Sitemap
JPB 로고The Korean Society of Plant Biotechnology｜Contact Us
닫기
Search
Advanced Search +
닫기
Quick links
Most Cited Most Read Archives Go to e-Submission

Research Article

Split Viewer

J Plant Biotechnol (2024) 51:143-151

Published online May 29, 2024

https://doi.org/10.5010/JPB.2024.51.015.143

© The Korean Society of Plant Biotechnology

Solanum jamesii의 엽록체 전장 유전체 분석 및 이를 활용한 S. jamesii 특이적 PCR기반의 분자마커 개발

조주련･박태호

대구대학교 원예학과

Received: 18 April 2024; Revised: 20 May 2024; Accepted: 20 May 2024; Published: 29 May 2024.

Complete chloroplast genome of Solanum jamesii and development of PCR-based markers to discriminate between S. jamesii and other Solanum species

Ju-Ryeon Jo ･Tae-Ho Park

Author Info. +

Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea

Correspondence to : e-mail: thzoo@daegu.ac.kr

Received: 18 April 2024; Revised: 20 May 2024; Accepted: 20 May 2024; Published: 29 May 2024.

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Go to

Solanum jamesii is a wild Solanum species with a native range from northwestern Mexico to southwestern United States. It is a resource for potato breeding due to its resistance to late blight. However, S. jamesii is diploid and has an endosperm balanced number (EBN) of one, which hampers the sexual hybridization between S. jamesii and cultivated potatoes. To overcome this problem, somatic fusion can be performed. After fusion, molecular markers are necessary to select fusion products efficiently. In this study, therefore, the chloroplast genome of S. jamesii was sequenced using next-generation sequencing (NGS) technology and was compared with those of eight other Solanaceae species to develop specific markers for S. jamesii. The total length of the chloroplast genome sequence of S. jamesii is 155,576 bp. The structural organization of the chloroplast genome is almost identical to those of other Solanum species. Phylogenetic analysis with 17 other Solanaceae species showed that S. jamesii is most closely related to S. cardiophyllum. Detailed analysis of the chloroplast genome sequence of nine Solanum species identified two S. jamesii-specific InDels and 11 S. jamesii-specific SNPs. Based on these results, six S. jamesii-specific PCR-based markers were developed. The results of this study can be used to identify S. jamesii from other Solanum species and will contribute to the development of new potato varieties using S. jamesii.

Keywords cpDNA, PCR-based marker, Potato, SNPs, Solanum jamesii

서 론

Go to

재배되고 있는 감자(Solanum tuberosum L.)의 야생종 중 하나인 S. jamesii는 멕시코의 북서부부터 미국의 남서부 지역까지 자생하며, 재배종 감자와 같이 괴경을 형성하는 반면 배수성이 2배체로 재배종 감자의 4배체와는 차이가 있다(Hanneman 1994; Hawkes 1990). S. jamesii는 풋마름병, 더뎅이병, 감자역병, 콜로라도감자잎벌레, 뿌리혹선충, 감자바이러스X, Y (PVX, PVY)와 함께 건조한 환경에도 강한 것으로 알려져 있어 신품종 감자를 육성하는데 중요한 재료로 활용될 수 있다(Bamberg et al. 2021; Kim-Lee et al. 2005; Kozlov et al. 2007; Machida-Hirano 2015; Srivastava et al. 2016; Watanabe et al. 2011). 저항성과 같은 유용 형질을 재배종 감자에 도입하여 감자 신품종을 육성하기 위해서는 전통적인 교배육종 방법을 이용할 수 있으나 S. jamesii의 EBN (Endosperm Balanced Number)은 1로 EBN이 4인 재배종 감자와의 차이가 있어 교배육종이 불가능하다(Cho et al. 1997; Hawkes 1990; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014). 이러한 생리적 교잡 불화합성을 극복하기 위해서는 형질전환에 의한 유전자

도입(genetic modification, GM), 순차적 교배(bridge crosses), 체세포잡종(somatic hybridization) 등이 제시되고 있다(Cho and Park 2014). S. jamesii를 이용한 감자 신품종 육성을 위해 순차적 교배 방법이 시도된 바 있으나(Bamberg et al. 2021), S. jamesii와 S. tuberosum을 체세포융합 방법을 이용하여 체세포잡종 계통을 육성하고자 하는 시도는 아직 이루어진 바가 없어 연구가 진행중에 있으며, 향후 체세포잡종 계통을 확보하였을 때, 체세포잡종 계통에서의 엽록체 DNA의 구성을 확인하기 위한 목적으로 S. jamesii 전체 엽록체 유전체의 염기서열 정보를 구명하고 이를 이용하여 S. jamesii 특이적인 분자마커를 개발하였다.

