The 53 amino acid protein known as human epidermal growth factor (hEGF) is folded with three disulfide links. In the human system, this protein is used for epithelial cell differentiation and proliferation (Nanba et al. 2013; Zeng and Harris 2014). Since its initial identification in the submaxillary salivary glands of adult mice, hEGF has been detected in a variety of body fluids, including skin, tears, milk, saliva, urine, and plasma (Cohen 1962; Zeng and Harris 2014). The human epidermal growth factor has a variety of therapeutic benefits that can hasten the healing of burns, wounds, diabetic ulcers, stomach ulcers, and ocular injuries (Alemadaroglu et al. 2006; Yao and Eriksson 2000). Additionally, hEGF treatment can prevent and reverse internal organ ischemia damage (Berlanga et al. 2002). hEGF may also help with the healing of mucosal damage caused by radiotherapy, according to a study (Oh et al. 2010; Wu et al. 2009).

There is a high demand for hEGF because of its therapeutic properties, and numerous researchers have tried to produce this protein in heterologous systems. Although the production of hEGF on a large scale in bacterial cultures is technically possible, one obstacle is the absence of post-translational machinery in bacterial cells, which may have a negative effect on the biological

activity and stability of proteins (Wirth et al. 2004). However, the majority of proteins produced from transgenic or mammalian cell cultures are equivalent to those produced from their natural counterparts, despite the increased costs associated with bulk synthesis (Wirth et al. 2004). Transgenic plants have instead been given the hEGF gene insertion. Compared to other expression systems, plants scale up more affordably, especially for crops whose harvesting and processing are based on tried-and-true methods. The absence of animal diseases like viruses or prions that could endanger human health is another advantage of the plant system (Daniell et al. 2001; Wirth et al. 2004). However, the plant-based platform has several drawbacks, such as lower expression levels (Wirth et al. 2004). Strong promoter use, enhanced translation of transgenic mRNAs, improved RNA stability, and codon usage optimization are among the solutions that have been proposed to address this issue (Bai et al. 2007; Wirth et al. 2004). Several researchers have documented that hEGF yields up to 0.3% to 6.24% of total soluble protein in transgenic tobacco by using codon optimization and directing the transgenic protein to organelles like the endoplasmic reticulum (Bai et al. 2007; Thomas and Walmsley 2014).

Plant cell and organ cultures have recently become viable alternatives for the production of raw materials derived from both plants and heterologous sources. Plant cell and organ cultures are advantageous options for the synthesis of bioactive compounds for biomedical uses because they are standardized, contaminant-free, and bio-sustainable systems (Murthy et al. 2014). Due to a number of benefits, including a short culture period, rapid cell proliferation, a simplified technique for isolating and purifying proteins, and inexpensive production costs, plant cell cultures were also shown to be useful for the manufacture of recombinant proteins (Schillberg et al. 2013). Furthermore, the efficient large-scale manufacturing of recombinant proteins is made possible by the cultivation of plant cells in bioreactors (Huang and McDonald 2009; Murthy et al. 2023). An important medicinal plant used in Chinese and Indian traditional medicine, Centella asiatica (L.) Urban is also known as “Asiatic Pennywort” (Prasad et al. 2019; Sun et al. 2020). This herb has been used to treat psoriasis, burn scars, nootropic conditions, hypertonic scars, and skin cell regeneration for 3000 years (Prasad et al. 2019). Additionally, C. asiatica includes bioactive substances such as pentacyclic terpenes, primarily madecassoside, asiaticoside, and madecassic acid. Numerous in vitro and in vivo studies have shown its value in wound healing, minimizing scars, and relieving inflammation of the skin, and as a result, the cosmetics industry uses it extensively. The main goal of this study was to express the hEGF gene in C. asiatica and use positive transgenic lines for mass cultivation so that cell biomass produced in bioreactor cultures could be used for the extraction of hEGF protein for therapeutic uses. In the current study, we transformed the C. asiatica callus using vectors containing the hEGF gene and vectors containing the hEGF gene together with KDEL, a signal that directs the recombinant protein to the endoplasmic reticulum. For the production of recombinant proteins, cell suspension cultures were performed by applying chosen clones of C. asiatica transformed callus. Additionally, multiple light sources were used to induce the accumulation of hEGF protein in transgenic cell cultures, including white, red, blue, red + blue, and red + green + blue light sources. To produce hEGF protein, the transgenic cell cultures were established in balloon-type bubble bioreactors.

