 200 μl sample supernatant was added to each. The Remark standard curve was prepared by diluting 200 μl of Linalool (Sigma-Aldrich, St. Louis, USA) solution in 1.5 ml of chloroform. The sample was vortexed and 100 μl of sulfuric acid (Sigma-Aldrich, St. Louis, USA) was added. The tubes were incubated in the dark for 2 h at room temperature for analysis. The supernatant was discarded and the precipitate was completely dissolved in 95% methanol. The sample was transferred to a colorimetric cuvette and absorbance was measured at 538 nm on EVOLUTION 260 BIO (Thermo Fisher Scientific, Waltham, USA) (Ghorai et al. 2012).

Measurement of antioxidant enzymes activity

For all antioxidant enzyme assays, the proteins from 18- day-old leaves samples (0.1g) were homogenized in 200 mM potassium phosphate buffer (pH 7.0) containing 0.1 mM ethylenediaminetetraacetic acid (EDTA) at 4°C. After homogenization, the samples were centrifuged at 15,000 rpm for 15 min at 4°C. Total protein content was determined by the Bradford assay using BSA as a standard (Bradford 1976). Peroxidase (POD) activity was determined with a modified Pütter (Pütter et al. 1974) method and Ascorbate peroxidase (APX) activity was analyzed according to the method of Mittler and Zilinskas (1993). Superoxide dismutase (SOD) activity was assayed using the sigma SOD determination kit (#19160) (Sigma-Aldrich, St. Louis, USA) following the manufacturer’s instructions. Catalase (CAT) activity was assayed using the Amplex^® Red Catalase Assay kit (A22180) (Thermo Fisher Scientific, Waltham, USA) following the manufacturer’s instructions.

Subcellular localization of OsTPS30

A. thaliana protoplasts were isolated from the leaves of 14-days-old WT and OX-OsTPS30 plants (CaMV35S: OsTPS30- GFP). All plants were incubated at 22 °C for 2 weeks under a 16-h light/8-h dark cycle. The fluorescence of the GFP and red chlorophyll autofluorescence was detected using the LSM800 confocal laser scanning microscope (Carl Zeiss, Jena, Germany) at an excitation wavelength of 488 nm.

OsTPS30 expression following gamma irradiation

To investigate the effect of gamma-ray on the expression of OsTPS30 expression, rice seeds were exposed to gamma-ray. A subsequent qRT-PCR revealed that OsTPS30 expression levels were upregulated in response to gamma-ray. Increasing the gamma-ray dosage from 0 to 400 Gy resulted in a 3.4-fold increase in the OsTPS30 transcript abundance (Fig. 1A). These observations were consistent with previously reported RT-PCR results (Lee et al. 2015). Moreover, the OsNAC10 expression was increased with increasing intensity of gamma-rays (Fig. 1B), which is reportedly upregulated by gamma irradiation (Park et al. 2014), was used as a positive control.

Figure 1.

Expression of OsTPS30 in rice plants exposed to gamma irradiation and overexpression of OsTPS30 in transgenic A. thaliana plants. (A) Rice seeds irradiated with gamma-rays at 100, 200, or 400 Gy. (B) OsNAC10 was used as a positive control for the gamma irradiation. The OsTPS30 transcript levels were analyzed using qRT-PCR, and normalized against those of OsACT. (C) Schematic diagram of the CaMV35S:OsTPS30-GFP plasmid construct used to generate the OsTPS30-overexpressing transgenic plant lines. (D) OsTPS30 transcript levels were analyzed using qRT-PCR. Transcript levels were standardized against those of AtACT2. (E) A linalool Analysis of total terpenoid of OX-OsTPS30 (#2-1, #9-17) and WT plants. Data is presented as the mean ± standard deviation for the three biological replicates. Asterisks indicate significant differences in the data for non-irradiated plants (0 Gy) or for the WT plants (Ler) at P < 0.05 (One-way ANOVA)

Overexpression of OsTPS30 in A. thaliana

The gamma-ray treatment clearly upregulated OsTPS30 expression. To assess the physiological function of OsTPS30 in plants irradiated with gamma-rays, we constructed OX- OsTPS30 plants. The OsTPS30 gene was PCR-amplified from rice. The pMDC83-OsTPS30:GFP vector was inserted into A. tumefaciens GV3101 cells for subsequent transformation of A. thaliana using a floral dip method (Fig. 1C). The T₃ homozygous transgenic plant lines, which were resistant to hygromycin, were produced by the self- pollination of T₂ transgenic plant lines. The OsTPS30 expression levels were evaluated by qRT-PCR (Fig. 1D). Three homozygous transgenic plant lines (#2-1, #4-6, #9-17) with different expression levels were selected to analyze the OsTPS30 expression levels and the effects of the gamma-ray treatment.

