Sitemap
JPB 로고The Korean Society of Plant Biotechnology｜Contact Us
닫기
Search
Advanced Search +
닫기
Quick links
Most Cited Most Read Archives Go to e-Submission

Research Article

Split Viewer

J Plant Biotechnol (2024) 51:121-128

Published online May 29, 2024

https://doi.org/10.5010/JPB.2024.51.013.121

© The Korean Society of Plant Biotechnology

Solanum pinnatisectum 엽록체 전장유전체 구명 및 특이적 분자마커의 개발

손서연･박태호

대구대학교 원예학과

Received: 18 April 2024; Revised: 6 May 2024; Accepted: 6 May 2024; Published: 29 May 2024.

Completion of chloroplast genome sequence and development of PCR-based markers for Solanum pinnatisectum

Seoyeon Son ･Tae-Ho Park

Author Info. +

Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea

Correspondence to : e-mail: thzoo@daegu.ac.kr

Received: 18 April 2024; Revised: 6 May 2024; Accepted: 6 May 2024; Published: 29 May 2024.

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Go to

Solanum pinnatisectum, originating from Mexico, is a wild potato species valued for its resistance to various insects and pathogens, including the Colorado potato beetle, potato tuber moth, Phytophthora infestans, and Erwinia carotovorum. Despite its advantageous traits, S. pinnatisectum is diploid with an endosperm balanced number (EBN) of one, presenting sexual reproduction barriers with cultivated potatoes. Cell fusion methods can be employed to circumvent these barriers and integrate beneficial traits from S. pinnatisectum into cultivated potatoes. In this study, therefore, the chloroplast genome sequence of S. pinnatisectum was completed using next-generation sequencing (NGS) technology and compared with those of ten other Solanum species to develop specific PCR markers for S. pinnatisectum. The complete chloroplast genome of S. pinnatisectum is 155,597 bp in length and exhibits structural organization similar to those of other Solanum species. Sequence alignment of the complete chloroplast genomes sequences of eleven Solanum species, including S. pinnatisectum, identified 216 SNPs and 26 InDels unique to S. pinnatisectum. Based on these InDels and SNPs, six PCR-based markers were developed to identify the plastid genotype of S. pinnatisectum. The results of this study will be instrumental in distinguishing S. pinnatisectum from other Solanum species, selecting suitable genotypes for potato breeding through somatic hybridization, and accelerating the breeding program using S. pinnatisectum.

Keywords cpDNA, InDels, PCR-based marker, Potato, SNPs, Solanum pinnatisectum

서 론

Go to

Solanum pinnatisectum은 멕시코에서 자생하는 근연 야생종 중 하나로, 그 배수성이 2배체로 4배체인 재배종 감자(S. tuberosum L.)와 차이있다(Chen et al. 2004; Hawkes 1990). S. pinnatisectum은 역병, 풋마름병, 감자줄기검은병, 뿌리혹선충, 콜로라도감자잎벌레 그리고 감자바이러스 X, Y (PVX, PVY)등에 대한 저항성을 가지고 있는 것으로 알려져 감자 신품종 육성에 활용 가치로 중요한 재료가 될 수 있다(Chen et al. 2003; Kuhl et al. 2001; Machida-Hirano 2015; Menke et al. 1996; Srivastava et al. 2016). 하지만, S. pinnatisectum의 게놈 구성비(EBN)는 1로, 4인 재배종 감자와의 차이로 인한 교잡불화합성 때문에 전통적인 교배육종이 어려운 실정이다(Cho et al. 1997; Jansky 2006). 이러한 생리적 장벽을 극복하기 하기 위한 하나의 방법으로는 체세포잡종을 이용한 계통 육성이 이용될 수 있다(Cho and Park 2014). 따라서, S. pinnatisectum을 이용하여 체세포잡종 계통을 육성하는 연구가 진행 중에 있으며, 향후 체세포잡종 계통이 확보되었을 때, S. pinnatisectum과 S. tuberosum의 핵내 또는 세포질 유전체가 어떻게 체세포잡종에 전달되는지를 확인하기 위해, 본 연구에서는 S. pinnatisectum 엽록체의 유전체 염기서열 정보를 구명하여 S. tuberosum과 구별할 수 있는 S. pinnatisectum 특이적으로 나타나는 분자마커를 개발하고자 하였다.

엽록체 유전체는 전형적으로 한 쌍의 inverted repeats (IRs) 영역, small single copy (SSC) 영역, 그리고 large single copy (LSC) 영역으로 구분되는 4분할 원형의 이중가닥 분자구조로 구성되어 있다(Yurina and Odintosova 1998). 본 연구에서는 S. pinnatisectum 엽록체 유전체 전체 염기서열에 대한 정보를 제공하고, 다른 야생종 엽록체 유전체의 염기서열과 비교하여 S. pinnatisectum에 특이적으로 나타나는 분자마커 개발에 대한 결과를 제공하고자 한다.

재료 및 방법

Go to

식물재료

S. pinnatisectum의 엽록체 전체 유전체의 염기서열 분석에는 S. pinnatisectum 계통 중 하나인 SP10이 이용되었다. 또한, S. pinnatisectum에 특이적으로 나타나는 분자마커를 개발하기 위해 S. pinnatisectum 계통 중 하나인 SP10과 더불어 SP1이 추가되었으며, 자체 수집한 S. nigrum을 제외한 감자 품종 ‘대지(DJ)’, ‘대서(DS)’, ‘수미(SM)’와 12개의 야생종 SA (S. acaule, PI310970), SB2 (S. brevicaule, PI205394), SC1 (S. cardiophyllum, PI341233), SK (S. kurtzianum, PI578236), SC2 (S. commersonii, PI558050), SH2 (S. hougasii, PI161174), SS (S. stoloniferum, PI160224), SM1 (S. mochiquense, PI338616), SJ (S. jamesii, PI578326), SV1 (S. verrucosum, PI160228), SV2 (S. vernei, PI230468), SI (S. iopetalum, PI230459)는 국립식량과학원 고령지농업연구소로부터 분양 받아 기내식물체로 증식하여 이용하였다.

DNA 분리

분양받은 식물재료들은 기내에서 증식되어 약 100 mg의 식물체를 채취하여 Genomic DNA Extraction kit (Plants) (RBC, New Taipei City, Taiwan)를 이용하여 DNA를 추출하였다.

S. pinnatisectum 엽록체 전장유전체의 완성 및 분석

S. pinnatisectum 엽록체 전체 유전체의 염기서열 분석에는 S. pinnatisectum 계통 SP10을 대상으로 DNA를 추출하여 진행되었으며, 전체 염기서열(raw data)은 Macrogen (Macrogen, Seoul, South Korea)에서 제공하는 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA) 플랫폼을 이용하였다. 획득한 전체 염기서열(raw data) 정보는 파이젠 생물정보학 파이프라인(http://phyzen.com)의 CLC assembly cell package version 4.2.1 (CLC Inc, Rarhus, Danmark)를 이용한 de novo assembly에 의해 분석하여 완성되었다(Cho et al. 2015). 우선, CLC quality trim 프로그램을 이용하여 전처리 과정을 거쳐 Phred score 20 미만의 low-quality 정보를 제외한 염기서열을 추출하여 얻은 후, CLC de novo assemble 프로그램을 이용하여 dnaLCW 방법으로 조립하였다. 그리고, 엽록체 유전체의 염기서열로만 구성된 contig만을 선별하고, gap-filling을 통한 확장 및 통합을 거쳐 엽록체 유전체를 완성하였다. 완성된 엽록체 유전체에 trimmed read 전체를 mapping하여 read depth를 계산하고, BLASTN을 실시하여 확인된 homology가 가장 높은 종의 전장 엽록체 유전체 서열을 확인하고, BLASTZ (Schwartz et al. 2003) 분석을 실시하였다.

완성된 S. pinnatisectum 엽록체 유전체 서열에 존재하는 유전자 부위를 결정하기 위해 Geseq 프로그램을 이용하였고, BLAST search를 기반으로 manual curation을 수행하여 유전자를 최종적으로 구명하였다. 엽록체 유전체 전체 유전자는 OGDraw 프로그램에 원형의 유전자지도에 표시하였다(Lohse et al. 2007; Tillich et al. 2017).

