The yeast cadmium factor 1 (YCF1) from Saccharomyces cerevisiae is a common enzyme that detoxifies heavy metals, including Cd, As, and Sb (Preveral et al. 2006). Previous studies have investigated the detoxification of heavy metals through YCF1 heterologous expression in higher plants. In Arabidopsis thaliana, YCF1 overexpression enhanced Pb and Cd tolerance and increased their accumulation (Song et al. 2003). Similarly, in Brassica juncea, YCF1 overexpression enhanced the tolerance to Cd and Pb stress (Bhuiyan et al. 2011). Transgenic Populus alba × Populus. tremula var. glandulosa overexpressing YCF1 exhibited increased Cd content compared with that in non-transgenic plants (Shim et al. 2013).

Various signaling pathways involved in plant defense regulate resistance to abiotic stresses, such as heavy metals. Among these, the effective scavenging of reactive oxygen species (ROS) that accumulate owing to abiotic stress is one of the mechanisms for increasing stress resistance. Exposure of plant cells to environmental or abiotic stresses leads to ROS accumulation, triggering cellular responses to external stimuli (Nadarajah 2020). Excessive ROS can cause cellular toxicity, senescence, and cell death. Plants maintain ROS homeostasis by reducing ROS accumulation via the activation of antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPX), and ascorbate peroxidase (APX) (Hasanuzzaman et al. 2020; Zandi and Schnug 2022).

Plants have evolved complex signaling networks involving various transcription factors that modulate the expression of antioxidant genes in response to stress to regulate ROS levels (Wang et al. 2024; You and Chan 2015). Among them, the WRKY family plays a crucial role. The WRKY family members comprises transcription factors involved in abiotic stress responses that achieve cellular homeostasis by recognizing the W-box in the promoter and inducing the expression of target genes (Rushton et al. 2010). In A. thaliana, AtWRKY13 overexpression decreased Cd accumulation and enhanced Cd tolerance (Sheng et al. 2019). WRKY25 involved in intracellular redox regulation and enhanced resistance to oxidative stress. WRKY25 overexpression increases the H₂O₂ scavenging capacity in Arabidopsis, which increases lifespan without increasing senescence (Doll et al. 2020).

This study aimed to reveal the ROS regulation mechanism considering the correlation between the YCF1 heterologous expression and stress resistance under abiotic stress conditions in Arabidopsis. YCF1 heterologous expression was achieved via Agrobacterium-mediated transformation. Molecular and physiological analyses were performed to investigate the effects of the YCF1 gene on ROS scavenging and transcription factor regulation. YCF1 heterologous expression maintains ROS homeostasis by activating ROS-scavenging genes under heavy metal and oxidative stress conditions. Additionally, we analyzed the expression patterns of the WRKY family members to assess their role in stress tolerance, particularly considering YCF1 heterologous expression.

Growth conditions and stress treatments

In this study, A. thaliana (L.) Columbia (Col-0) was used to generate transformants. Seeds were sterilized with 70% ethanol and 0.5% Triton X-100 for 1 min, and the process was repeated thrice. The sterilized seeds were sown on Murashige and Skoog medium (1/2 MS [Sigma-Aldrich, St Louis, MI, USA) with 15 g/L sucrose and 8 g/L Phyto Agar (Sigma-Aldrich) and kept in the dark at 4°C for 4 days for cold stratification. Next, the seeds were placed in a growth chamber at 22°C and a photoperiod of 16 h light / 8 h dark, with a light intensity of 120 µmol photos/s²/m.

After 4 days, the germinated seeds were transferred to separate media for cd, salt, and H₂0₂ treatments. Cd concentrations of 50 and 100 µM (Zhang et al. 2018) and H₂0₂ concentrations of 0.5 and 1 mM, considering concentrations used in previous studies (Huang et al. 2011).

Vector construction for YCF1 and transformation

The vector was constructed using pCAMBIA1302 as the backbone, and the CaMV 35S promoter was used for YCF1 heterologous expression. The YCF1 sequence was obtained from UniProt (UniProt, Geneva, Switzerland) and synthesized at the Biofact Company in Daejeon, Korea. YCF1 was cloned into pCAMBIA1302 and digested with BamHI and XbaI. The pCAMBIA1302-YCF1 vector was introduced into the Agrobacterium tumefaciens strain GV3101, and YCF1 transformants were generated using the floral dip method (Clough and Bent 1998). YCF1 transformants cultured on MS agar medium containing hygromycin (50 mg/mL) and kanamycin (50 mg/mL) were selected using the selective marker of the pCAMBIA1302-YCF1 vector. The genomic DNA of A. thaliana was amplified for genotype confirmation using the YCF1 primers. The sequences of all primers are listed in Table 1. Homozygous T2 and T3 seeds were obtained through segregation for heritability analysis.