Induction callus of C. asiatica

Seeds of C. asiatica were germinated on Murashige and Skoog (MS, Murashige and Skoog 1962) basal medium after disinfection with 0.1% mercuric chloride and washing them in sterile distilled water three times. After seed germination, leaf segments (0.5 × 0.5 cm²) were prepared from the leaves of two weeks seedlings and cultured on MS semisolid-medium supplemented with 2.0 mg L^-1 naphthaleneacetic acid (NAA), 30 g L^-1 sucrose, and 2.4 g L^-1 gelrite (CA medium). All the cultures were maintained at 25 ± 1°C under the fluorescent light (16 h light and 8 h dark). The callus induced from the leaf explants was maintained on the same medium by sub-culturing once in four weeks.

Agrobacterium-mediated transformation

Agrobacterium tumefaciens strains harboring plasmid pKRE1 containing hEGF gene and pKRE2 containing hEGF-KDEL genes under the control of 35S promoters (Fig. 1) were used in the current study. These constructs were procured from the Director, Bio FD&C Co., Ltd., Sandangil, Republic of Korea. The calluses (2 g) of C. asiatica were immersed in A. tumefaciens suspension containing 100 µM acetosyringone for 30 min, and then calluses were cultured on CA medium and co-cultured for 3 days in the dark at 25 ± 1°C. Subsequently, the calluses were transferred to a CA medium containing 500 µg mL^-1 carbenicillin and 250 µg mL^-1 kanamycin to remove the residual A. tumefaciens. After that, calluses were transferred to CA media containing 100 µg mL^-1 of kanamycin for selection of transformed clones, and they were subcultured once a week. The better-growing calluses were selected and maintained on the CA medium as above. The selected callus lines were frozen in liquid nitrogen and stored at -70°C for molecular analysis.

Figure 1. Schematic representations of genetic constructs for allowing cytoplasmic hEGF accumulation or endoplasmic retention signal, hEGF-KDEL, under the control of the CaMV 35S promoter. A. Expression cassettes used for Centella asiatica transformation. B. PCR analysis of gDNA extracted from putative transgenic callus lines of C. asiatica. The PCR mixture was prepared by mixing 3 µl diluted gDNA and 2 µl primer set in Prime Taq Pre-mix (2X). Electrophoresis was performed using a 1.5% agarose gel for 60 min at 50 V. Lane M: DNA ladder; Lane E3 to E11, hEGF transgenic callus lines; Lane EK1-EK7, hEGF-KDEL transgenic callus lines; hEGF, human epidermal growth factor; PCR, polymerase chain reaction; gDNA, genomic DNA

Confirmation of hEGF gene insertion in transgenic callus

To confirm the presence of the hEGF gene in transgenic callus lines, 100 mg of putative transgenic callus of C. asiatica was selected from the antibiotic medium and were pulverized using TissueLyser II (Qiagen, Germany). Genomic DNA was isolated using the cetyltrimethylammonium bromide (CTAB) method (Rogers and Bendich 1985). Nanodrop (DeNovix, USA) was used to measure the concentration and purity of gDNA, and gDNA was diluted to 10 pmol using tertiary sterile water. A PCR mixture was prepared by mixing 3 µL diluted gDNA and 2 µL primer set in 2x Prime Taq Premix (GeNet Bio, Korea; Table 1). The primer set was diluted to 10 pmol with tertiary sterile water. A PCR reaction was carried out using CFX96 TouchTM Real-Time PCR (Bio-Rad, California, USA). PCR conditions involved 30 cycles of denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, and extension at 72°C for 40 sec, followed by a final extension for 7 min at 72°C. The DNA was mixed with Dyne Loading STAR (DYNEBIO, Korea) in a ratio of 1:4 (DNA: Dye), and then electrophoresed on 1.5% agarose gel for 60 min at 50 V using Mupd-exU (ADVANCE, Japan). DNA marker was used with ExcelBand 100 bp + 3K DNA ladder (SMOBio, Taiwan) and DNA bands were examined using Econo Gel Documentation (Optinity, China).

Table 1 . Primer sets used for PCR analysis.