엽록체 유전체의 비교 및 분자마커 개발

엽록체 유전체 정보를 기반으로 한 S. pinnatisectum과 다른 종들의 유연관계 분석을 진행하기 위해 NCBI (National Center for Biotechnology Information)에 등록되어 있는 S. tuberosum (KM489056 및 NC_008096)을 포함하는 다른 가지과(Solanaceae) 총 17종 S. stoloniferum (MF471373), S. verrucosum (MK690625), S. commersonii (KM489054), S. hougasii (MF471372), S. hjertingii (MK690623), S. demissum (MK036508), S. berthaultii (KY419708), S. brevicaule (MK036507), S. chacoense (MF471371), S. acaule (MK036506), S. bulbocastanum (DQ347958), S. cardiophyllum (MK690622), S. jamesii (MK690624), S. lycopersicum (NC_007898), S. nigrum (KM489055), Capsicum annuum (JX270811)과 비교하여 계통수를 작성하였다. 엽록체 코딩서열을 기반으로 MEGA6.0 프로그램으로 분석하였으며, Kimura 2-parameter 모델 기반의 Maximum likelihood 방법을 이용하여 1,000번의 Bootstrap 옵션을 적용하였다(Tamura et al. 2013).

S. pinnatisectum에 특이적으로 나타나는 분자마커를 개발하기 위해 S. pinnatisectum 엽록체 전장 유전체의 염기서열은 NCBI로부터 얻은 S. iopetalum (MZ233587), S. mochiquense (MZ233589), S. tuberosum (NC_008096), S. berthaultii (KY419708), S. hougasii (MF471372), S. commersonii (KM489054), S. acaule (MK036506), S. bulbocastanum (DQ347958)의 엽록체 전장 유전체 염기서열과 ClustalW2 (EMBL; http://www.ebi.ac.uk/Tools/msa/clustalw2)에 의해 다중정렬을 수행하여 S. pinnatisectum에 특이적으로 나타나는 Indel과 SNP를 구명하고 이를 대상으로 S. pinnatisectum 특이적인 마커 개발을 진행하였다.

InDel의 경우 InDel 영역에서 특이적인 primer를 디자인하여 allele 특이적 분자마커를 개발하고자 하였고, SNP의 경우에는 dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html)을 이용하여 S. pinnatisectum에 특이적으로 작용하거나 S. pinnatisectum을 제외한 다른 Solanum 종들에 특이적으로 작용하는 제한효소를 찾아 확인한 후, Primer를 디자인하였다. S. pinnatisectum (SP10 및 SP1)과 재배종 감자 ‘대지(DJ)’, ‘대서(DS)’, ‘수미(SM)’, S. nigrum 및 총 12개의 감자 근연야생종 계통 SA (S. acaule, PI310970), SB2 (S. brevicaule, PI205394,), SC1 (S. cardiophyllum, PI341233), SM1 (S. mochiquense, PI338616), SC2 (S. commersonii, PI558050), SH2 (S. hougasii, PI161174), SK (S. kurtzianum, PI578236), SJ (S. jamesii, PI578326), SS (S. stoloniferum, PI160224), SV1 (S. verrucosum, PI160228), SV2 (S. vernei, PI230468), SI (S. iopetalum, PI230459)을 대상으로 Thermocycler (Biometra, Göttingen, Germany)을 이용하여 총 25 ul 볼륨(약 20 ng genomic DNA, 10x reaction buffer, 10 mM dNTPs, 10 pMol의 forward/reverse primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 PCR을 진행하였고, PCR의 결과는 핵산 염색 용액인 StaySafe (RBC, New Taipei City, Taiwan)를 이용하여 염색 후 1.8% agarose gel에서 확인하였다. 필요에 따라 확인한 PCR 결과물을 대상으로 제한효소를 처리하였다.

결과 및 고찰

Go to

S. pinnatisectum의 엽록체 전장 유전체

S. pinnatisectum의 엽록체 전체 유전체의 염기서열 NGS 기술을 이용하여 완성되었다. S. pinnatisectum의 데이터 총 염기서열은 13,042,942 read를 통해 약 1.9 Gbp를 생산하였고, 평균 길이는 151.0 bp였다. CLC Assembly Cell package version 4.2.1 내의 프로그램 CLC quality trim을 통한 전처리과정을 거쳐, Phred score 20 미만의 low-quality 정보를 제외한 염기서열로 평균 길이 약 147.6 bp인 염기서열 정보 약 1.7 Gbp를 얻을 수 있었다. 이는 전체 raw data의 약 90.28%로 같은 package 내의 프로그램 de novo assemble을 이용한 dnaLCW 방법으로 조립하고, 이후 엽록체 유전체 contig만을 선발하고, gap-filling 과정을 거쳐 확장 및 통합하여 전체 엽록체 유전체를 완성하였다. 그 결과, 총 염기서열의 길이는 155,597 bp이며, aligned read의 수는 918,059개, 평균 coverage는 868.64x로 확인되었다. 완성된 유전체 서열에 전체 trimmed read를 mapping한 결과 read depth는 179이상 인 것으로 확인되었다. 또한, 전체 엽록체 유전체 염기서열의 구조는 다른 식물의 엽록체 전장 유전체와 유사한 형태의 원형 이중가닥 분자로 86,012 bp의 LSC, 18,395 bp의 SSC, 그리고 한 쌍의 25,595 bp IRa/IRb 영역으로 나누어져 있었다(Fig. 1).

Fig. 1. Gene map of the chloroplast genome of S. pinnatisectum. Genes on the outside and inside of the map are transcribed in clockwise and counterclockwise directions, respectively

S. pinnatisectum 전체 엽록체 유전체에는 105개의 단백질 코딩 유전자, 8개의 rRNA, 45개의 tRNA를 포함한 총 158개의 유전자가 분포하고 있었으며, 그 중 단백질 코딩 유전자 11개, tRNA 9개, rRNA 4개는 Ira과 IRb 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 1). 전체 염기서열 중 코딩 영역이 차지하는 비율은 59.2%로 158개의 유전자 평균 길이는 약 583.3 bp로, 이 중 단백질 코딩 유전자의 평균 길이는 764.8 bp로 51.6%로 분포하고 있었고, tRNA의 평균 길이는 62.0bp로 1.8%로 분포하였으며, rRNA의 평균 길이는 1,133.5 bp로 5.8%의 비율로 분포되어 이는 다른 Solanum 속의 종들과 매우 유사하였다(Cho et al. 2016, 2019; Cho and Park 2016; Daniell et al. 2006; Gargano et al. 2005; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021a, 2021b, 2022a, 2022b)(Table 1).

Table 1 . Results of comparative analysis of the chloroplast genome sequence of S. pinnatisectum with those of 14 Solanaceae species

SpeciesAccession no.Total length (bp)GC content (%)Total no. of genesNo. of tRNANo. of rRNAReference
S. pinnatisectumMZ233590155,59737.90134364In this study
S. hjertingiiMK690623155,54537.88134364Park (2023a)
S. cardiophyllumMK690622155,57037.90134364Park (2023b)
S. acauleMK036506155,57037.84135364Park (2022b)
S. brevicauleMK036507155,53137.87135364Park (2022a)
S. demissumMK036508155,55837.87135364Park (2021b)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*The data have been partially adopted from Park (2023b).

엽록체 전장 유전체 비교

계통수 작성을 위해 S. pinnatisectum의 엽록체 전장 유전체와 다른 가지과에 속하는 18종의 엽록체 전장 유전체의 코딩서열을 비교 및 분석하였다(Fig. 2). 그 결과, S. pinnatisectum은 재배종 감자 S. tuberosum을 포함하는 다수의 Solanum 종들과 같은 그룹에 위치함을 확인하였으며, S. cardiophyllum와 S. jamesii와 가장 근접한 유연관계를 나타내었을 뿐만 아니라, 전체 염기서열에서도 각각 99.93%, 99.95%로 가장 높은 유사도를 나타내었다. 반면에 까마중(S. nigrum), 고추(C. annuum), 토마토(S. lycopersicum)와는 다소 유연관계가 먼 것을 확인하였다.

Fig. 2. Maximum-likelihood phylogenetic tree of S. pinnatisectum with 18 species belonging to the Solanaceae family, based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. Data are partially adopted from Park (2023a)

S. pinnatisectum의 엽록체 유전체 정보를 이용하여 S. pinnatisectum과 다른 Solanum 종들을 구분할 수 있는 S. pinnatisectum에 특이적으로 나타나는 분자마커 개발을 위해 ClustalW2 (EMBL; https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 S. pinnatisectum 및 10개의 Solanum 종의 엽록체 전장 유전체를 대상으로 다중정렬을 수행하였다(Fig. 3). 그 결과, S. pinnatisectum 특이적인 InDel과 SNP 영역은 각각 26개와 216개인 것으로 확인되었고, InDel은 26개 중 25개가 유전자 간 영역에 위치하였으며, 1개가 유전자 내 영역에 위치하고 있었다. SNP의 경우 216개 중 98개는 유전자 내에, 118개는 유전자 간에 위치하고 있었다.

