Barley (Hordeum vulgare L.) is one of the most important crop plants worldwide and has been cultivated since ancient times for a variety of uses, especially as animal feed, human food, and malting substrate (Honsdorf et al. 2014). However, even though the production of other major cereal crops (e.g., maize, rice, and wheat) increases continuously, barley production has declined over the past two decades. Interestingly, though, since multiple studies have reported the beneficial effects of barley leaves on human health can be attributed to potent antioxidant activities (Kamiyama and Shibamoto 2012), barley is regaining research attention as a potential functional food.

Plant secondary metabolites have been used as important source of active traditional medicine for centuries. Flavonoids, as one of the most abundant natural secondary metabolites, are found in a variety of vegetative and reproductive tissues, including leaves, roots, flowers, and fruits (Middleton 1998). Such plant-derived flavonoids possess a variety of beneficial biological and pharmacological properties, including antioxidant, cardio-protective, anti-carcinogenic, anti-inflammatory, anti-proliferative, anti-angiogenic, and estrogenic properties (Seo et al. 2013). Saponarin, for example, is a naturally occurring diglycoside flavone (apigenin6-C-glucosyl-7-O-glucoside) that is likely responsible for the immunostimulatory, hypocholesterolemic, anti-carcinogenic, anti-inflammatory, anti-microbial, anti-protozoan, molluscicidal, and anti-oxidant properties of primary barley leaves (Cushnie and Lamb 2005; Hertog et al. 1993; Mojzisova et al. 2006; Moses et al. 2014; Seo et al. 2014).

Because polyphenolic compounds exhibit such a wide range of biological functions in plants, it is reasonable to question whether flavonoids could affect the yield stability of plants exposed to environmental stressors. In barley, genetic information and resources regarding flavonoid biosynthetic pathways are already available. Peukert et al. (2013), for example, partially sequenced the chalcone synthase (CHS), phenylalanine ammonia-lyase (PAL), cinnamate 4-hydroxylase (C4H), flavanone 3-hydroxylase (F3H), and dihydroflavonol 4-reductase (DFR) genes of 16 barley genotypes and developed single nucleotide polymorphism (SNP) markers. However, the genes of many other enzymes involved in flavonoid biosynthesis have yet to be identified. For instance, the genes involved in the conversion of naringenin to isovitexin (apigenin6-C-glucoside) have not been identified in barley (Marinova et al. 2007). Furthermore, the lack of suitable mutants and the poor characterization of existing mutant lines in barley impede the identification of new genes (Jende-Strid 1993; Reuber et al. 1997).

A variety of genes involved in flavonoid biosynthesis are subject to both transcriptional and post-translational regulation (Lepiniec et al. 2006; Weisskopf et al. 2006). For example, CHS, which catalyzes the first step in flavonoid synthesis, is regulated at the levels of transcription, translation, and enzymatic activity (Block et al. 1990; Hartmann et al. 2005; Hartmann et al. 1998; Knogge and Weissenbock 1986), and CHS expression is strongly affected by environmental stimuli, such as light and elicitors (Christie and Jenkins 1996; Faktor et al. 1997; Schulze-Lefert et al. 1989; Wingender et al. 1989). In addition, a variety of genes involved in the flavonoid biosynthetic pathway are differentially expressed in a spatiotemporal manner (Hutzler et al. 1998; Schulz and Weissenbo¨ck 1986; 1988). This suggests that the regulation of flavonoid biosynthetic pathways is more complicated than expected.

Even though saponarin in the flavonoid compounds of barley has highly accumulated during primary leaf development (Reuber et al. 1996), the regulation of saponarin biosynthesis has yet to be established. Accordingly, the aim of the present study was to investigate the relationship between saponarin content and the expression levels of three saponarin biosynthetic genes, namely CHS, chalcone isomerase (CHI), and UDP-Glc:isovitexin 7-O-glucosyltransferase (OGT; hereafter, HvCHS, HvCHI, and HvOGT), in young barley seedlings. The effects of abiotic stressors (e.g., light/dark transition, drought, and low or high temperature) on saponarin content and gene expression were also investigated.

Database Searching and Sequence Analysis

The sequence data of barley saponarin biosynthesis-related genes (HvCHS, HvCHI, and HvOGT) were collected from the NCBI (https://www.ncbi.nlm.nih.gov/) and Phytozome (https://phytozome.jgi.doe.gov/pz/portal.html) databases. The HvCHS, HvCHI, and HvOGT genes used in this study are listed in Table 1. For multiple sequence alignments, the nucleotide or amino acid sequences of HvCHS and HvOGT were performed using a ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/) with default parameters.