속씨식물의 엽록체 유전체는 일반적으로 4분할의 원형 이중가닥 분자구조로 한 쌍의 inverted repeats (IRs) 영역과 각각 하나의 small single copy (SSC) 및 large single copy (LSC) 영역으로 구성되어 있다(Yurina and Odintosova 1998). 앞서 보고된 바와 같이 재배종 감자와 근연야생종의 엽록체 전체 염기서열과 그 구조는 서로 매우 유사하였다(Palmer 1991; Raubeson and Jansen 2005; Saski et al. 2005; Sugiura et al. 1998)(Table 1). 이러한 유사성에도 불구하고, 이들 엽록체 유전체에서는 유전자 역위나 재배열 등과 같은 구조적 변화에 의한 변이가 발생하여 엽록체 유전체 전체를 비교하면 식물체 종 특이적인 InDel이나 SNP를 발견할 수 있다(Calsa Junior et al. 2004; Cho et al. 2015; Jheng et al. 2012; Kim et al. 2005, 2018; Kim and Park 2019, 2020a, 2020b; Park 2021, 2022a, 2022b, 2023a, 2023b; Saski et al. 2005). 따라서, 본 연구에서는 S. jamesii의 엽록체 전장유전체를 구명하여 이에 대한 정보를 제공하고, 전장유전체의 염기서열 정보를 이용하여 개발한 PCR기반의 S. jamesii 특이적 분자마커에 대한 결과를 제공하고자 한다.

Table 1 . Results of comparative analysis of the chloroplast genome sequence of S. jamesii with those of 14 Solanaceae species

SpeciesAccession no.Total length (bp)GC content (%)Total no. of genesNo. of tRNAsNo. of rRNAsReference
S. jamesiiMK690624155,57637.90134364This study
S. hjertingiiMK690623155,54537.88134364Park (2023a)
S. cardiophyllumMK690622155,57037.90134364Park (2023b)
S. acauleMK036506155,57037.84135364Park (2022b)
S. brevicauleMK036507155,53137.87135364Park (2022a)
S. demissumMK036508155,55837.87135364Park (2021)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*The data have been partially adopted from Park (2023b).

재료 및 방법

Go to

식물재료 및 DNA 분리

S. jamesii (PI578326) 엽록체의 전장유전체 분석에는 S. jamesii 계통 중 하나인 SJ-8이 이용되었으며, S. jamesii 특이적 분자마커 개발을 위해 S. jamesii의 SJ-6과 SJ-11 계통이 추가되었다. 이외에 3개의 재배종 감자 품종과 12종의 가지속(Solanum) 이용되었으며, 자체적으로 대구에서 수집한 S. nigrum (SN)을 제외한 모든 식물재료는 국립식량과학원 고령지농업연구소에서 분양 받아 기내식물체로 유지 및 증식하여 이용하였다. 실험에 이용된 재배종 감자의 품종은 ‘대지’(DJ), 대서’(DS), ‘수미’(SM)이고, S. nigrum 이외 11개의 야생종 계통은 S. acaule (PI310970, SA), S. brevicaule (PI205394, SB2), S. hougasii (PI161174, SH2), S. cardiophyllum (PI341233, SC1), S. commersonii (PI558050, SC2), S. hjertingii (PI186559, SH1), S. stoloniferum (PI160224, SS), S. kurtzianum (PI578236, SK), S. mochiquense (PI338616, SM1), S. verrucosum (PI160228, SV1), S. vernei (PI230468, SV2)이다.

DNA 분리는 Genomic DNA Extraction kit (Plants)(RBC, New Taipei City, Taiwan)를 이용하여 모든 식물체를 대상으로 계대배양 한 후 약 3주 이내 유식물체의 약 100 mg을 채취하여 진행하였다.