Fig. 3. Multiple alignments of the sequences in the intergenic regions containing InDels and SNPs used to develop PCR-based markers. The chloroplast genome sequences of S. iopetalum (SI-1: MZ233587), S. mochiquense (SM1-3: MZ233589), S. kurtzianum (SK-1: MZ233588), S. pinnatisectum (SP-10: MZ233590), S. vernei (SV2-5: MZ233591), S. tuberosum (Stbr: NC008096), S. berthautii (Sber: KY419708), S. hougasii (Shou: MF471372), S. commersonii (Scmr: KM489054), S. acaule (Sacl: MK036506), and S. bulbocastanum (Sblb: DQ347958) were analyzed and listed from top to bottom for each InDels and SNP region. The InDel and SNP regions detected in S. pinnatisectum are bolded, highlighted, and underlined

S. pinnatisectum 특이적 분자마커 개발

S. pinnatisectum을 포함한 총 11개의 Solanum 종의 엽록체 전장 유전체 전체 염기서열의 다중정렬로 구명된 S. pinnatisectum 특이적 InDel과 SNP는 S. pinnatisectum 특이적 분자마커 개발을 위해 사용되었다.

InDel을 기반으로 한 분자마커의 경우 유전자 간에 존재하는 4개의 InDel 영역을 대상으로 Primer를 디자인하여 PCR을 진행한 결과 4개의 InDel 마커 모두 S. jamesii에서 동일한 크기로 추정되는 마커가 나타났고, 두 번째 InDel 마커를 제외한 3개의 InDel 마커에서 S. jamesii 뿐만 아니라 S. cardiophyllum에서도 동일한 크기로 추정되는 마커가 함께 나타났다. 이는 계통수 분석에서도 나타난 바와 같이, S. jamesii 및 S. cardiophyllum과의 유연관계가 매우 근접한 위치에 밀접한 그룹으로 분류되었고, 실제로 염기서열의 해당 영역에서 비교해본 결과 각각의 근연 야생종의 염기서열이 동일한 것으로 확인되었다(Fig. 2, Fig. 4). SNP를 기반으로 한 분자마커의 경우 216개의 영역 중 일부를 대상으로 Primer를 디자인하여 PCR의 결과로 얻은 DNA 단편을 적절한 제한효소를 처리하여 S. pinnatisectum 특이적인 CAPS (Cleaved Amplified Polymorphism Sequence) 마커로 개발되었다(Konieczny and Ausubel 1993). CAPS 마커는 Solanum 종들을 대상으로 한 종들을 구분하거나 종 내 유전자형의 구분 및 선발 등에 많이 이용되고 있으며(Smilde et al. 2005; van der Voort et al. 1999), 다른 작물에서도 같은 목적으로 많이 활용되고 있다(Konovalov et al. 2005; Lee et al. 2008; Pettenkofer et al. 2020; Uncu et al. 2015). 본 연구에서는 최종적으로 2개의 CAPS 마커를 개발되었는데, 첫 번째 SNP 마커는 제한효소 TaqI에 의해 S. pinnatisectum 및 S. jamesii, S. cardiophyllum에서도 SNP 영역이 절단되었는데 이는 앞서 InDel에서 나타난 것과 같은 이유로 인해 이러한 결과가 나타난 것으로 확인되었다. 두 번째 SNP 마커 또한 TaqI에 의해 절단되는 결과를 보여주었으나 S. pinnatisectum과는 다르게 나머지 야생종들은 다른 패턴으로 절단되어 S. pinnatisectum 특이적인 결과를 나타내었다(Table 2, Fig. 4).

Fig. 4. PCR-based markers for distinguishing S. pinnatisectum from other Solanum species. A: SP10_InDel12. B: SP10_InDel20. C: SP10_InDel24. D: SP10_InDel25. E: SP10_SNP23. F: SP10_SNP27. The markers SP10_InDel12, SP10_InDel20, SP10_InDel24, and SP10_InDel25 are positively specific to S. pinnatisectum. The markers SP10_SNP23 and SP10_SNP27 show positive and negative specificity to S. pinnatisectum. SP10 and SP1 indicate two different lines of S. pinnatisectum (PI190115). M, DS, DJ, SM, SA, SB2, SC1, SC2, SN, SH2, SK, SM1, SJ, SS, SV1, SV2, and SI denote a size marker ladder and the following potato varieties: ‘Daeseo’, ‘Daeji’, ‘Sumi’, S. acaule (PI310970), S. brevicaule (PI205394), S. cardiophyllum (PI341233), S. commersonii (PI558050), a line of S. nigrum collected in Daegu, South Korea, S. hougasii (PI161174), S. kurtzianum (PI578236), S. mochiquense (PI338616), S. jamesii (PI578326), S. stoloniferum (PI160224), S. verrucosum (PI160228), S. vernei (PI230468), and S. iopetalum (PI230459), respectively. Red and yellow arrows indicate positive and negative bands in S. pinnatisectum, respectively

Table 2 . Information on primers to generate S. pinnatisectum specific and non-specific markers

InDel/SNPSaPrimer sequence (5’ → 3’)Tm (°C)Size or REb
SP10_InDel12FTAACGCGACATAAAGACTCC54615 bp
RCACTATTTAATAATACTATTTAA
SP10_InDel20FGTATAGAAAGGATTAGATTAG58509 bp
RTGAAATCTGGAGGGAAGTG
SP10_InDel24FGTATTCTGCAACTTTAACTTT58496 bp
RAATCAGAAAAGCGAATAGAG
SP10_InDel25FACCATTACTATTATAATATTACT52508 bp
RTTTGATAAATGCATTGCTTG
SP10_SNP23FGAATCAATTTCGAAAGTTCC65TaqI
RTCTCTGACAATATAGATTGC
SP10_SNP27FCGGCTTAACTTATTTCCTTC65TaqI
RCTTGAGATTCTTGGCTCTTC

aF and R indicate the forward and reverse strands of primers.

bThe expected sizes of PCR fragments are measured based on the sequence of S. pinnatisectum. RE indicates the restriction enzyme generating S. pinnatisectum-specific and non-specific markers.

본 연구에서 얻은 결과로 감자의 신품종 육성과정에서 그 정보를 활용하여 분자마커를 개발하는데 활용하고, 진화적 관점의 연구에도 기여할 것이다. 많은 근연야생종들이 재배종 감자와 배수성과 EBN의 차이로 인하여 전통적인 교배육종의 방법으로는 근연야생종의 유용형질 도입이 어려워 체세포잡종을 체세포융합에 의한 육성하여 이를 신품종 육성에 활용하고 있으며, 그 과정에서 적절한 유전자형의 체세포잡종 선발이 필요하다. 다양한 식물종에서 체세포융합이 이루어졌을 경우, 체세포융합에 이용된 서로 다른 종의 세포질 유전체가

체세포잡종에 전달되어 나타나는 결과는 다양한 것으로 알려져 있다. 엽록체 유전체는 한 쪽의 엽록체 유전체만 무작위로 전달되는 것이 일반적이나, 양친의 엽록체 유전체가 모두 전달되는 경우도 있는 것으로 알려져 있으며, 미토콘드리아 유전체는 일반적으로 재조합 발생이 높은 빈도로 이루어지는 것으로 알려져 있다(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Wang et al. 2011; Xiang et al. 2004). 본 연구에서 얻은 S. pinnatisectum의 엽록체 전장 유전체 정보와 분자마커는 S. pinnatisectum을 이용한 체세포잡종의 육성과 선발에 이용되어 감자의 신품종 육성에 기여할 수 있을 것이다.

적 요

Go to

멕시코에서 자생하는 2배체 감자 근연야생종 Solanum pinnatisectum은 감자 신품종 육성을 위한 중요한 재료로 활용되고 있다. 이는 S. pinnatisectum이 풋마름병, 감자역병, 감자줄기검은병, 뿌리혹선충, 콜로라도감자잎벌레, 그리고 감자바이러스X, Y (PVX, PVY) 등에 대한 저항성이 있는 것으로 알려져 있기 때문이다. 하지만, 재배되고 있는 감자(S. tuberosum)와 배수성과 EBN이 서로 달라 전통적인 교잡육종 방법으로 감자 근연야생종의 유용형질 도입이 어려운 실정이다. 이러한 생리적 장벽을 극복하기 위해서는 체세포 융합을 이용할 수 있으며, 적절한 체세포잡종을 선발할 수 있는 분자마커가 필요하다. 이에, 본 연구에서는 S. pinnatisectum의 엽록체 전장 유전체를 NGS기술을 이용하여 완성하고 다른 Solanum 종의 엽록체 전장 유전체 정보와 비교하여 S. pinnatisectum에 특이적으로 나타나는 분자마커를 개발하였다. S. pinnatisectum 전체 엽록체 유전체의 염기서열은 총 155,597 bp였으며, 유전자 구성, 구조 등은 다른 Solanum 종들과 거의 동일하였고, 총 158개의 유전자로 구성되어 있었다. 가지과의 다른 18개의 종들과 계통수 분석의 결과, 다른 Solanum 종과 가까운 유연관계를 가지는 것을 확인하였고, S. jamesii, S. cardiophyllum과의 가장 근접한 유연관계를 확인하였다. S. pinnatisectum의 전체 엽록체 염기서열을 다른 10개 Solanum 종의 전체 엽록체 염기서열과 다중 정렬한 결과, 총 26개와 216개의 S. pinnatisectum 특이적인 InDel과 SNP를 구명하였으며, 이러한 정보는 6개의 PCR 기반 분자마커 개발을 가능하게 하였다. 본 연구의 결과를 바탕으로 S. pinnatisectum를 이용한 감자 신품종 육성과 S. pinnatisectum의 진화적 관점에서의 연구가 지속될 수 있을 것이다.