Table 1 . List of primers used in this study.

Name	Sequence (5’-3’)	Use	Reference
YCF1-BamHI	GGATCCATGGCTGGTAATCTT	YCF1 construction	In this study
YCF1-XbaI	TCTAGAATTTTCATTGACCAAACCAGC		In this study
YCF1-F	CATGAGTGCGTTCTATCCCTCTAT	Confirmation of transformants qRT-PCR	In this study
YCF1-R	CCACCTTCGGTTAGTTGGGCATCT		In this study
UBQ10-F	GGCCTTGTATAATCCCTGATGAATA	qRT-PCR	Dugard et al. (2016)
UBQ10-R	AAAGAGATAACAGGAACGGAAACATA
WRKY13-F	ATCACAAACCGTCATAAACC		In this study
WRKY13-R	AACCCTAATCTCGTCTTTGT		In this study
WRKY25-F	CTTCCGGCGTTGACTGTTAC		In this study
WRKY25-R	GCTTCTCAGCTCCTCACACA		In this study
CAT-F	AAGTGCTTCATCGGGAAGGA		In this study
CAT-R	CTTCAACAAAACGCTTCACGA		In this study
SOD1-F	TCCATGCAGACCCTGATGAC		In this study
SOD1-R	CCTGGAGACCAATGATGCC		In this study
APX1-F	TGCCACAAGGATAGGTCTGG		In this study
APX1-R	CCTTCCTTCTCTCCGCTCAA		In this study
GST2-F	ATCACCAGTTCGACCCAGTG		In this study
GST2-R	CTCCTCTTCTGCAACAACGG		In this study

RNA extraction and quantitative reverse transcription polymerase chain reaction

RNA was isolated using TRIzol (Ambion, Austin, TX, USA) and a QIAGEN RNeasy kit (Qiagen, Germantown, MD, USA). Total RNA (200 ng) was used to synthesize cDNA using the GoScriptreverse transcription system (Promega, Madison, WI, USA). The relative expression levels were calculated using the 2^−ΔΔCT method using UBQ10 as the housekeeping gene. Real-time quantitative polymerase chain reaction was performed using a CFX Connect Real-Time System (BioRad, Hercules, CA, USA) under the following reaction conditions: 95°C for 15 min followed by 44 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 20 s, and a final extension at 72°C for 1 min (Lee et al. 2017). The sequences of all primers are listed in Table 1.

Primary root length and fresh weight determination

After capturing images of the seedlings, the root length was determined using ImageJ software (National Institute of Health, Bethesda, MD, SA). Finally, the fresh weights of A. thaliana fresh weight were measured.

Statistical analysis

All experiments were performed in triplicate. The results are presented as mean ± standard deviation (SD), and the error bars represent the SD. Asterisks indicate significant differences between YCF1 transformants based on the Holm-Sidak method (* and ** represent P < 0.05 and P < 0.01 significance levels, respectively) (Lee et al. 2022). Root length and fresh weight were analyzed by one-way ANOVA, followed by Tukey’s HSD test, with significance set at p < 0.05.

Generation of transformants expressing heterologous YCF1

To generate transformants expressing YCF1 heterologous, the multiple cloning site region of the pCAMBIA1302 vector was digested with the restriction enzymes XbaI and BamHI, and the YCF1 gene was ligated into the vector (Fig. 1A). Transformants were selected on 1/2 MS medium containing hygromycin. Two distinct phenotypes were observed in the YCF1 heterologous expression transformants. One exhibited a wild-type-like phenotype, similar to that of Col-0, whereas the other displayed a dwarf phenotype. We designated these transformants as YCF1_Wt and YCF1_Dw. Expression analysis of the T3 generation revealed that the YCF1 expression level in YCF1_Dw was 3-fold higher than that in YCF1_Wt (Fig. 1B).

Figure 1. Schematic diagram of the yeast cadmium factor 1 (YCF1) expression construct and relative YCF1 expression in transformants. (A) Schematic representation of the pCAMBIA1302 vector used for YCF1 overexpression in Arabidopsis thaliana. (B) Relative expression levels of YCF1 in transformants. Significant differences between YCF1_Wt and YCF1_Dw are represented with asterisks; significance assessed based on the Holm–Sidak method (**P < 0.01). The error bars represent the standard deviation of means. YCF1_Wt- YCF1-exhibiting wild type phenotype, YCF1_Dw-YFC1-exhibiting dwarf phenotype

YCF1_Wt and YCF1_Dw physiological characterization

The leaf morphologies of YCF1-Dw and YCF1-Wt plants exhibited pronounced divergence when grown on 1/2 MS medium (Fig. 2A). The leaves of YCF1-Wt plants exhibited a morphology analogous to that of Col-0, while YCF1-Dw had a distinct outward curling phenotype. Additionally, YCF1-Dw exhibited a significantly reduced fresh weight compared with those of Col-0 and YCF1-Wt. Despite these morphological and physiological differences, root lengths were comparable across the lines, measuring approximately 40-50 mm (Fig. 2D and E).