Identification of OsTPS30 as terpene synthase

Linalool, a monoterpene, was used to compare the synthesis of total terpenoid from the OX-OsTPS30 plants (#2-1, # 9-17) and WT plants. As a result, OX-OsTPS30 plants synthesized more total terpenoid than WT plants (Fig. 1E).

Effect of gamma irradiation on OX-OsTPS30 plants

To confirm rice OsTPS30 can increase the tolerance of other plants to gamma irradiation, we generated transgenic A. thaliana lines producing the GFP-tagged OsTPS30 protein. The 18-day-old plants exposed to gamma-rays at doses of 100-500 Gy for 24 h were transferred to normal growth conditions for a recovery period. After 14 days, the results showed that the height and weight of OX- OsTPS30 plants (#2-1, #4-6, #9-17) were significantly higher than those of WT plants. The phenotypes of the OX-OsTPS30 and WT plants were not significantly different under normal growing conditions (Fig. 2). These results indicate that OsTPS30 contributes to gamma irradiation resistance.

Figure 2.

The OX-OsTPS30 plants enhances tolerance to gamma irradiation. (A) The OX-OsTPS30 and WT plants were grown for 18 days after seeding and then irradiated for 24 h at 0, 100, 200, 300, 400, and 500 Gy. The irradiated plants were then analyzed after 2 weeks. White bar = 1 cm. (B) The height of OX-OsTPS30 and WT plants were also evaluated 2 weeks after the gamma irradiation. (C) The weight of OX-OsTPS30 and WT plants were evaluated 2 weeks after the gamma irradiation. The data is presented as the mean ± standard deviation for the three biological replicates. Asterisks indicate significant differences in the data for the WT plants (Ler) at P < 0.05 (One-way ANOVA)

Antioxidant enzyme activity of OX-OsTPS30 plant

Reactive oxygen species (ROS) scavenging is a common protective response to gamma irradiation. Activity of antioxidant enzymes, POD, APX, CAT and SOD, are induced by gamma irradiation (Moussa 2008). In order to determine the activities of the antioxidant enzyme of different dosages of gamma irradiation on OX- OsTPS30 (#2-1, #9-17) and WT plants, we measured the enzymatic activity of POD, CAT, APX and SOD (Fig. 3). At 200 Gy, the POD activity showed OX-OsTPS30 plants (#2-1, #9-17) were significantly higher than those of WT plants. However, when OX-OsTPS30 plants (#2-1, #9-17) were exposed to 400 Gy, POD activity was lower than WT plants (Fig. 3A). Regardless of gamma irradiation, CAT activity was higher OX-OsTPS30 plants (#2-1, #9-17) than WT plants (Fig. 3B). APX activity levels were increased in the OX-OsTPS30 plants (#2-1, #9-17) at 200 Gy gamma irradiation. However, there was no difference at 400 Gy gamma irradiation (Fig. 3C). At 0, 200 and 400 Gy gamma irradiation, SOD activity inhibition rate was 5~10% lower in the OX-OsTPS30 plants (#2-1, #9-17) than WT plants (Fig. 3D). These results suggested that OsTPS30 was positively regulated by regulating the activity of antioxidant enzyme involved in ROS induced by gamma irradiation.

Figure 3.

Antioxidant enzyme activity of OX-OsTPS30 and WT plants after gamma irradiation. (A) POD activity. (B) CAT activity. (C) APX activity. (D) SOD activity inhibition rate (%). Values are expressed as activity units per mg enzyme. Data is presented as the mean ± standard deviation for the three biological replicates. Asterisks indicate significant differences in the data for the WT plants (Ler) at P < 0.05 (One-way ANOVA)

Subcellular localization of OsTPS30

In general, monoterpene and diterpene synthases contain a transit peptides for translocation to the plastids (Tholl 2006; Arimura et al. 2009). OsTPS30 gene consists of 503 amino acid with a calculated molecular mass of 58.5 kDa. The amino acid sequence of OsTPS30 includes a DDxxD motif that has been implicated in binding with a divalent metal cofactor (Fig. 4). Sequence analysis using ChloroP 1.1 (http://www.cbs.dtu.dk/services/ChloroP/) predicted the localization of OsTPS30 to the chloroplast, suggest that OsTPS30 functions as a monterpene or diterpene synthases. However, as there was no direct experimental evidence for this behavior, we isolated A. thaliana protoplasts from the leaves of 14-day-old WT and OX-TPS30 plants. The GFP fluorescence was monitored, which revealed that OsTPS30-GFP fusion protein was localized in chloroplasts, suggest that OsTPS30 is a putative MEP pathway related terpene synthase (Fig. 5).