REFERENCES

Go to
  1. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
    Pubmed CrossRef
  2. Chen Q, Kawchuk L-M, Lynch D-R, Goettel M-S, Fujimoto D-K (2003) Identification of late blight, Colorado potato beetle, and blackleg resistance in three Mexican and two south American wild 2x (1EBN) Solanum species. Am J Potato Res 80:919
    CrossRef
  3. Chen Q, Sun S, Ye Q, McCuine S, Huff E, Zhang H-B (2004) Construction of two BAC libraries from the wild Mexican diploid potato, Solanum pinnatisectum, and the identification of clones near the late blight and Colorado potato beetle resistance loci. Theor Appl Genet 108:1002-1009
    Pubmed CrossRef
  4. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29:154-161
  5. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
    Pubmed CrossRef
  6. Cho KS, Cho JH, Park YE, Park TH (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4:1800-1802
    CrossRef
  7. Cho KS, Park TH (2014) Potato breeding via protoplast fusion. J Plant Biotechnol 41:65-72
    CrossRef
  8. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57:69-78
    CrossRef
  9. Cho KS, Yun BK, Yoon YH, Hong SY, Mekapogu M, Kim KH, Yang TJ (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
    Pubmed KoreaMed CrossRef
  10. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112:1503-1518
    Pubmed CrossRef
  11. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop 107
  12. Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. London, UK, Belhaven Press
    CrossRef
  13. Jansky S (2006) Overcoming hybridization barriers in potato. Plant breeding 125:1-12
    CrossRef
  14. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
    CrossRef
  15. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46:79-87
    CrossRef
  16. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140
    CrossRef
  17. Kim S, Park T-H (2020b) Development of Solanum hougasii-specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47:141-149
    CrossRef
  18. Konovalov F, Toshchakova E, Gostimsky S (2005) A CAPS marker set for mapping in linkage group III of pea (Pisum sativum L.). Cell Mol Biol Lett 10:163-171
  19. Kuhl J-C, Hanneman R-E, Havey M-J (2001) Characterization and mapping of Rpi1, a late-blight resistance locus from diploid (1EBN) mexican Solanum pinnatisectum. Mol Genet Genomics 265:977-985
    Pubmed CrossRef
  20. Lee J, Yoon JB, Park HG (2008) A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol Breeding 21:95-104
    CrossRef
  21. Lohse M, Drechsel O, Bock R (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52:267-274
    Pubmed CrossRef
  22. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116:221-230
    CrossRef
  23. Machida-Hirano R (2015) Diversity of potato genetic resources. Breed Sci 65:26-40
    Pubmed KoreaMed CrossRef
  24. Menke U, Schilde-Rentschler L, Ruoss B, Zanke C, Hemleben V, Ninnemann H (1996) Somatic hybrids between the cultivated potato Solanum tuberosum L. and the 1EBN wild species Solanum pinnatisectum Dun: morphological and molecular characterization. Theor Appl Genet 92:617-626
    Pubmed CrossRef
  25. Mohapatra T, Kirti P, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of diplotaxis cathollica + Brassica Juncea. Plant Cell Rep 17:814-818
    Pubmed CrossRef
  26. Park T-H (2021a) Complete chloroplast genome sequence of the wild diploid potato relative, Solanum acaule. Mitochondr DNA Part B 6:1189-1191
    Pubmed KoreaMed CrossRef
  27. Park T-H (2021b) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48:18-25
    CrossRef
  28. Park T-H (2022a) Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 49:30-38
    CrossRef
  29. Park T-H (2022b) PCR-based markers to select plastid genotypes of Solanum acaule. J Plant Biotechnol 49:178-186
    CrossRef
  30. Park T-H (2023a) Development of PCR-based markers for selecting plastid genotypes of Solanum hjertingii. J Plant Biotechnol 50:34-44
    CrossRef
  31. Park T-H (2023b) Chloroplast genome sequence and PCR-based markers for S. cardiophyllum. J Plant Biotechnol 50:45-55
    CrossRef
  32. Pettenkofer T, Finkeldey R, Müller M, Krutovsky KV, Vornam B, Leinemann L, Gailing O (2020) Development of novel Quercus rubra chloroplast genome CAPS markers for haplotype indentification. Silvae Genetica 69:78-85
    CrossRef
  33. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
    Pubmed KoreaMed CrossRef
  34. Smilde WD, Brigneti G, Jagger L, Perkins S, Jones JDG (2005) Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theor Appl Genet 110:252-258
    Pubmed CrossRef
  35. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35:1345-1358
    Pubmed KoreaMed CrossRef
  36. ivastava A Sr, Bhardwaj V, Singh BP, Khurana SMP (2016) Potato diversity and its genetic enhancement. Gene Pool Divers Crop Im 187-226
    CrossRef
  37. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30:2725-2729
    Pubmed KoreaMed CrossRef
  38. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45:W6-W11
    Pubmed KoreaMed CrossRef
  39. Uncu AT, Celik I, Devran Z, Ozkaynak E, Frary A, Frary A, Doganlar S (2015) Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper. Euphytica 206:393-399
    CrossRef
  40. van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Klein-Lankhorst R, Stiekema W, Baulcombe D, Bakker J (1999) Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol Plant-Microb Interact 18:722-729
    CrossRef
  41. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30:1811-1821
    Pubmed CrossRef
  42. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688
    Pubmed CrossRef
  43. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34:5-22

Article

Research Article

J Plant Biotechnol 2024; 51(1): 121-128

Published online May 29, 2024 https://doi.org/10.5010/JPB.2024.51.013.121

Copyright © The Korean Society of Plant Biotechnology.

Solanum pinnatisectum 엽록체 전장유전체 구명 및 특이적 분자마커의 개발

손서연･박태호

대구대학교 원예학과

Received: 18 April 2024; Revised: 6 May 2024; Accepted: 6 May 2024; Published: 29 May 2024.

Completion of chloroplast genome sequence and development of PCR-based markers for Solanum pinnatisectum

Seoyeon Son ･Tae-Ho Park

Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea

Correspondence to:e-mail: thzoo@daegu.ac.kr

Received: 18 April 2024; Revised: 6 May 2024; Accepted: 6 May 2024; Published: 29 May 2024.

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Solanum pinnatisectum, originating from Mexico, is a wild potato species valued for its resistance to various insects and pathogens, including the Colorado potato beetle, potato tuber moth, Phytophthora infestans, and Erwinia carotovorum. Despite its advantageous traits, S. pinnatisectum is diploid with an endosperm balanced number (EBN) of one, presenting sexual reproduction barriers with cultivated potatoes. Cell fusion methods can be employed to circumvent these barriers and integrate beneficial traits from S. pinnatisectum into cultivated potatoes. In this study, therefore, the chloroplast genome sequence of S. pinnatisectum was completed using next-generation sequencing (NGS) technology and compared with those of ten other Solanum species to develop specific PCR markers for S. pinnatisectum. The complete chloroplast genome of S. pinnatisectum is 155,597 bp in length and exhibits structural organization similar to those of other Solanum species. Sequence alignment of the complete chloroplast genomes sequences of eleven Solanum species, including S. pinnatisectum, identified 216 SNPs and 26 InDels unique to S. pinnatisectum. Based on these InDels and SNPs, six PCR-based markers were developed to identify the plastid genotype of S. pinnatisectum. The results of this study will be instrumental in distinguishing S. pinnatisectum from other Solanum species, selecting suitable genotypes for potato breeding through somatic hybridization, and accelerating the breeding program using S. pinnatisectum.