	Primer	5′ à 3′	Amplicon size (bp)
RT-qPCR	hEGF Fw	AGAATGAAGAATACCAGCTCTTTGTGT	254
	hEGF Rv	TACCTATCAGCGAAGCTCCCACCACTT
	hEGF-KDEL Fw	AGAATGAAGAATACCAGCTCTTTGTGT	266
	hEGF-KDEL Rv	TACCTATCACAGCTCGTCCTTGCGAAG
	5.8s rRNA Fw	CGGCAACGGATATCTCGGCTCT	201
	5.8s rRNA Rv	TCCGCCCCGACCCCTTTC

RT-qPCR, quantitative reverse transcription-polymerase chain reaction; hEGF, human epidermal growth factor..

hEGF expression in transgenic callus lines

Analysis of hEGF expression in transgenic callus lines was carried out by RT-qPCR. 100 mg transgenic cell lines which were cryopreserved in liquid nitrogen pulverized with Tissue Lyser II (QIAGEN, Germany) for the isolation of RNA according to the protocol of NculeoSpin® RNA Plant and Fungi Kit (MN, Germany). cDNA was synthesized by using ReverTRa Ace® qPCR Master Mix (TOYOBO, Japan). The cDNA was diluted to 100 ng µL^-1 and used for RT-qPCR. An RT-qPCR test was performed by adding 10 µL of TB green Premix Ex Taq (Takara, Japan), 1 µL of forward primer and reverse primer, 6 µL of distilled water, and 2 µL of cDNA to PCR tubes. The primer set was designed as shown in Table 1 for RT-qPCR, and the reference gene for normalization of expression level was the 5.8s rRNA gene. For the RT-qPCR reaction, CFX96 Touch TM Real-Time PCR (Bio-Rad, California, USA) was used.

hEGF Protein Extraction and Purification

For the isolation and analysis of hEGF protein from the transformed lines, the cells were separated from the medium by centrifugation for 20 min at 16,000 × g at 4°C. The cell pellets were washed with ice-cold 50 mM Tris-HCl (pH 8.0) to remove debris and contaminants. For protein extraction, the cell pellets were resuspended in a lysis buffer composed of 50 mM Tris-HCl (pH 8.0) with a protease inhibitor cocktail (Roche, 04693116001). The suspension was disrupted using sonication (Branson, SFX 550) to release the cellular contents. The lysate was then centrifuged for 20 min at 16,000 × g at 4°C to separate the soluble fraction (supernatant) from the insoluble fraction (cell debris). The solutions are filtered through 0.22 µm filters under vacuum. The soluble fraction containing the hEGF protein was subjected to ion exchange chromatography (Cytiva, HiTrap™ Q Sepharose Fast Flow, 17515601) and hydrophobic interaction column (Cytiva, HiTrap™ HIC selection kit 7, 28411007). The sample was loaded to the Äkta Avant system (Cytiva, ÄKTA pure™, 29046665, 150L) at a constant flow rate of about 1 mL/min. A gradient elution was performed to elute the column-bound hEGF protein using 25 mM Tris-HCl (pH 9.0) and 1 mM NaCl. The eluted fraction containing hEGF was subjected to desalting and buffer change using a dialysis system (Thermo Fisher, Slide-A-Lyzer™ dialysis cassettes, 66430). Dialyzed purified hEGF protein samples were stored in a deep freezer (-80°C).

Western blot assays

The samples (lines E3 with the hEGF gene and EK2 with the hEGF-KDEL gene) were lysed with SDS lysis buffer containing 10 mM EDTA pH 8.0, 10 mM β-mercaptoethanol, 4 mM DTT, 0.1% Triton X-100, 0.1% SDS, 250 mM sucrose, and 10% glycerol. Phosphate inhibitor cocktails (Sigma, Roche, USA) were to the lysis buffer. Protein concentrations were determined by Bradford protein assay (Bio-Rad, USA). Subsequently, 20 µg of the lysates were loaded onto 12% acrylamide gels and transferred to PVDF membranes (Thermo Fisher Scientific, USA). The membranes were then blocked with 5% milk in TBS containing 0.1% Tween 20 and incubated with primary antibodies overnight at 4°C. The primary antibodies used were anti-hEGF (ab206423, 1:1000) from Abcam and anti-Actin (AS21 4615-10, 1:5000) from Agrisera. Following primary antibody incubation, HRP-conjugated anti-rabbit secondary antibodies (Vector Laboratories, PI-1000, and PI-2000, 1:5000) were applied. The membranes were developed using SupersignalTM West Femto chemiluminescence reagents (Thermo Fisher Scientific, USA), and scanned using a chemiluminescence scanner (Bio-Rad, USA).