S. jamesii 엽록체 전장유전체의 구명 및 분석

S. jamesii의 엽록체 전장유전체 분석은 S. jamesii 계통 SJ-8을 대상으로 진행하였다. 전체 염기서열 정보(raw data)는 Macrogen (Macrogen, Seoul, South Korea)의 MiSeq (Illumina, SanDiego, CA, USA) 플랫폼을 통해 확보하였으며, 염기서열의 분석과 조립은 파이젠(http://phyzen.com)에서 제공하는 de novo assembly가 이용되었다(Cho et al. 2015). 그 과정에서 전처리(trimming), high-quality 염기서열 추출(Phred score 20 이상), dnaLCW 방법으로 조립 등은 CLC quality trim, CLC de novo assemble 등의 프로그램이 이용되었으며, 이들 프로그램은 CLC genome assembler package version 4.2.1 (CLC Inc, Rarhus, Denmark)에서 제공된 것이다. 이후 조립된 염기서열 중, 엽록체 유전체 유래의 contig를 선발하고, gap-filling에 의한 확장과 통합을 통해 엽록체 유전체를 완성하였다. 전처리된 염기서열 전체를 완성된 엽록체 전장 유전체 서열에 mapping하여 각각의 영역별 read depth를 계산하였고, reference 종과 유전체의 구조 및 염기서열을 비교하였다. 또한, 엽록체 전장 유전체 서열을 이용하여 BLASTN을 수행하였으며, homology가 높은 종의 엽록체 전장 유전체 서열을 확인하고 BLASTZ (Schwartz et al. 2003) 분석을 실시하였다.

완성된 S. jamesii 엽록체 전장 유전체의 유전자는 Geseq 프로그램을 통해 확인하고, BLAST search를 기반으로 한 manual curation을 통해 최종적으로 유전자와 유전자의 위치를 결정하였다(Tillich et al. 2017). 이들은 OGDraw 프로그램을 통해 원형의 유전자지도 상에 표시되었다(Lohse et al. 2007).

엽록체 유전체의 비교와 분자마커 개발

S. jamesii와 유사종들과의 유전관계 분석을 위해 NCBI (National Center for Biotechnology Information)에 등록되어 있는 재배종 감자 S. tuberosum (NC008096 및 KM489056), 가지과의 까마중 S. nigrum (KM489055), 고추 Capsicum annuum (JX270811), 토마토 S. lycopersicum (NC007898), 감자의 근연야생종 12종 S. acaule (MK036506), S. brevicaule (MK036507), S. berthaultii (KY419708), S. bulbocastanum (DQ347958), S. demissum (MK036508), S. cardiophyllum (MK690622), S. stoloniferum (MF471373), S. chacoense (MF471371), S. commersonii (KM489054), S. hjertingii (MK690623), S. hougasii (MF471372), S. verrucosum (MK690625) 등 총 18개의 엽록체 전체 염기서열을 확보하여, 여기에 존재하는 단백질 코딩 서열을 MEGA11 프로그램을 이용하여 분석하였으며, 이 프로그램은 1,000번의 Bootstrap 옵션이 적용되었고 GTR (General Time Reversible)모델 기반의 Maximum Likelihood 방법이 이용되었다(Tamura et al. 2021).