Figure 2. Effect of yeast cadmium factor 1 (YCF1) overexpression on root length and fresh weight under oxidative stress in Arabidopsis thaliana

To investigate the correlation between YCF1 and ROS, A. thaliana was grown on 1/2 MS medium supplemented with 0.5 and 1 mM concentrations of H₂O₂ (Fig. 2B and C). In the presence of 0.5 mM H₂O₂, the YCF1-Dw root length was longer than that of Col-0 and YCF1-Wt (Fig. 2D). Specifically, the roots of YCF1-Dw grown on 0.5 mM H₂O₂ reached 62 mm, which is 1.2-fold longer than the 50 mm observed for YCF1-Wt. The fresh weight of YCF1-Dw plants had a contrasting trend compared with that of plants grown on untreated 1/2 MS medium (Fig. 2E). The fresh weight of YCF1-Dw increased to 25 mg in the presence of H₂O₂, representing a 6-fold increase compared with that of YCF1-Dw grown on untreated 1/2 MS medium. As the H₂O₂ concentration increased, the difference between YCF1-Wt and YCF1-Dw became more pronounced. Under 1 mM H₂O₂ conditions (Fig. 2C), the YCF1-Wt root length was shorter than that of Col-0, and its fresh weight was reduced (Fig. 2E). Contrastingly, YCF1-Dw maintained a root length of 55 mm and a fresh weight of 17.5 mg, both of which were greater than those of YCF1-Wt (Fig. 2D).

Gene regulation of YCF1 transformant under stress conditions

YCF1 transformants were grown under varying concentrations of heavy metals and oxidative stress to assess YCF1 expression. Media supplemented with Cd and H₂O₂ were used to induce heavy metal and oxidative stress, respectively (Fig. 3). Under Cd stress, YCF1_Dw exhibited higher levels of YCF1 expression than that of YCF1_Wt. Specifically, under 50 µM Cd, YCF1_Dw had a 7-fold increase in YCF1 expression compared with that of YCF1_Wt. Under 100 µM Cd, YCF1 expression in YCF1_Dw was > 3.5-fold higher than that in YCF1_Wt (Fig. 3A). Similarly, under H₂O₂ treatment, YCF1_Dw displayed a concentration-dependent increase in expression, exhibiting 3- and 3-fold increases in YCF1 expression compared with that of YCF1_Wt (Fig. 3B). Upregulation of YCF1 expression in YCF1_Dw was observed under heavy metal stress and in response to oxidative stress.

Figure 3. Comparative analysis of yeast cadmium factor 1 (YCF1) expression in transformants under stress conditions. (A) Relative YCF1 expression levels in transformants at 50 and 100 µM Cd. (B) Relative YCF1 expression levels at 0.5 and 1 mM H₂O₂ treatments. Significant differences between YCF1_Wt and YCF1_Dw are represented by asterisks based on the Holm–Sidak method (** indicates significance at P < 0.01). The error bars represent the standard deviation of the means. YCF1_Wt exhibits a wild-type phenotype, YCF1_Dw shows a dwarf phenotype

To assess the transcriptional regulation under stress conditions, we investigated the WRKY13 and WRKY25 expression levels (Fig. 4). Under Cd stress, all three WRKYs were upregulated in YCF1 transformants. WRKY13 expression was higher in YCF1-Dw cells than that in YCF1-Wt (Fig. 4A). Under oxidative stress conditions, WRKY25 was upregulated in YCF1 transformants (Fig. 4B). However, WRKY13 did not exhibit significant differences in YCF1 expression between Col-0 and the YCF1 transformants.

Figure 4. Expression levels of transcription factors in response to stress in Arabidopsis thaliana. (A) Relative WRKY13 and WRKY25 gene expression following 50 µM Cd treatment. (B) WRKY13 and WRKY25 relative gene expression following 0.5 mM H₂O₂ treatment. Significant differences between Col-0 and YCF1 transformants are represented with asterisks based on the Holm–Sidak method (**indicate statistical significance at P < 0.01). The error bars represent the standard deviation of the means. yeast cadmium factor 1 (YCF1)

Under cadmium stress, ROS-scavenging enzymes were upregulated in YCF1 transformants compared with that in Col-0, with SOD1 exhibiting high expression levels in YCF1-Dw (Fig. 5A). Similarly, under oxidative stress conditions, ROS-scavenging activity was upregulated in all YCF1 transformants (Fig. 5B). CAT and APX1 expression levels were higher in YCF1-Dw than that in YCF1-Wt.