ELISA assay

The protein samples were diluted at a ratio of 1:20 before each assay and were evaluated using a commercially available hEGF ELISA kit (R&D Systems Inc., USA) according to the manufacturer’s instructions. Each well was loaded with 10 µL of total protein in 200 µL of volume, resulting in a concentration of 50 ng µL^-1. The detectable range for hEGF levels in the assay was 3.9-250 pg mL^-1. The analysis was conducted using the Thermo Fisher Scientific Multiscan® FC1 Front microplate spectrophotometer at a wavelength of 450 nm.

Cell cycle analysis using flow cytometry

Cell cycle analysis in the transformed calli was carried out as per the procedure of Lee et al. (2018). Analysis was carried out on a PA flow cytometer (PA, Partec, Munster, Germany) and data were processed with DPAC software Partec, Munster, Germany.

Effect of light quality on accumulation of hEGF protein in suspension cultures of transgenic cells

Based transgenic analysis 4 lines containing hEGF gene (E3, E5, E10 and E11) and 6 lines containing hEGF-KDEL gene (EK1, EK2, EK3, EK4, EK6, and EK7) were selected. To enhance the accumulation of hEGF protein two cell lines namely E3 and EK2 were selected. Cell suspension was established in 100 ml of CA medium and 2.5 g of inoculum in 250 ml Erlenmeyer flasks. The cultures were kept on an orbital shaker at 100 rpm. The effect of white, red, blue, red + blue, and red + blue + green light was tested in order to enhance the accumulation of hEGF protein. The light source was provided with light-emitting diodes (LED BWF 5050; LEDZONE Co., Goyang, Korea). The effect of white (420-700 nm), red (R, 620 nm), blue (B, 450 nm), red and blue (1:1, RB), red, green, and blue (1:1:1. RGB; G stands for the green of wavelength 520 nm) lights at 40 ± 2 µmol m^-2s^-1 and photoperiod of 16 h light and 8 h dark were tested for 3 weeks. One set of cultures that were kept in dark conditions on the orbital shaker served as a control. The experiments were performed with three replicates. Cell samples were taken on 0, 3, 7, 14, and 21 days for the analysis of the cell cycle. The total soluble proteins (TSP) were analyzed after 3 weeks of culture.

Bioreactor suspension cultures of transgenic cells for the production of hEGF protein

Transgenic cell line EK2 of C. asiatica was initially cultured in Erlenmeyer flasks using MS medium containing 2.0 mg L^-1 NAA and 30 g L^-1 sucrose and maintained on an orbital shaker at 100 rpm in dark conditions. Cells were sub-cultured once in 4 four weeks to fresh medium and cell stocks were maintained. Subsequently, C. asiatica transgenic EK2 cell lines were used for established bioreactor cultures. Bioreactor cultures were established in 3 L capacity balloon-type bubble bioreactors using 1.5 L MS medium with 2.0 mg L^-1 NAA and 30 g L^-1 sucrose. 5 g L^-1 inoculum was used and cultures were maintained at 24 ± 1°C in dark conditions the cultures were aerated with 0.1 vvm (air volume per culture volume per min) sterile air. The cultures were maintained for two weeks. EK2 callus line (0.5 g) was also cultured in the Petri plates using MS semisolid medium supplemented with 2.0 mg L^-1 NAA, 30 g L^-1 sucrose, and 2.4 g L^-1 gelrite for two weeks. The cells and callus were harvested from bioreactor cultures and Petri plates respectively after two weeks and fresh biomass was determined. The growth index was determined by the formula fresh weight of the cells-dry weight of the cells/dry weight of cells.

Assessment of hEGF using the Cell Counting Kit-8 (CCK-8) assay

The study aimed to assess the impact of hEGF on human skin keratinocytes (HaCaT) growth, proliferation, and survival by conducting a CCK-8 assay. HaCaT cells were seeded at a density of 5 × 104 cells per well in a 96-well plate and incubated for 24 hours. The cells were then treated with the final concentration of hEGF for 24 hours, with a non-transgenic cell line serving as control. After hEGF treatment, 1X CCK-8 solution (Donginbio, Korea) was added to each well, the cells were incubated for 3 hours. A Thermo Scientific Multiscan GO microplate Spectrophotometer (Fisher Scientific Ltd., Vantaa, Finland) was used to measure the wavelength absorbance at 450 nm. The percentage of cell viability was calculated using the formula: (absorbance of treated cells/ absorbance of control cells) × 100.