Keywords: cpDNA, InDels, PCR-based marker, Potato, SNPs, Solanum pinnatisectum

서 론

Solanum pinnatisectum은 멕시코에서 자생하는 근연 야생종 중 하나로, 그 배수성이 2배체로 4배체인 재배종 감자(S. tuberosum L.)와 차이있다(Chen et al. 2004; Hawkes 1990). S. pinnatisectum은 역병, 풋마름병, 감자줄기검은병, 뿌리혹선충, 콜로라도감자잎벌레 그리고 감자바이러스 X, Y (PVX, PVY)등에 대한 저항성을 가지고 있는 것으로 알려져 감자 신품종 육성에 활용 가치로 중요한 재료가 될 수 있다(Chen et al. 2003; Kuhl et al. 2001; Machida-Hirano 2015; Menke et al. 1996; Srivastava et al. 2016). 하지만, S. pinnatisectum의 게놈 구성비(EBN)는 1로, 4인 재배종 감자와의 차이로 인한 교잡불화합성 때문에 전통적인 교배육종이 어려운 실정이다(Cho et al. 1997; Jansky 2006). 이러한 생리적 장벽을 극복하기 하기 위한 하나의 방법으로는 체세포잡종을 이용한 계통 육성이 이용될 수 있다(Cho and Park 2014). 따라서, S. pinnatisectum을 이용하여 체세포잡종 계통을 육성하는 연구가 진행 중에 있으며, 향후 체세포잡종 계통이 확보되었을 때, S. pinnatisectum과 S. tuberosum의 핵내 또는 세포질 유전체가 어떻게 체세포잡종에 전달되는지를 확인하기 위해, 본 연구에서는 S. pinnatisectum 엽록체의 유전체 염기서열 정보를 구명하여 S. tuberosum과 구별할 수 있는 S. pinnatisectum 특이적으로 나타나는 분자마커를 개발하고자 하였다.

엽록체 유전체는 전형적으로 한 쌍의 inverted repeats (IRs) 영역, small single copy (SSC) 영역, 그리고 large single copy (LSC) 영역으로 구분되는 4분할 원형의 이중가닥 분자구조로 구성되어 있다(Yurina and Odintosova 1998). 본 연구에서는 S. pinnatisectum 엽록체 유전체 전체 염기서열에 대한 정보를 제공하고, 다른 야생종 엽록체 유전체의 염기서열과 비교하여 S. pinnatisectum에 특이적으로 나타나는 분자마커 개발에 대한 결과를 제공하고자 한다.

재료 및 방법

식물재료

S. pinnatisectum의 엽록체 전체 유전체의 염기서열 분석에는 S. pinnatisectum 계통 중 하나인 SP10이 이용되었다. 또한, S. pinnatisectum에 특이적으로 나타나는 분자마커를 개발하기 위해 S. pinnatisectum 계통 중 하나인 SP10과 더불어 SP1이 추가되었으며, 자체 수집한 S. nigrum을 제외한 감자 품종 ‘대지(DJ)’, ‘대서(DS)’, ‘수미(SM)’와 12개의 야생종 SA (S. acaule, PI310970), SB2 (S. brevicaule, PI205394), SC1 (S. cardiophyllum, PI341233), SK (S. kurtzianum, PI578236), SC2 (S. commersonii, PI558050), SH2 (S. hougasii, PI161174), SS (S. stoloniferum, PI160224), SM1 (S. mochiquense, PI338616), SJ (S. jamesii, PI578326), SV1 (S. verrucosum, PI160228), SV2 (S. vernei, PI230468), SI (S. iopetalum, PI230459)는 국립식량과학원 고령지농업연구소로부터 분양 받아 기내식물체로 증식하여 이용하였다.

DNA 분리

분양받은 식물재료들은 기내에서 증식되어 약 100 mg의 식물체를 채취하여 Genomic DNA Extraction kit (Plants) (RBC, New Taipei City, Taiwan)를 이용하여 DNA를 추출하였다.

S. pinnatisectum 엽록체 전장유전체의 완성 및 분석

S. pinnatisectum 엽록체 전체 유전체의 염기서열 분석에는 S. pinnatisectum 계통 SP10을 대상으로 DNA를 추출하여 진행되었으며, 전체 염기서열(raw data)은 Macrogen (Macrogen, Seoul, South Korea)에서 제공하는 Illumina Hiseq2000 (Illumina, SanDiego, CA, USA) 플랫폼을 이용하였다. 획득한 전체 염기서열(raw data) 정보는 파이젠 생물정보학 파이프라인(http://phyzen.com)의 CLC assembly cell package version 4.2.1 (CLC Inc, Rarhus, Danmark)를 이용한 de novo assembly에 의해 분석하여 완성되었다(Cho et al. 2015). 우선, CLC quality trim 프로그램을 이용하여 전처리 과정을 거쳐 Phred score 20 미만의 low-quality 정보를 제외한 염기서열을 추출하여 얻은 후, CLC de novo assemble 프로그램을 이용하여 dnaLCW 방법으로 조립하였다. 그리고, 엽록체 유전체의 염기서열로만 구성된 contig만을 선별하고, gap-filling을 통한 확장 및 통합을 거쳐 엽록체 유전체를 완성하였다. 완성된 엽록체 유전체에 trimmed read 전체를 mapping하여 read depth를 계산하고, BLASTN을 실시하여 확인된 homology가 가장 높은 종의 전장 엽록체 유전체 서열을 확인하고, BLASTZ (Schwartz et al. 2003) 분석을 실시하였다.

완성된 S. pinnatisectum 엽록체 유전체 서열에 존재하는 유전자 부위를 결정하기 위해 Geseq 프로그램을 이용하였고, BLAST search를 기반으로 manual curation을 수행하여 유전자를 최종적으로 구명하였다. 엽록체 유전체 전체 유전자는 OGDraw 프로그램에 원형의 유전자지도에 표시하였다(Lohse et al. 2007; Tillich et al. 2017).

엽록체 유전체의 비교 및 분자마커 개발

엽록체 유전체 정보를 기반으로 한 S. pinnatisectum과 다른 종들의 유연관계 분석을 진행하기 위해 NCBI (National Center for Biotechnology Information)에 등록되어 있는 S. tuberosum (KM489056 및 NC_008096)을 포함하는 다른 가지과(Solanaceae) 총 17종 S. stoloniferum (MF471373), S. verrucosum (MK690625), S. commersonii (KM489054), S. hougasii (MF471372), S. hjertingii (MK690623), S. demissum (MK036508), S. berthaultii (KY419708), S. brevicaule (MK036507), S. chacoense (MF471371), S. acaule (MK036506), S. bulbocastanum (DQ347958), S. cardiophyllum (MK690622), S. jamesii (MK690624), S. lycopersicum (NC_007898), S. nigrum (KM489055), Capsicum annuum (JX270811)과 비교하여 계통수를 작성하였다. 엽록체 코딩서열을 기반으로 MEGA6.0 프로그램으로 분석하였으며, Kimura 2-parameter 모델 기반의 Maximum likelihood 방법을 이용하여 1,000번의 Bootstrap 옵션을 적용하였다(Tamura et al. 2013).

S. pinnatisectum에 특이적으로 나타나는 분자마커를 개발하기 위해 S. pinnatisectum 엽록체 전장 유전체의 염기서열은 NCBI로부터 얻은 S. iopetalum (MZ233587), S. mochiquense (MZ233589), S. tuberosum (NC_008096), S. berthaultii (KY419708), S. hougasii (MF471372), S. commersonii (KM489054), S. acaule (MK036506), S. bulbocastanum (DQ347958)의 엽록체 전장 유전체 염기서열과 ClustalW2 (EMBL; http://www.ebi.ac.uk/Tools/msa/clustalw2)에 의해 다중정렬을 수행하여 S. pinnatisectum에 특이적으로 나타나는 Indel과 SNP를 구명하고 이를 대상으로 S. pinnatisectum 특이적인 마커 개발을 진행하였다.

InDel의 경우 InDel 영역에서 특이적인 primer를 디자인하여 allele 특이적 분자마커를 개발하고자 하였고, SNP의 경우에는 dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html)을 이용하여 S. pinnatisectum에 특이적으로 작용하거나 S. pinnatisectum을 제외한 다른 Solanum 종들에 특이적으로 작용하는 제한효소를 찾아 확인한 후, Primer를 디자인하였다. S. pinnatisectum (SP10 및 SP1)과 재배종 감자 ‘대지(DJ)’, ‘대서(DS)’, ‘수미(SM)’, S. nigrum 및 총 12개의 감자 근연야생종 계통 SA (S. acaule, PI310970), SB2 (S. brevicaule, PI205394,), SC1 (S. cardiophyllum, PI341233), SM1 (S. mochiquense, PI338616), SC2 (S. commersonii, PI558050), SH2 (S. hougasii, PI161174), SK (S. kurtzianum, PI578236), SJ (S. jamesii, PI578326), SS (S. stoloniferum, PI160224), SV1 (S. verrucosum, PI160228), SV2 (S. vernei, PI230468), SI (S. iopetalum, PI230459)을 대상으로 Thermocycler (Biometra, Göttingen, Germany)을 이용하여 총 25 ul 볼륨(약 20 ng genomic DNA, 10x reaction buffer, 10 mM dNTPs, 10 pMol의 forward/reverse primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 PCR을 진행하였고, PCR의 결과는 핵산 염색 용액인 StaySafe (RBC, New Taipei City, Taiwan)를 이용하여 염색 후 1.8% agarose gel에서 확인하였다. 필요에 따라 확인한 PCR 결과물을 대상으로 제한효소를 처리하였다.