Table 1 . Saponarin biosynthesis-related genes analyzed in this study.

Gene Name	Transcript name	Chromosome localization	Direction	Designation for this study
Chalcone synthase	HORVU2Hr1G116390.2	Chr2H:737966163..	R	HvCHS1
		737969220
	HORVU2Hr1G004170.4	Chr2H:9398287..	R	HvCHS2
		9446222
	HORVU2Hr1G005220.3	Chr2H:11395530..	R	HvCHS3
		11400280
Chalcone isomerase	HORVU5Hr1G112670.5	Chr5H:639991759..	F	HvCHI
		639992903
UDP-Glc:isovitexin 7-O-glucosyltransferase	HORVU7Hr1G031800.2	Chr7H:65071583..	R	HvOGT1
		65073314
	HORVU3Hr1G110110.2	Chr3H:680047819..	R	HvOGT2
		680049439

Plant Materials and the Growth Conditions

Barley (Hordeum vulgare L.) seeds were soaked in water for 1 d, germinated in the dark over 2 d, transferred to soil, and then maintained in a growth room (23°C, 16-h photoperiod, light intensity of 120 mmol m^-2 s^-1). Leaves were collected for analysis over a 12-d period.

For the light/dark transition treatment, 15-d-old barley plants that had been grown under continuous light conditions were transferred to a dark chamber at 23°C for 1 or 2 d. For the drought treatment, 15-d-old barley plants were removed from the soil and air-dried on a filter paper in a growth chamber at 23°C for 1 or 2 d. For the low and high-temperature treatments, 15-d-old barley plants were placed in dark chambers at 4°C and 37°C, respectively, for 1 or 2 d. After harvesting, the samples were immediately frozen in liquid nitrogen for subsequent analysis. All experiments involved three biological replicates (independently harvested samples).

Ultra-high performance liquid chromatography (UHPLC) analysis

To prepare barley seedling extracts, 0.5~1 g dried barley seedlings were extracted in 20 mL 80% methanol (v/v) with shaking at room temperature for 1 d. The saponarin contents of the extracts were measured using UHPLC with a UV detector (Dionex Ultimate 3000; Thermo Scientific, Waltham, MA, USA; Seo et al. 2014). Chromatographic separation was performed using a reversed-phase HPLC column (ACQUITY BEH C18, 2.1 mm × 100 mm, Waters, Milford, MA, USA) at 35°C, with 0.1% TFA in water (A) and acetonitrile (B) as the mobile phases and with a flow rate of 0.5 mL/min. The gradient program was as follows: 0~3 min, 3% B; 3~10 min, 3~15% B; 10~13 min, 15~30% B; 13~15 min, 30~50% B; 15~16 min, 50~90% B; 16~18 min, 90% B; 18~20 min, 90~3% B. The injection volume was 2 µL, and the detection wavelength was 325 nm. The saponarin content of each sample was identified by directly comparing the retention times to those of saponarin standards (Extrasynthese, Lyon, France). Three technical duplicates were performed for each of the three biological replicates (independently harvested samples). Statistical analyses were performed using SPSS for Windows (version 12.0; SPSS, Seoul, Korea). The student’s t-test was used to compare mean saponarin contents.

RNA Expression Analysis

Total RNA was extracted from the samples using Trizol reagent (Invitrogen, Carlsbad, CA, USA), and the quality of the resulting RNA was assessed using a Nanodrop ND-2000 spectrophotometer (Nanodrop Technologies, Waltham, MA, USA). Only high-quality RNA samples (A260/A230 > 2.0 and A260/A280 > 1.8) were used for subsequent experiments. To check RNA expression, Reveres Transcription-polymerase chain reaction (RT-PCR) or real time–quantitative PCR (RT-qPCR) analyses were performed.