Statistical analysis

Three replicate cultures were maintained for each treatment and mean values of replicates were presented as results. Statistical analysis of differences between mean values was then assessed by Duncan’s multiple range test (DMRT). A p-value of 0.05 was considered to indicate statistical significance, and all data were analysed using SAS version 9.4 (SAS Institute, Cary, NC, USA).

Agrobacterium-mediated transformation of C. asiatica callus with EPF and EPF-KDEL gene constructs

In the current work, target cells were transformed using two constructs (Fig. 1). pKRE1, and pKRE2, which contained the hEGF and hEGF-KDEL genes (KDEL sequence targeting peptides to endoplasmic reticulum), respectively (Fig. 1A). Agrobacterium tumefaciens with the aforementioned constructions was co-cultivated with the callus of C. asiatica. The preliminary transgenic callus was picked from the sub-culture after transformation for four weeks on a selection medium containing 100 µg mL^-1 kanamycin. After numerous sub-cultures, the callus lines were chosen that displayed greater cell proliferation on antibiotic selection media. Utilizing primers specific to hEGF and hEGF-KDEL, genomic DNA was extracted from a subset of lines and subjected to PCR analysis (Table 1). The lines that have shown stable integration of the 266 bp hEGF-KDEL and 254 bp hEGF-positive sequences were chosen (Fig. 1B). hEGF gene positivity was found in callus lines E3, E5, E10, and E11. Similarly, hEGF-KDEL gene integration positivity was found in callus lines EK1, EK2, EK3, EK4, EK6, and EK7.

hEGF expression in transgenic callus lines of C. asiatica

The growth performance, gene expression level, and protein yield of the positive transgenic callus lines were evaluated during the four-week sub-culture on an antibiotic medium. The results are shown in Fig. 2. The hEGF lines E3 and E11 grew most efficiently and produced biomass of 2.21 and 2.43 g mass^-1, respectively. Similar to this, several hEGF-KDEL lines also showed improved growth, with fresh biomass reaching 1.47-1.72 g mass^-1. By using RT-qPCR data to compare the gene expression levels of various lines, it was determined that hEGF line E3 was the most effective line. It displayed an expression level of 1.5 times, which was 6.5 times greater than that of the E5 line. Among hEGF-KDEL lines, EK2 exhibited an expression level of 1.4 times, which was 13 times higher than that of the EK3 line, which exhibited the lowest expression level (Fig. 2). The best yielding lines were E3 and EK2, according to the fresh weight and hEGF expression level, for overall hEGF yield.

Figure 2. Transgenic hEGF and hEGF-KDEL cell lines of Centella asiatica. hEGF expression and growth was determined after 4 weeks of culture. Quantitative reverse transcription-polymerase chain reaction analysis was performed by adding 10 μL of TB green Premix Ex Taq, 1 μL of forward primer and reverse primer, 6 μL of dH2O, and 2 μL of cDNA to PCR tubes. zDifferent letters indicate significant differences at p < 0.05 according to Duncan’s multiple range test (n = 3 with hEGF and hEGF-KDEL lines). hEGF, human epidermal growth factor

Western blot analysis was used to confirm the expression of hEGF, and the findings are shown in Fig. 3. The recombinant hEGF protein standard was positive control. Western blot analysis showed no significant difference in standard hEGF with that of hEGF obtained from transformed cells of C. asiatica (Fig. 3A). The E3 line (hEGF) had an expression level of hEGF protein of 7800 ± 050 pg mL^-1, whereas the EK2 line (hEGF-KDEL) had an expression level of 5650 ± 350 pg mL^-1 (Fig. 3B). With the E3 and EK2 lines, respectively, the maximum expression levels of hEGF protein were 7.86% and 8.00% of the total soluble protein.