결과 및 고찰

S. pinnatisectum의 엽록체 전장 유전체

S. pinnatisectum의 엽록체 전체 유전체의 염기서열 NGS 기술을 이용하여 완성되었다. S. pinnatisectum의 데이터 총 염기서열은 13,042,942 read를 통해 약 1.9 Gbp를 생산하였고, 평균 길이는 151.0 bp였다. CLC Assembly Cell package version 4.2.1 내의 프로그램 CLC quality trim을 통한 전처리과정을 거쳐, Phred score 20 미만의 low-quality 정보를 제외한 염기서열로 평균 길이 약 147.6 bp인 염기서열 정보 약 1.7 Gbp를 얻을 수 있었다. 이는 전체 raw data의 약 90.28%로 같은 package 내의 프로그램 de novo assemble을 이용한 dnaLCW 방법으로 조립하고, 이후 엽록체 유전체 contig만을 선발하고, gap-filling 과정을 거쳐 확장 및 통합하여 전체 엽록체 유전체를 완성하였다. 그 결과, 총 염기서열의 길이는 155,597 bp이며, aligned read의 수는 918,059개, 평균 coverage는 868.64x로 확인되었다. 완성된 유전체 서열에 전체 trimmed read를 mapping한 결과 read depth는 179이상 인 것으로 확인되었다. 또한, 전체 엽록체 유전체 염기서열의 구조는 다른 식물의 엽록체 전장 유전체와 유사한 형태의 원형 이중가닥 분자로 86,012 bp의 LSC, 18,395 bp의 SSC, 그리고 한 쌍의 25,595 bp IRa/IRb 영역으로 나누어져 있었다(Fig. 1).

Figure 1. Gene map of the chloroplast genome of S. pinnatisectum. Genes on the outside and inside of the map are transcribed in clockwise and counterclockwise directions, respectively

S. pinnatisectum 전체 엽록체 유전체에는 105개의 단백질 코딩 유전자, 8개의 rRNA, 45개의 tRNA를 포함한 총 158개의 유전자가 분포하고 있었으며, 그 중 단백질 코딩 유전자 11개, tRNA 9개, rRNA 4개는 Ira과 IRb 영역에서 역배열로 중복되어 있었다(Table 1, Fig. 1). 전체 염기서열 중 코딩 영역이 차지하는 비율은 59.2%로 158개의 유전자 평균 길이는 약 583.3 bp로, 이 중 단백질 코딩 유전자의 평균 길이는 764.8 bp로 51.6%로 분포하고 있었고, tRNA의 평균 길이는 62.0bp로 1.8%로 분포하였으며, rRNA의 평균 길이는 1,133.5 bp로 5.8%의 비율로 분포되어 이는 다른 Solanum 속의 종들과 매우 유사하였다(Cho et al. 2016, 2019; Cho and Park 2016; Daniell et al. 2006; Gargano et al. 2005; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021a, 2021b, 2022a, 2022b)(Table 1).

Table 1 . Results of comparative analysis of the chloroplast genome sequence of S. pinnatisectum with those of 14 Solanaceae species.

SpeciesAccession no.Total length (bp)GC content (%)Total no. of genesNo. of tRNANo. of rRNAReference
S. pinnatisectumMZ233590155,59737.90134364In this study
S. hjertingiiMK690623155,54537.88134364Park (2023a)
S. cardiophyllumMK690622155,57037.90134364Park (2023b)
S. acauleMK036506155,57037.84135364Park (2022b)
S. brevicauleMK036507155,53137.87135364Park (2022a)
S. demissumMK036508155,55837.87135364Park (2021b)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*The data have been partially adopted from Park (2023b)..

엽록체 전장 유전체 비교

계통수 작성을 위해 S. pinnatisectum의 엽록체 전장 유전체와 다른 가지과에 속하는 18종의 엽록체 전장 유전체의 코딩서열을 비교 및 분석하였다(Fig. 2). 그 결과, S. pinnatisectum은 재배종 감자 S. tuberosum을 포함하는 다수의 Solanum 종들과 같은 그룹에 위치함을 확인하였으며, S. cardiophyllum와 S. jamesii와 가장 근접한 유연관계를 나타내었을 뿐만 아니라, 전체 염기서열에서도 각각 99.93%, 99.95%로 가장 높은 유사도를 나타내었다. 반면에 까마중(S. nigrum), 고추(C. annuum), 토마토(S. lycopersicum)와는 다소 유연관계가 먼 것을 확인하였다.

Figure 2. Maximum-likelihood phylogenetic tree of S. pinnatisectum with 18 species belonging to the Solanaceae family, based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. Data are partially adopted from Park (2023a)

S. pinnatisectum의 엽록체 유전체 정보를 이용하여 S. pinnatisectum과 다른 Solanum 종들을 구분할 수 있는 S. pinnatisectum에 특이적으로 나타나는 분자마커 개발을 위해 ClustalW2 (EMBL; https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 S. pinnatisectum 및 10개의 Solanum 종의 엽록체 전장 유전체를 대상으로 다중정렬을 수행하였다(Fig. 3). 그 결과, S. pinnatisectum 특이적인 InDel과 SNP 영역은 각각 26개와 216개인 것으로 확인되었고, InDel은 26개 중 25개가 유전자 간 영역에 위치하였으며, 1개가 유전자 내 영역에 위치하고 있었다. SNP의 경우 216개 중 98개는 유전자 내에, 118개는 유전자 간에 위치하고 있었다.

Figure 3. Multiple alignments of the sequences in the intergenic regions containing InDels and SNPs used to develop PCR-based markers. The chloroplast genome sequences of S. iopetalum (SI-1: MZ233587), S. mochiquense (SM1-3: MZ233589), S. kurtzianum (SK-1: MZ233588), S. pinnatisectum (SP-10: MZ233590), S. vernei (SV2-5: MZ233591), S. tuberosum (Stbr: NC008096), S. berthautii (Sber: KY419708), S. hougasii (Shou: MF471372), S. commersonii (Scmr: KM489054), S. acaule (Sacl: MK036506), and S. bulbocastanum (Sblb: DQ347958) were analyzed and listed from top to bottom for each InDels and SNP region. The InDel and SNP regions detected in S. pinnatisectum are bolded, highlighted, and underlined

S. pinnatisectum 특이적 분자마커 개발

S. pinnatisectum을 포함한 총 11개의 Solanum 종의 엽록체 전장 유전체 전체 염기서열의 다중정렬로 구명된 S. pinnatisectum 특이적 InDel과 SNP는 S. pinnatisectum 특이적 분자마커 개발을 위해 사용되었다.

InDel을 기반으로 한 분자마커의 경우 유전자 간에 존재하는 4개의 InDel 영역을 대상으로 Primer를 디자인하여 PCR을 진행한 결과 4개의 InDel 마커 모두 S. jamesii에서 동일한 크기로 추정되는 마커가 나타났고, 두 번째 InDel 마커를 제외한 3개의 InDel 마커에서 S. jamesii 뿐만 아니라 S. cardiophyllum에서도 동일한 크기로 추정되는 마커가 함께 나타났다. 이는 계통수 분석에서도 나타난 바와 같이, S. jamesii 및 S. cardiophyllum과의 유연관계가 매우 근접한 위치에 밀접한 그룹으로 분류되었고, 실제로 염기서열의 해당 영역에서 비교해본 결과 각각의 근연 야생종의 염기서열이 동일한 것으로 확인되었다(Fig. 2, Fig. 4). SNP를 기반으로 한 분자마커의 경우 216개의 영역 중 일부를 대상으로 Primer를 디자인하여 PCR의 결과로 얻은 DNA 단편을 적절한 제한효소를 처리하여 S. pinnatisectum 특이적인 CAPS (Cleaved Amplified Polymorphism Sequence) 마커로 개발되었다(Konieczny and Ausubel 1993). CAPS 마커는 Solanum 종들을 대상으로 한 종들을 구분하거나 종 내 유전자형의 구분 및 선발 등에 많이 이용되고 있으며(Smilde et al. 2005; van der Voort et al. 1999), 다른 작물에서도 같은 목적으로 많이 활용되고 있다(Konovalov et al. 2005; Lee et al. 2008; Pettenkofer et al. 2020; Uncu et al. 2015). 본 연구에서는 최종적으로 2개의 CAPS 마커를 개발되었는데, 첫 번째 SNP 마커는 제한효소 TaqI에 의해 S. pinnatisectum 및 S. jamesii, S. cardiophyllum에서도 SNP 영역이 절단되었는데 이는 앞서 InDel에서 나타난 것과 같은 이유로 인해 이러한 결과가 나타난 것으로 확인되었다. 두 번째 SNP 마커 또한 TaqI에 의해 절단되는 결과를 보여주었으나 S. pinnatisectum과는 다르게 나머지 야생종들은 다른 패턴으로 절단되어 S. pinnatisectum 특이적인 결과를 나타내었다(Table 2, Fig. 4).