Complementary DNA (cDNA) was synthesized from 5 µg RNA, following the protocol of the ReverTra Ace qPCR RT Master Mix kit (Toyobo, Osaka, Japan), and RT-qPCR analysis was conducted in 96-well plates using a CFX real-time system (Bio-Rad, Hercules, CA, USA), THUNDERBIRD SYBR qPCR mix (Toyobo), and gene-specific RT-qPCR primers (Table 2) were designed using QuantPrime (http://quantprime.mpimp-golm.mpg.de/) and mRNA sequences from the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/): HvCHSs (accession numbers: AK248641, AK354067, and AK357384), HvCHI (accession number: AK374952), and HvOGTs (accession numbers: AK371730 and AK375231). In accordance with the best-established RT-qPCR practices (Janska et al. 2013; Zhang et al. 2018), HvPP2AA3 (accession number: AK251150) was included as a stably expressed reference gene, and three technical duplicates were performed for each of the three biological replicates. To determine the relative abundance of the transcripts, the data were analyzed using Bio-Rad CFX Manager (Bio-Rad). Statistical analyses were performed using SPSS for Windows (version 12.0; SPSS, Seoul, Korea). The student’s t-test was used to compare mean expression levels.

Table 2 . Oligonucleotides used for RT–PCR and RT–qPCR analysis in this study.

Gene name	Gene ID	Primers (5' to 3')	Direction
HvCHS1	AK248641	TTTCATCATGGACGAGATGC	F
		TGTGGAGGACGACGGTCT	R
		CGCGACACAGACTAACAGGA	R
HvCHS2	AK357384	TTTCATCATGGACGAGATGC	F
		TCAAACGACCACGATCTCAA	R
HvCHS3	AK354067	TTTCATCATGGACGAGATGC	F
		GGAATGCGTAAGCCAAGAGA	R
HvCHI	AK374952	AACTGTGTCGCGTACTGGAA	F
		GGGGAGTGCGTGAAGAGTAT	R
HvOGT1	AK375231	TGTCGAGATAGTTTGTCGGGTGTG	F
		ATCACGCCGTCGGATGGATATCTG	R
HvOGT2	AK371730	CAGCAGGAGGAACCTGGATA	F
		CTGGCACCAAGCAGCAGAT	R
HvPP2AA3	AK251150	ACATCCCTCTGCTGGCTAGT	F
		GCCAGTCGCTTCAAGTTGTT	R

Identification of saponarin biosynthetic pathway genes in barley

To identify saponarin biosynthesis-related genes in barley, we searched the NCBI and Phytozome databases. The present study showed that three HvCHSs, one HvCHI, and two HvOGTs in barley genome (Table 1). Based on sequence similarity to other plant homologs, we designated the three HvCHSs as HvCHS1 [HORVU2Hr1G116390.2 (AK248641)], HvCHS2 [HORVU2Hr1G004170.4 (AK357384)], and HvCHS3 [HORVU2Hr1G005220.3 (AK354067)], and the two HvOGTs as HvOGT1 [HORVU7Hr1G031800.2 (AK375231)] and HvOGT2 [HORVU3Hr1G110110.2 (AK371730)].

We investigated the temporal expression patterns of three HvCHSs and two HvOGTs during the developmental stages. Only HvCHS1 transcripts, but not HvCHs2 and HvCHS3 transcripts, were expressed in all developmental stages (Fig. 1a). HvOGT1 transcripts were expressed in all stages, whereas HvOGT2 transcripts were detected in later stages (from 18 to 27 d) (Fig. 1b). Furthermore, higher levels of HvCHS1 and HvOGT1 expression were seen in early stages (from 1 to 6 d). Because higher accumulation of saponarin is found in earlier developmental stages (Reuber et al. 1996), we chose HvCHS1, HvCHI, and HvOGT1 for subsequent experiments.

Figure 1.

Expression levels of HvCHS1/2/3 and HvOGT1/2 members during barley developmental stages. (a) Expression levels of HvCHS1/2/3 members. Barley plants grown at 23°C under long-day (LD) conditions were harvested at 1, 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30 d, and expression levels were analyzed using RT–PCR. HvPP2AA3 was used as an internal control. (b) Expression levels of HvOGT1/2 members

Saponarin biosynthesis and accumulation in barley seedlings

Because saponarin accumulates to high levels as the major flavonoid compound during primary barley leaf development (Reuber et al. 1996), the expression of saponarin biosynthetic pathway genes in young barley seedlings were examined in detail. Barely plants were grown at 23°C under LD conditions and harvested after 1, 3, 6, 9, or 12 d. Expression analysis revealed that HvCHS1 expression increased significantly at Day 3 and then decreased to Day 12, whereas HvCHI and HvOGT1 expression peaked on either Day 1 or Day 3 days and then decreased rapidly to Day 12 (Fig. 2a). These results are consistent with previous reports that CHS and CHI expression are developmentally regulated (Schulz and Weissenböck 1988) and that CHS protein is present in young rice leaves but not in old leaves (Reddy et al. 1996).