Figure 3. Western blot analysis of transgenic hEGF and hEGF-KDEL cell lines of Centella asiatica. A. Immunoblotting of hEGF protein. B. hEGF concentration [M, marker; WT, non-transformed callus; PC, positive control (200 ng of recombinant hEGF protein obtained from Sigma-Aldrich)]. (n = 3 with each analysis). hEGF, human epidermal growth factor

Cell cycle analysis in transgenic lines and correlation with hEGF expression

Fig. 4 shows the findings of the cell cycle analysis we performed on the transformed cell lines in the current investigation using flow cytometry. Of all the hEGF-converted lines examined, the E3 line displayed the highest percentage of G2/M stage cells at 16%. EK2 and EK6 similarly displayed 15.7% and 13.78% of cells in the G2/M stages in the hEGF-KDEL lines. Additionally, we looked at the relationship between the expression of the hEGF gene and the cell’s fresh biomass, total soluble protein content, and cell division (the proportion of cells in the G2/M phase) (Fig. 5). However, there was a positive correlation between hEGF gene expression and cell division or the proportion of cells in the G2/M phase. Cell fresh biomass/weight and total soluble protein did not significantly correlate with hEGF gene expression.

Figure 4. Cell cycle analysis of hEGF and hEGF-KDEL transgenic lines via flow cytometry. G0/G1, Gap1 phase; S, DNA synthesis phase; G2/M, Gap2 phase and metaphase (n = 3 with each analysis). hEGF, human epidermal growth factor

Figure 5. Correlation analysis of hEGF expression with fresh weight of the cells, total protein content, and ratio of cells which were in G2/M phases of the cell cycle. Gene expression level was determined via quantitative reverse transcription-polymerase chain reaction. hEGF, human epidermal growth factor

Influence of light quality on cell proliferation and hEGF expression

In the current study, we treated C. asiatica cell suspensions with various LED sources, including red light (620 nm), blue light (450 nm), red: blue: green: blue (R+G+B; 1: 1: 1), white light (420-700 nm) of 40 mol m^-2 s^-1 (16 h light and 8 h dark), and continuous dark conditions. We then observed the cell cycle, growth of the cells, and expression of the hEGF According to the findings, the G2/M phase increased on day three when cultures were incubated under white and RGB light, but it started to decline after day seven (Fig. 6). On the other hand, the G2/M was raised in the cultures that were incubated in the dark starting on the seventh day. Additionally, it was shown that there was no discernible difference between various light treatments and dark treatments in terms of biomass accumulation (fresh weight), total soluble protein, and yield (Fig. 7). The highest levels of fresh weight accumulation and protein production were seen in the E3 line cell suspension that was incubated in the dark (Fig. 7). Similarly, dark-incubated EK2 line cell suspensions demonstrated the maximum protein increase and protein production (Fig. 7). Dark incubation is therefore excellent for protein accumulation and biomass increase in C. asiatica transgenic lines.

Figure 6. Effect of incubation in the dark and with exposure to different light conditions on the proportion of cells which were in G2/M phases during cell suspension cultures of transgenic EK2 cell lines. Values are presented as the mean ± standard error (n = 3). hEGF, human epidermal growth factor

Figure 7. Effect of incubation in the dark and with exposure to different light conditions on fresh weight, total soluble protein, and yield in transgenic cell lines of E3 and EK2 cells. Values are presented as the mean ± standard error (n = 3 with each analysis)

Bioreactor suspension cultures of transgenic cells for the production of hEGF protein

In the current investigation, the EK2 line of the C. asiatica that had been transformed with the hEGF-KDEL was used. Bioreactor cultures of this line were established in 3 L balloon-type bubble bioreactors that contained 1.5 L of CA media, and the cultures were kept alive for 14 days (Fig. 8). From 6 to 12 days, cells engaged in growth, multiplication, and biomass accumulation (Fig. 8). The greatest growth was seen between days 8 and 10 of cultivation. Fresh biomass accumulation and the growth index were 306 g and 6.1 respectively when cells were harvested 15 days after culture, compared to a growth index increase of 2.5 for callus cultures in pert-dish at the same time (Fig. 9). When compared to callus produced in Petri plates, bioreactor cultures showed a 2.4-fold increase in biomass accumulation. Cell biomass hEGF expression was also higher in bioreactor cultures (Fig. 9).