Figure 4. PCR-based markers for distinguishing S. pinnatisectum from other Solanum species. A: SP10_InDel12. B: SP10_InDel20. C: SP10_InDel24. D: SP10_InDel25. E: SP10_SNP23. F: SP10_SNP27. The markers SP10_InDel12, SP10_InDel20, SP10_InDel24, and SP10_InDel25 are positively specific to S. pinnatisectum. The markers SP10_SNP23 and SP10_SNP27 show positive and negative specificity to S. pinnatisectum. SP10 and SP1 indicate two different lines of S. pinnatisectum (PI190115). M, DS, DJ, SM, SA, SB2, SC1, SC2, SN, SH2, SK, SM1, SJ, SS, SV1, SV2, and SI denote a size marker ladder and the following potato varieties: ‘Daeseo’, ‘Daeji’, ‘Sumi’, S. acaule (PI310970), S. brevicaule (PI205394), S. cardiophyllum (PI341233), S. commersonii (PI558050), a line of S. nigrum collected in Daegu, South Korea, S. hougasii (PI161174), S. kurtzianum (PI578236), S. mochiquense (PI338616), S. jamesii (PI578326), S. stoloniferum (PI160224), S. verrucosum (PI160228), S. vernei (PI230468), and S. iopetalum (PI230459), respectively. Red and yellow arrows indicate positive and negative bands in S. pinnatisectum, respectively

Table 2 . Information on primers to generate S. pinnatisectum specific and non-specific markers.

InDel/SNPSaPrimer sequence (5’ → 3’)Tm (°C)Size or REb
SP10_InDel12FTAACGCGACATAAAGACTCC54615 bp
RCACTATTTAATAATACTATTTAA
SP10_InDel20FGTATAGAAAGGATTAGATTAG58509 bp
RTGAAATCTGGAGGGAAGTG
SP10_InDel24FGTATTCTGCAACTTTAACTTT58496 bp
RAATCAGAAAAGCGAATAGAG
SP10_InDel25FACCATTACTATTATAATATTACT52508 bp
RTTTGATAAATGCATTGCTTG
SP10_SNP23FGAATCAATTTCGAAAGTTCC65TaqI
RTCTCTGACAATATAGATTGC
SP10_SNP27FCGGCTTAACTTATTTCCTTC65TaqI
RCTTGAGATTCTTGGCTCTTC

aF and R indicate the forward and reverse strands of primers..

bThe expected sizes of PCR fragments are measured based on the sequence of S. pinnatisectum. RE indicates the restriction enzyme generating S. pinnatisectum-specific and non-specific markers..

본 연구에서 얻은 결과로 감자의 신품종 육성과정에서 그 정보를 활용하여 분자마커를 개발하는데 활용하고, 진화적 관점의 연구에도 기여할 것이다. 많은 근연야생종들이 재배종 감자와 배수성과 EBN의 차이로 인하여 전통적인 교배육종의 방법으로는 근연야생종의 유용형질 도입이 어려워 체세포잡종을 체세포융합에 의한 육성하여 이를 신품종 육성에 활용하고 있으며, 그 과정에서 적절한 유전자형의 체세포잡종 선발이 필요하다. 다양한 식물종에서 체세포융합이 이루어졌을 경우, 체세포융합에 이용된 서로 다른 종의 세포질 유전체가

체세포잡종에 전달되어 나타나는 결과는 다양한 것으로 알려져 있다. 엽록체 유전체는 한 쪽의 엽록체 유전체만 무작위로 전달되는 것이 일반적이나, 양친의 엽록체 유전체가 모두 전달되는 경우도 있는 것으로 알려져 있으며, 미토콘드리아 유전체는 일반적으로 재조합 발생이 높은 빈도로 이루어지는 것으로 알려져 있다(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Wang et al. 2011; Xiang et al. 2004). 본 연구에서 얻은 S. pinnatisectum의 엽록체 전장 유전체 정보와 분자마커는 S. pinnatisectum을 이용한 체세포잡종의 육성과 선발에 이용되어 감자의 신품종 육성에 기여할 수 있을 것이다.

적 요

멕시코에서 자생하는 2배체 감자 근연야생종 Solanum pinnatisectum은 감자 신품종 육성을 위한 중요한 재료로 활용되고 있다. 이는 S. pinnatisectum이 풋마름병, 감자역병, 감자줄기검은병, 뿌리혹선충, 콜로라도감자잎벌레, 그리고 감자바이러스X, Y (PVX, PVY) 등에 대한 저항성이 있는 것으로 알려져 있기 때문이다. 하지만, 재배되고 있는 감자(S. tuberosum)와 배수성과 EBN이 서로 달라 전통적인 교잡육종 방법으로 감자 근연야생종의 유용형질 도입이 어려운 실정이다. 이러한 생리적 장벽을 극복하기 위해서는 체세포 융합을 이용할 수 있으며, 적절한 체세포잡종을 선발할 수 있는 분자마커가 필요하다. 이에, 본 연구에서는 S. pinnatisectum의 엽록체 전장 유전체를 NGS기술을 이용하여 완성하고 다른 Solanum 종의 엽록체 전장 유전체 정보와 비교하여 S. pinnatisectum에 특이적으로 나타나는 분자마커를 개발하였다. S. pinnatisectum 전체 엽록체 유전체의 염기서열은 총 155,597 bp였으며, 유전자 구성, 구조 등은 다른 Solanum 종들과 거의 동일하였고, 총 158개의 유전자로 구성되어 있었다. 가지과의 다른 18개의 종들과 계통수 분석의 결과, 다른 Solanum 종과 가까운 유연관계를 가지는 것을 확인하였고, S. jamesii, S. cardiophyllum과의 가장 근접한 유연관계를 확인하였다. S. pinnatisectum의 전체 엽록체 염기서열을 다른 10개 Solanum 종의 전체 엽록체 염기서열과 다중 정렬한 결과, 총 26개와 216개의 S. pinnatisectum 특이적인 InDel과 SNP를 구명하였으며, 이러한 정보는 6개의 PCR 기반 분자마커 개발을 가능하게 하였다. 본 연구의 결과를 바탕으로 S. pinnatisectum를 이용한 감자 신품종 육성과 S. pinnatisectum의 진화적 관점에서의 연구가 지속될 수 있을 것이다.

Fig 1.

Download
Figure 1.Gene map of the chloroplast genome of S. pinnatisectum. Genes on the outside and inside of the map are transcribed in clockwise and counterclockwise directions, respectively
Journal of Plant Biotechnology 2024; 51: 121-128https://doi.org/10.5010/JPB.2024.51.013.121

Fig 2.

Download
Figure 2.Maximum-likelihood phylogenetic tree of S. pinnatisectum with 18 species belonging to the Solanaceae family, based on the chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. Data are partially adopted from Park (2023a)
Journal of Plant Biotechnology 2024; 51: 121-128https://doi.org/10.5010/JPB.2024.51.013.121

Fig 3.

Download
Figure 3.Multiple alignments of the sequences in the intergenic regions containing InDels and SNPs used to develop PCR-based markers. The chloroplast genome sequences of S. iopetalum (SI-1: MZ233587), S. mochiquense (SM1-3: MZ233589), S. kurtzianum (SK-1: MZ233588), S. pinnatisectum (SP-10: MZ233590), S. vernei (SV2-5: MZ233591), S. tuberosum (Stbr: NC008096), S. berthautii (Sber: KY419708), S. hougasii (Shou: MF471372), S. commersonii (Scmr: KM489054), S. acaule (Sacl: MK036506), and S. bulbocastanum (Sblb: DQ347958) were analyzed and listed from top to bottom for each InDels and SNP region. The InDel and SNP regions detected in S. pinnatisectum are bolded, highlighted, and underlined
Journal of Plant Biotechnology 2024; 51: 121-128https://doi.org/10.5010/JPB.2024.51.013.121

Fig 4.