Figure 2.

Saponarin content and related gene expression in young barley seedlings. (a) Expression levels of HvCHS1, HvCHI, and HvOGT1. Barley plants grown at 23 °C under LD conditions were harvested at 1, 3, 6, 9 and 12 d, and expression levels of HvCHS1, HvCHI and HvOGT1 in each sample were analyzed using RT–qPCR. The expression levels of each gene at Day 1 were set to 1. Values and error bars indicate mean ± SEM values (n = 3). Asterisks indicate significant differences, when compare to the expression level at Day 1 (Student’s t-test, ^*P < 0.05, ^**P < 0.01). n.s., not significant. (b) Saponarin content of young barley seedlings. The accumulation of saponarin was determined by UHPLC analysis

The saponarin contents of young barley seedling extracts were also investigated. UHPLC analysis revealed that saponarin content highly accumulated at 3 and 6 d and slightly reduced until 9 and 12 d (Fig. 2b). These results indicated that higher expression of three saponarin biosynthetic genes at 1 or 3 d caused high accumulation of saponarin during early developmental stages of barley seedlings.

Effect of photoperiod on saponarin biosynthesis and accumulation

Because light/dark conditions have been reported to affect CHS and CHI expression (Dao et al. 2011; Wang et al. 2012) and because light is important for inducing or regulating plant metabolism (Yang et al. 2018), 15-d-old barley seedlings were transferred to a dark chamber for 1 or 2 d, and then HvCHS1, HvCHI, and HvOGT1 expression were measured. Expression analysis revealed that HvCHS1 and HvCHI expression decreased dramatically after the light/dark transition, whereas HvOGT1 expression declined after 2 d under dark conditions (Fig. 3a). Many studies have reported that CHS and CHI promoters contain the CACGTG motif (i.e., G-box), which is associated with important light responses (Kaulen et al. 1986; Schulze-Lefert et al. 1989; Staiger et al. 1989), and other regulatory domains, such as the Box I, Box II, Box III, Box IV, or H-box (CCTACC) domains, which are also found in the CHS promoter region, are also involved in light responses (Block et al. 1990; Lawton et al. 1990; Weisshaar et al. 1991). This result was consistent with the aforementioned findings.

Figure 3.

Effect of light/dark transition on the saponarin content and related gene expression of young barley seedlings. (a) Expression levels of HvCHS1, HvCHI, and HvOGT1. Fifteen-d-old barley plants grown at 23°C under continuous light conditions were transferred to dark conditions for 1 or 2 d, and the expression levels of HvCHS1, HvCHI, and HvOGT1 in each sample were analyzed using RT–qPCR. The expression levels of each gene at Day 0 were set to 1. Values and error bars indicate mean ± SEM values (n = 3). Asterisks indicate significant differences, when compared to the expression level at Day 0 (Student’s t-test, ^*P < 0.05, ^**P < 0.01). n.s., not significant. (b) Saponarin content of light-stressed barley seedlings. The accumulation of saponarin was determined by UHPLC analysis.

The effect of light/dark transition on the saponarin contents of young barley seedling extracts was also investigated. However, the treatment had no effect on saponarin content (Fig. 3b). Given the finding that in vitro translation products of oat CHS mRNA are highly found at the dark or light phase (Knogge and Weissenbock 1986), it was expected that neither light nor dark would directly influence the translation of certain flavonoid biosynthetic genes, even if light exposure affects the expression of some flavonoid biosynthetic genes. These results indicate that the reduced HvCHS1, HvCHI, and HvOGT1 expression of the light-to-dark transitioned barley seedlings did not affect saponarin content, which suggests that HvCHS1, HvCHI, and HvOGT1 translation still occurs in darkness.

Effect of abiotic stress on saponarin biosynthesis and accumulation

Because drought and temperature are the main environmental factors that affect the production of secondary metabolites, such as flavonoids, which are produced to cope with the oxidative stress generated by abiotic stresses (Yang et al. 2018), 15-d-old barley seedlings were exposed to dehydration conditions for 1 or 2 d, and then HvCHS1, HvCHI, and HvOGT1 expression were measured. Expression analysis revealed that HvCHS1 and HvCHI expression decreased dramatically, whereas HvOGT1 expression was unaffected (Fig. 4a). The saponarin content of the dehydrated barley seedlings was slightly lower at Day 2, although not significantly (Fig. 4b).