Figure 8. Analysis of cell growth of the cell line EK2 between petri-dish and bioreactor culture conditions (3 L capacity in balloon-type bubble bioreactors) for 14 d. Values are presented as the mean ± standard error (n = 3)

Figure 9. Growth index and hEGF expression of the transgenic cell line EK2 line in semi-solid and liquid cultures. Growth index was determined using the formula: fresh weight of the cells - dry weight of the cells/dry weight of cells. Values are presented as the mean ± standard error (n = 6). Statistical analysis of the data was performed using an independent sample t-test to compare the mean values between two groups. *** - significantly different at a p-value of 0.05. hEGF, human epidermal growth factor

Cell proliferation of human keratinocytes HaCaT lines using hEGF protein produced in cell suspensions of C. asiatica

Human keratinocytes and HaCaT cell line cultures were used to evaluate the efficacy of hEGF protein made from transformed C. asiatica cell cultures. The results are shown in Fig. 10. In comparison to proteins recovered from non-transformed cells the protein isolated from hEGF transgenic callus EK2 demonstrated very strong cell proliferation at concentrations of 2-100 ng/ml.

Figure 10. Comparison of effects of protein extracts from a non-transgenic (first column) and transgenic cell line (EK2 cells - varied concentration effect) on proliferation of HaCaT cells analyzed via CCK-8 assays. Values are presented as the mean ± standard error (n = 3 with each treatment)

Production of therapeutic proteins through recombinant DNA technology in plant systems, especially in cell suspension cultures has become a useful technology these days (Egelkrout et al. 2012; Xu et al. 2011, 2012). The advantages of transgenic plant cell cultures as an expression system are cost-effectiveness, high level of accumulation of proteins, low risk of contamination with animal pathogens, relatively simple and cheaper protein purification, ease of the scale-up process, post-translation modifications (Demian and Vaishnav 2009; Xu et al. 2011, 2012). In several cases, post-translation protein degradation by proteases within plant cells has been reported (Doran 2006). However, targeting proteins by cloning additional endoplasmic reticulum retention signal KDEL sequences along with recombinant genes, target the recombinant proteins to the Golgi complex and the endoplasmic reticulum. This may lead to the enhanced accumulation of target proteins in plant cells (Doran 2006; Sharma and Sharma 2009). In the current study, two constructs pKRE1 and pKRE2 containing hEGF and hEGF-KDEL genes respectively were used for the transformation of C. asiatica callus and obtained positive transformant lines. The PCR analysis depicted that the E3, E5, E10, and E1 were positive for hEGF gene integration with transgenic calli. Likewise, EK1, EK2, EK3, EK4, EK6, and EK7 were positive with hEGF-KDEL gene incorporation. Similar to the current results Agrobacterium-mediated transformation has resulted in the successful transformation of hEGF genes into tobacco and rice (Bai et al. 2007; Wu et al. 2014). Agrobacterium-mediated transformation was also efficient in the transformation of other useful genes in plant systems for the production of recombinant proteins (Chung et al. 2009; Sidorov et al. 2006).

The transformed lines E3 and EK2 containing hEGF and hEGF-KDEL genes demonstrated higher expression levels as assessed by RT-qPCR and were also involved in growth performance and protein yield. The greatest levels of hEGF protein expression were 7.86% and 8.00% of the total soluble protein with the E3 and EK2 lines, respectively. Numerous plant systems, including Nicotiana tabacum, Oryza sativa, and Solanum tuberosum, have expressed the hEGF gene (Bai et al. 2007; Higo et al. 1993; Salmanian et al. 1996; Wirth et al. 2004, 2006). With varying degrees of success, each of these studies tried to localize hEGF to different subcellular compartments. hEGF was specifically targeted to the endoplasmic reticulum by Bai et al. (2007), who attained up to 0.1% of TSP. Wu et al. (2014) were successful in obtaining 1.8% and 7.4% of TSP by directing hEGF to the endoplasmic reticulum in suspension and seedling forms of Oryza sativa, respectively.

According to findings in the literature, transformed cell lines with the highest levels of cell division (G2/M phase) express the most hEGF (Cazzonelli and Velten 2006). In the current work, we used flow cytometry to analyse the cell cycles of the transformed cell lines. The results showed that among all the cell lines evaluated, lines E3 with the hEGF gene and EK2 with the hEGF-KDEL gene were in the best G2/M stages. However, there was no association between gene expression and cell division or the proportion of cells in the G2/M phase.