Figure 4.

Amino acid sequences of OsTPS30 (Os08g07080). The gene consists of 503 amino acids with a calculated molecular mass of 58.5 kDa. The putative conserved DDxxD motif is underline

Figure 5.

Subcellular localization of the OsTPS30-GFP fusion protein in A. thaliana protoplasts. Isolated protoplasts from the leaves of OX-OsTPS30 and WT plants (Ler). Isolated protoplasts were analyzed using confocal microscopy and photographed. DIC, Differential interference contrast image; GFP, Green fluorescence protein; Chl, Red chlorophyll autofluorescence utilized as a chloroplast marker. The white bar represents 10 µm

Terpenes are defense compounds present in diverse plant species. Terpenoids play a large role in plant development and stress responses. Terpene production may be induced by abiotic stresses, including gamma-rays, UV-rays, and high temperature, ultimately generating ROS (Jenkins 2009; Esnault et al. 2010). Several aspects regarding the genetic basis of plant-responses to ionizing radiation remain unknown. Lee et al. (2015) reported that the expression levels of five OsTPS genes (i.e., OsTPS19, OsTPS20, OsTPS25, OsTPS26, and OsTPS30) are induced by gamma irradiation. However, OsTPS30 was not functionally characterized. In the current study, we observed that OsTPS30 transcript abundance increased following exposures to gamma irradiation (Fig. 1A). These results imply that OsTPS30, encodes a putative rice TPS and gamma irradiation-inducible genes.

To characterize the physiological function of OsTPS30 following gamma irradiation, we generated Ox-OsTPS30 plants. Ghorai et al. (2012) reported, linalool, monoterpene, can indirectly measure total terpenoid. As result, total terpenoid were slightly increased in Ox-OsTPS30 plants (#2-1, # 9-17) than WT plants (Fig. 1E). We hypothesize that the increase in the total terpenoid of Ox-OsTPS30 plants may be a reason for resistance to gamma irradiation.

Plants height and weight are a major parameter influencing responses to gamma irradiation. The height and weight of OX-OsTPS30 plants higher than the WT plants after the gamma irradiation (Fig. 2). Previous studies concluded that OsTPS30 expression is upregulated by gamma irradiation (Fig. 1A). Moreover, we observed that OX-OsTPS30 plants were more resistant to the gamma irradiation than the WT plants (Fig. 2). There results, the increased expression of OsTPS30 in response to gamma irradiation and greater tolerance of plants that overexpressed OsTPS30, suggest that OsTPS30 plays an important role in resistant to gamma irradiation.

Produced ROS induce damages of protein, membrane and nucleic acids and negatively influence plant growth and development. The antioxidant role of monoterpenes under oxidative stress have been experimentally elucidated to directly mitigate the ozone level leading to decreased oxidative damage (Fares et al. 2008). The POD, CAT, APX, SOD activity showed OX-OsTPS30 plants (#2-1, #9-17) were significantly higher than the WT plants (Fig. 3). Thus, OsTPS30 increased the activity of antioxidant enzymes, thereby eliminating ROS increased by gamma irradiation.

Terpene synthases are involved in the MEP pathway in chloroplast. Monoterpene and diterpene synthases generally contain a transit peptide that enables them to translocate to plastids (Tholl 2006; Arimura et al. 2009). Amino acid sequence analysis using ChloroP 1.1, we could predict that OsTPS30 would be present in the chloroplast. However, chloroplast transit peptide was not found. We determined that OsTPS30-GFP fusion protein is mainly localized to the chloroplast (Fig. 5), implying this OsTPS30 is a monoterpene or diterpene synthase associated with MEP pathway.

In conclusion, transcription of OsTPS30 was strongly upregulated in rice plants after gamma irradiation. OX-OsTPS30 plants synthesized more total terpenoid than WT plants. OX-OsTPS30 plants tended to be more tolerant to gamma irradiation than WT plants. Following gamma irradiation, these OX-OsTPS30 plants showed significant differences in plant height and weight when compared to WT plants. The OsTPS30 increased the activity of antioxidant enzymes. Subcellular localization analysis of OsTPS30-GFP showed abundant fluorescent signals accumulated in the chloroplast, suggesting that OsTPS30 is putative MEP pathway-related terpene synthase.

This research was supported by grants from the Nuclear R&D Program by the Ministry of Science and ICT (MSIT), and the research program of KAERI, Republic of Korea.

S. W. Kim designed the experimental plan and wrote the manuscript. S. W. Kim and I. J. Jung performed the experiments. J. -B. Kim, S. -Y. Kang, S. H. Kim and H. -I. Choi supervised the project. All of the authors were involved in data analysis and interpretation.