Figure 4.

Effect of drought on the saponarin content and related gene expression of young barley seedlings. (a) Expression levels of HvCHS1, HvCHI, and HvOGT1. Fifteen-d-old barley plants grown at 23°C under long day (LD) conditions were subjected to dehydration conditions for 1 or 2 d, and the expression levels of HvCHS1, HvCHI, and HvOGT1 in each sample were analyzed using RT–qPCR. The expression levels of each gene at Day 0 were set to 1. Values and error bars indicate mean ± SEM values (n = 3). Asterisks indicate significant differences, when compared to the expression level at Day 0 (Student’s t-test, ^*P < 0.05, ^**P < 0.01). n.s., not significant. (b) Saponarin content of drought-stressed barley seedlings. The accumulation of saponarin was determined by UHPLC analysis

To investigate whether low or high temperatures affect saponarin content or saponarin biosynthetic gene expression, 15-d-old barley seedlings were transferred to low- or high-temperature conditions for 1 or 2 d, and HvCHS1, HvCHI, and HvOGT1 were measured. The expression patterns of HvCHS1, HvCHI, and HvOGT1 were affected similarly by low- and high-temperature conditions. More specifically, HvCHS1 and HvCHI expression declined dramatically, whereas HvOGT1 expression remained stable (Fig. 5a, b). However, neither low- nor high-temperature conditions significantly affected saponarin content (Fig. 5c, d). These results indicate that the reduced expression levels of HvCHS1 and HvCHI, but not HvOGT1, were not correlated with saponarin accumulation under abiotic stress conditions.

Figure 5.

Effect of low and high temperature on the saponarin content and related gene expression of young barley seedlings. (a and b) Expression levels of HvCHS1, HvCHI, and HvOGT1. Fifteen-d-old barley plants grown at 23°C under long day (LD) conditions were transferred to low (4°C, a) or high (37°C, b) temperature conditions for 1 or 2 d, and the expression levels of HvCHS1, HvCHI, and HvOGT1 in each sample were analyzed using RT-qPCR. The expression levels of each gene at Day 0 were set to 1. Values and error bars indicate mean ± SEM values (n = 3). Asterisks indicate significant differences, when compared to the expression level at Day 1 (Student’s t-test, *P < 0.05, **P < 0.01). n.s., not significant. (c and d) Saponarin content of low (4°C, c) and high (37°C, d) temperature-stressed barley seedlings. The accumulation of saponarin was determined by UHPLC analysis.

Saponarin is synthesized from isovitexin (apigenin6-C-glucoside) after the addition of glucose in the 7-O position catalyzed by HvOGT as a soluble UDP-Glc:flavone glucosyltransferase (Blume et al. 1979). Because HvOGT catalyzes the final step of saponarin synthesis (Marinova et al. 2007), the stable expression of HvOGT1 under abiotic stress conditions, such as drought and extreme temperature (Figs. 4 and 5), could maintain the level of saponarin content without significant change.

Flavonoids, such as saponarin, are used as medicinal ingredients and food additives and also served as plant secondary metabolites that provide protection against biotic and abiotic stresses. Even though saponarin mainly accumulates during early stages of barley leaf development, the correlation between saponarin content and the expression of saponarin biosynthetic pathway genes is not well understood. In the present study, the upregulation of HvCHS1, HvCHI, and HvOGT1 during early stages was associated with saponarin accumulation at later stages. In addition, exposure to abiotic stresses significantly affected the expression of HvCHS1 and HvCHI but failed to affect either HvOGT1 expression or saponarin accumulation. Even though the expression levels of HvCHS1, HvCHI, and HvOGT1 under abiotic stress were not correlated with saponarin content, the results of the present study may provide a potential and profitable way to increase the accumulation of bioactive compounds, such as saponarin, in young barley seedlings.

This work was supported by a grant from the “Cooperative Research Program for Agriculture Science & Technology Development (Project title: Identification and standardization of ameliorating effect on bioactive compounds for blood lipid levels from crop sprouts, Project No.: PJ01324902)”, Rural Development Administration (RDA), Republic of Korea. We wish to express our gratitude towards Kyung Sook Chung, Hye Rim Shin, A Mi Yoon, Young Kwang Song, Wonyoung Park and Jae-Hyeok Park for their assistance.