With cell suspension cultures, culture conditions can be easily changed to promote increased cell division and proliferation processes, allowing for the production of higher levels of recombinant protein (Schillberg et al. 2013). Numerous studies have demonstrated that the kind and amount of light have an impact on the development of transgenic plants’ ability to accumulate recombinant protein. For instance, Cazzonelli and Velten (2006) showed that, in contrast to dark conditions, treatment with a photosynthetic photon flux density of 80-100 mol m^-2 s^-1 increased the amount of recombinant luciferase in transgenic tobacco plants. Similar to this, De Clercq et al. (2002) demonstrated that Phaseolus acutifolius callus cultures displayed increased expression of recombinant glucuronidase when cultures were treated with a photosynthetic photon flux density of 20 mol m^-2 s^-1, but no expression was identified in those treated in the dark. However, Norikane (2015) showed that when the plants were grown under light-emitting diode (LED) light sources, the quality of the light (red, far-red, etc.) had an impact on the growth of transgenic tobacco plants and the accumulation of recombinant proteins. In the current investigations, C. asiatica cell suspensions were treated using a variety of LED sources, including red light (620 nm), blue light (450 nm), red: blue (R+B; 1:1), red: green (R+G+B; 1:1:1), white light (420-700 nm) of 40 mol m^-2 s^-1, and continuous dark conditions. Our research findings demonstrated that the dark treatment of cultures was considerably superior to the light treatment in terms of biomass growth and protein accumulation. These findings support an earlier finding that dark treatment promoted recombinant protein accumulation in Nicotiana benthamaina plants but the light treatment had no beneficial effects (McDonald et al. 2014).

To reach commercial productivity of recombinant proteins, plant cell cultures must be scaled up during process development after cell line development (Schillberg et al. 2013). The choice of the scale-up method relies on the species and culture type, depending on traits including cell growth, shape and aggregation, shear sensitivity, oxygen consumption, and culture rheological qualities. Stirred tanks, bubble columns, and air-lift bioreactors are utilized (Schillberg et al. 2013; Xu et al. 2011). In the current study, C. asiatica transgenic cell lines were grown in balloon-shaped bubble bioreactors, which produced greater growth indices and higher biomass accumulation than semi-solid cultures. In line with recent findings, Park et al. (2020) produced recombinant miraculin protein in transgenic carrot cell suspension cultures using balloon-type bubble bioreactors.

Efficacy testing of the hEGF protein produced from transformed C. asiatica cell cultures was done in the current study, and human keratinocytes from the HaCaT cell line cultures were used to treat the protein. The results showed that treating HaCaT cells with recombinant protein improved cell growth. Similar to the current findings, Bai et al. (2007) and Hanittinan et al. (2020) have shown that human keratinocytes HaCaT cells can be activated by plant-produced hEGF.

In the current investigation, we effectively produced a range of transformed lines by transforming C. asiatica callus with Agrobacterium tumefaciens strains carrying the hEGF gene and the hEGF-KDEL gene on plasmids pKRE1 and pKRE2, respectively, under the control of 35S promoters. PCR analysis was used to confirm the transformation, and qRT-PCR analysis was used to evaluate hEGF gene expression. Using hEGF gene-containment-confirmed cell lines, we produced cell suspension cultures in Erlenmeyer flasks and balloon-type bubble bioreactors. Using human keratinocytes HaCaT cells, we have further proven the effectiveness of hEGF protein generated in cell cultures. The aforementioned findings showed that plant cell culture systems have the ability to produce recombinant hEGF, which might be used by the cosmetics sector and for therapeutic applications.

SY Park and HN Murthy are thankful for the “Brain Pool” (BP) program, Grant No. 415 2022H1D3A2A02056665.

S.-Y.P. planned, executed, and supervised the research work. G.-E.B. conducted the experiments. H.-S.L., X.B., H.-H.S., S.-H.M., and E.-J.S. helped with the molecular analysis and efficacy analysis. H.N.M. has interpreted the data and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

This work was supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (No. NRF-2020R1A2C2102401), the Technology Innovation Program (Biorisk Assessment Renovation Project) (20015900) and Advanced Technology Centre Plus (ATC+, 20017936) funded By the Ministry of Trade, Industry, and Energy (MOTIE, Korea). This work was partially supported by a funding for the academic research program of Chungbuk National University in 2024.

The datasets used and/or analyzed during this study are available from the corresponding author upon reasonable request.

The authors declare no competing interests.