Figure 5. Expression of reactive oxygen species (ROS) scavenging enzymes under stress conditions (A) CAT, SOD1, APX1, and GST2 relative expression levels following 50 µM Cd treatment. (B) Relative expression levels of the same ROS scavenging enzymes following 0.5 mM H₂O₂ treatment. Significant differences between Col-0 and Yeast cadmium factor 1 (YCF1) transformants are indicated by asterisks based on the Holm–Sidak method (* and ** indicates statistical significance at P < 0.05 and P < 0.01, respectively). The error bars represent the standard deviation of the means

The phenotypic differences observed between YCF1_Wt and YCF1_Dw were probably due to the random insertion of T-DNA during Agrobacterium-mediated transformation. YCF1_Wt and YCF1_Dw exhibited Col-0-like and dwarf phenotypes with high YCF1 expression levels, indicating that the T-DNA insertion site is critical in determining phenotypic outcomes. Random T-DNA integration disrupts or modifies the expression of endogenous genes and regulatory elements, leading to unpredictable phenotypic effects (Deng et al. 2021; Dong et al. 2020). In this study, the dwarf phenotype and elevated YCF1 expression in YCF1_Dw were probably due to an insertional effect, in which the T-DNA was integrated into a genomic region that either enhanced YCF1 expression or interfered with genes essential for normal growth and development. Mapping T-DNA insertion sites is necessary to determine whether these differences are due to random T-DNA integration or YCF1 overexpression.

WRKY transcription factors, including WRKY13 and WRKY25, are key regulators of plant stress-response pathways and have been extensively studied across various species (Schluttenhofer and Yuan 2015; Wani et al. 2021). WRKY13, in particular, enhance Cd tolerance in A. thaliana, and its overexpression leads to increased Cd resistance by upregulating the genes involved in detoxification and stress response pathways. WRKY25 primarily responds to oxidative stress, such as that induced by H₂0₂. WRKY25 overexpression improves oxidative stress tolerance by regulating antioxidant genes, while its reduction increases oxidative damage (Li et al. 2011; Zheng et al. 2007).

In YCF1_Dw, distinct upregulation of WRKY13 and WRKY25 was observed under Cd and oxidative stress conditions (Fig. 4). WRKY13 exhibited higher expression under Cd stress (Fig. 4A), consistent with its role in enhancing Cd tolerance (Sheng et al. 2019; Zhang et al. 2020), while WRKY25 is more upregulated under oxidative stress, which is consistent with its function in mitigating oxidative damage (Fig. 4B). This differential expression suggests that YCF1 influences these transcription factors differently depending on the type of stress (Li ShuJia et al. 2009; Liu et al. 2024), with YCF1 and WRKY13 correlating to enhance Cd detoxification, and YCF1 and WRKY25 correlating to alleviate oxidative stress, highlighting the complexity of stress response networks in Arabidopsis and indicating that YCF1 selectively modulates WRKY transcription factors to optimize stress defense strategies.

YCF1_Dw exhibited enhanced ROS scavenging activity compared with those in YCF1_Wt and Col-0 under stress conditions, as reflected by the increased expression of key antioxidant enzymes, such as SOD1, CAT, APX1, and glutathione S-transferase theta 2 (Fig. 5). Elevated YCF1 expression in YCF1_Dw resulted in robust ROS scavenging, enabling plants to manage oxidative stress. WRKY13 and WRKY25 up-regulation further reveals the influence of YCF1 on multiple stress response pathways, with WRKY13 and WRKY25 playing significant roles under Cd and under oxidative stresses, respectively. Although these results are promising, further studies are needed to comprehensively understand the interactions between YCF1 and the transcription factors under various stress conditions. The increased ROS scavenging and differential WRKY expression resulted in YCF1_Dw being a more resilient line under various environmental stressors compared with the wild type. Additionally, the dwarf phenotype of YCF1_Dw has practical advantages, as its smaller stature makes it easily distinguishable in a field setting, facilitating its identification and potential removal when necessary (Kumar et al. 2023; Mohanty et al. 2022). This trait could be particularly useful in controlled environments or phytoremediation applications where selective management of transgenic plants is required (Rocha et al. 2022; Stephenson and Black 2014; Zhang et al. 2022).

This work was supported by grants from the National Institute of Ecology (NIE), funded by the Ministry of Environment of the Republic of Korea (NIE-A-2024-04, NIE-A-2024-10, and NIE-A-2024-11).