Download
Figure 4.PCR-based markers for distinguishing S. pinnatisectum from other Solanum species. A: SP10_InDel12. B: SP10_InDel20. C: SP10_InDel24. D: SP10_InDel25. E: SP10_SNP23. F: SP10_SNP27. The markers SP10_InDel12, SP10_InDel20, SP10_InDel24, and SP10_InDel25 are positively specific to S. pinnatisectum. The markers SP10_SNP23 and SP10_SNP27 show positive and negative specificity to S. pinnatisectum. SP10 and SP1 indicate two different lines of S. pinnatisectum (PI190115). M, DS, DJ, SM, SA, SB2, SC1, SC2, SN, SH2, SK, SM1, SJ, SS, SV1, SV2, and SI denote a size marker ladder and the following potato varieties: ‘Daeseo’, ‘Daeji’, ‘Sumi’, S. acaule (PI310970), S. brevicaule (PI205394), S. cardiophyllum (PI341233), S. commersonii (PI558050), a line of S. nigrum collected in Daegu, South Korea, S. hougasii (PI161174), S. kurtzianum (PI578236), S. mochiquense (PI338616), S. jamesii (PI578326), S. stoloniferum (PI160224), S. verrucosum (PI160228), S. vernei (PI230468), and S. iopetalum (PI230459), respectively. Red and yellow arrows indicate positive and negative bands in S. pinnatisectum, respectively
Journal of Plant Biotechnology 2024; 51: 121-128https://doi.org/10.5010/JPB.2024.51.013.121

Table 1 . Results of comparative analysis of the chloroplast genome sequence of S. pinnatisectum with those of 14 Solanaceae species.

SpeciesAccession no.Total length (bp)GC content (%)Total no. of genesNo. of tRNANo. of rRNAReference
S. pinnatisectumMZ233590155,59737.90134364In this study
S. hjertingiiMK690623155,54537.88134364Park (2023a)
S. cardiophyllumMK690622155,57037.90134364Park (2023b)
S. acauleMK036506155,57037.84135364Park (2022b)
S. brevicauleMK036507155,53137.87135364Park (2022a)
S. demissumMK036508155,55837.87135364Park (2021b)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*The data have been partially adopted from Park (2023b)..

Table 2 . Information on primers to generate S. pinnatisectum specific and non-specific markers.

InDel/SNPSaPrimer sequence (5’ → 3’)Tm (°C)Size or REb
SP10_InDel12FTAACGCGACATAAAGACTCC54615 bp
RCACTATTTAATAATACTATTTAA
SP10_InDel20FGTATAGAAAGGATTAGATTAG58509 bp
RTGAAATCTGGAGGGAAGTG
SP10_InDel24FGTATTCTGCAACTTTAACTTT58496 bp
RAATCAGAAAAGCGAATAGAG
SP10_InDel25FACCATTACTATTATAATATTACT52508 bp
RTTTGATAAATGCATTGCTTG
SP10_SNP23FGAATCAATTTCGAAAGTTCC65TaqI
RTCTCTGACAATATAGATTGC
SP10_SNP27FCGGCTTAACTTATTTCCTTC65TaqI
RCTTGAGATTCTTGGCTCTTC

aF and R indicate the forward and reverse strands of primers..

bThe expected sizes of PCR fragments are measured based on the sequence of S. pinnatisectum. RE indicates the restriction enzyme generating S. pinnatisectum-specific and non-specific markers..

References

  1. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
    Pubmed CrossRef
  2. Chen Q, Kawchuk L-M, Lynch D-R, Goettel M-S, Fujimoto D-K (2003) Identification of late blight, Colorado potato beetle, and blackleg resistance in three Mexican and two south American wild 2x (1EBN) Solanum species. Am J Potato Res 80:919
    CrossRef
  3. Chen Q, Sun S, Ye Q, McCuine S, Huff E, Zhang H-B (2004) Construction of two BAC libraries from the wild Mexican diploid potato, Solanum pinnatisectum, and the identification of clones near the late blight and Colorado potato beetle resistance loci. Theor Appl Genet 108:1002-1009
    Pubmed CrossRef
  4. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29:154-161
  5. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
    Pubmed CrossRef
  6. Cho KS, Cho JH, Park YE, Park TH (2019) Chloroplast genome sequence of Solanum demissum, a wild tuber-bearing species was completed. Mitochondr DNA Part B 4:1800-1802
    CrossRef
  7. Cho KS, Park TH (2014) Potato breeding via protoplast fusion. J Plant Biotechnol 41:65-72
    CrossRef
  8. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57:69-78
    CrossRef
  9. Cho KS, Yun BK, Yoon YH, Hong SY, Mekapogu M, Kim KH, Yang TJ (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
    Pubmed KoreaMed CrossRef
  10. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112:1503-1518
    Pubmed CrossRef
  11. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) The complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop 107
  12. Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. London, UK, Belhaven Press
    CrossRef
  13. Jansky S (2006) Overcoming hybridization barriers in potato. Plant breeding 125:1-12
    CrossRef
  14. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
    CrossRef
  15. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46:79-87
    CrossRef
  16. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140
    CrossRef
  17. Kim S, Park T-H (2020b) Development of Solanum hougasii-specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47:141-149
    CrossRef
  18. Konovalov F, Toshchakova E, Gostimsky S (2005) A CAPS marker set for mapping in linkage group III of pea (Pisum sativum L.). Cell Mol Biol Lett 10:163-171
  19. Kuhl J-C, Hanneman R-E, Havey M-J (2001) Characterization and mapping of Rpi1, a late-blight resistance locus from diploid (1EBN) mexican Solanum pinnatisectum. Mol Genet Genomics 265:977-985
    Pubmed CrossRef
  20. Lee J, Yoon JB, Park HG (2008) A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol Breeding 21:95-104
    CrossRef
  21. Lohse M, Drechsel O, Bock R (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52:267-274
    Pubmed CrossRef
  22. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116:221-230
    CrossRef
  23. Machida-Hirano R (2015) Diversity of potato genetic resources. Breed Sci 65:26-40
    Pubmed KoreaMed CrossRef
  24. Menke U, Schilde-Rentschler L, Ruoss B, Zanke C, Hemleben V, Ninnemann H (1996) Somatic hybrids between the cultivated potato Solanum tuberosum L. and the 1EBN wild species Solanum pinnatisectum Dun: morphological and molecular characterization. Theor Appl Genet 92:617-626
    Pubmed CrossRef
  25. Mohapatra T, Kirti P, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of diplotaxis cathollica + Brassica Juncea. Plant Cell Rep 17:814-818
    Pubmed CrossRef
  26. Park T-H (2021a) Complete chloroplast genome sequence of the wild diploid potato relative, Solanum acaule. Mitochondr DNA Part B 6:1189-1191
    Pubmed KoreaMed CrossRef
  27. Park T-H (2021b) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48:18-25
    CrossRef
  28. Park T-H (2022a) Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 49:30-38
    CrossRef
  29. Park T-H (2022b) PCR-based markers to select plastid genotypes of Solanum acaule. J Plant Biotechnol 49:178-186
    CrossRef
  30. Park T-H (2023a) Development of PCR-based markers for selecting plastid genotypes of Solanum hjertingii. J Plant Biotechnol 50:34-44
    CrossRef
  31. Park T-H (2023b) Chloroplast genome sequence and PCR-based markers for S. cardiophyllum. J Plant Biotechnol 50:45-55
    CrossRef
  32. Pettenkofer T, Finkeldey R, Müller M, Krutovsky KV, Vornam B, Leinemann L, Gailing O (2020) Development of novel Quercus rubra chloroplast genome CAPS markers for haplotype indentification. Silvae Genetica 69:78-85
    CrossRef
  33. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
    Pubmed KoreaMed CrossRef
  34. Smilde WD, Brigneti G, Jagger L, Perkins S, Jones JDG (2005) Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theor Appl Genet 110:252-258
    Pubmed CrossRef
  35. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35:1345-1358
    Pubmed KoreaMed CrossRef
  36. ivastava A Sr, Bhardwaj V, Singh BP, Khurana SMP (2016) Potato diversity and its genetic enhancement. Gene Pool Divers Crop Im 187-226
    CrossRef
  37. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 30:2725-2729
    Pubmed KoreaMed CrossRef
  38. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45:W6-W11
    Pubmed KoreaMed CrossRef
  39. Uncu AT, Celik I, Devran Z, Ozkaynak E, Frary A, Frary A, Doganlar S (2015) Development of a SNP-based CAPS assay for the Me1 gene conferring resistance to root knot nematode in pepper. Euphytica 206:393-399
    CrossRef
  40. van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Klein-Lankhorst R, Stiekema W, Baulcombe D, Bakker J (1999) Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol Plant-Microb Interact 18:722-729
    CrossRef
  41. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30:1811-1821
    Pubmed CrossRef
  42. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688
    Pubmed CrossRef
  43. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34:5-22
JPB
Vol 51. 2024
Current Issue Archives

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download