분자마커의 개발은 S. jamesii의 엽록체 전체 염기서열과 NCBI로부터 얻은 S. verrucosum (MK690625), S. cardiophyllum (MK690622), S. bulbocastanum (DQ347958), S. berthaultii (KY419708), S. hjertingii (MK690623), S. tuberosum (KM489056), S. commersonii (KM489054), S. hougasii (MF471372)의 엽록체 전체 염기서열을 ClustalW2 (EMBL: http://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 다중정렬 하였고, 이를 통해 S. jamesii에 특이적으로 나타나는 InDel과 SNP를 확보할 수 있었다. InDel의 경우 InDel이 있는 영역에 primer를 제작하여 allele 특이적 분자마커를 개발하고자 하였으며, SNP의 경우 tetra-primer ARMS (Amplification Refractory Mutation System)-PCR 기술을 이용하여 primer를 제작하였다(Collins and Ke 2012; Ye et al. 2001). S. jamesii와 S. tuberosum을 포함한 총 18개의 계통, S. jamesii (SJ6, SJ8 및 SJ11), S. tuberosum (감자품종 ‘대지’(DJ), ‘수미’(SM), ‘대서’(DS)), S. acaule (SA), S. cardiophyllum (SC1), S. brevicaule (SB2), S. commersonii (SC2), S. hjertingii (SH1), S. hougasii (SH2), S. mochiquense (SM1), S. kurtzianum (SK), S. nigrum (SN), S. stoloniferum (SS), S. verrucosum (SV1), S. vernei (SV2)를 대상으로 PCR을 수행하였다. InDel 기반의 분자마커 개발은 위한 PCR의 경우, 총 20 ul (약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로, SNP 기반의 분자마커 개발을 위한 PCR의 경우, 총 20 ul (약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each inner primer, 1 pMol each outer primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany)을 이용하였다. PCR의 결과는 핵산 염색용액인 StaySafe (RBC, New Taipei City, Taiwan)를 이용하여 1.5% agarose gel에서 확인하였다.

결과 및 고찰

Go to

S. jamesii의 엽록체 유전체

S. jamesii의 엽록체 전체 염기서열은 NGS 기술을 이용하여 완성되었다. NGS 기반으로 얻은 데이터는 평균 301.0 bp 길이의 총 염기서열 약 1.5 Gbp로, 이는 5,267,110 read를 통해 생산되었다. 이중 약 90.79%를 이용하여 전처리 및 Phred score 20 이상의 데이터 추출과정을 거쳐 high-quality 총 염기서열 정보 약 1.3 Gbp를 얻었으며, 평균 길이는 283.6 bp로 확인되었다. 이는 전체 raw data의 약 85.55%였으며, S. cardiophyllum 의 전체 엽록체 염기서열과 비교했을 때 사용된 총 염기서열이 약 0.3 Gbp 적었지만, 총 생산된 데이터 대비 추출 염기서열의 비율은 비슷한 수준이었다(Park 2023a, 2023b). 또한, de novo assembly와 엽록체 유래의 contig를 선발하고, gap-filling 과정을 통한 확장과 통합 등을 거쳐 총 염기서열은 155,576 bp의 S. jamesii 엽록체 전장 유전체가 완성되다. 최종적으로 aligned read의 개수는 435,578개, 전체 유전체에 대한 평균 coverage는 약 789.54x, 전체 trimmed read를 완성된 전체 유전체 서열에 mapping한 결과로 나타난 read depth는 최소 378 이상이었다. 구조적으로는 원형 이중가닥 분자 구조로 다른 식물의 엽록체 유전체와 동일한 형태였으며, 한 쌍의 25,596 bp의 IRa/IRb, 18,394 bp의 SSC, 85,990 bp의 LSC 영역으로 구성되어 있었다. S. bulbocastanum의 엽록체 전체 염기서열(DQ347958)과의 비교와 BLASTZ 분석의 결과로도 그 유사성을 확인할 수 있었다(Daniell et al. 2006; Schwartz et al. 2003) (Fig. 1). S. jamesii의 엽록체 전체 염기서열을 대상으로 NCBI의 BLASTN 분석 결과 S. pinnatisectum (MZ233590), S. cardiophyllum (MK690622)과 99.95%의 높은 염기서열 일치도를 보였으며, GC 비율 또한 37.90%로 매우 유사하였다(Table 1).

Fig. 1. Assembly of the complete chloroplast genome sequence of S. jamesii. The four representative contigs for the chloroplast genome of S. jamesii and comparison with the corresponding regions of the S. bulbocastanum chloroplast genome (DQ347958) are combined. Blue and yellow bars indicate contigs matching the reference sequence in forward and reverse orientation, respectively

S. jamesii의 엽록체 전장 유전체에는 105개의 단백질 코딩, 45개의 tRNA, 8개의 rRNA를 포함는 총 158개의 유전자가 존재하고 있는데, 이중 11개의 단백질 코딩 유전자, 9개의 tRNA, 4개의 rRNA가 한 쌍의 Ira 및 IRb 영역에 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 코딩 영역의 비율은 59.2%로 나타났으며, 158개 유전자의 평균 길이는 약 583.4 bp, 이중 각각의 평균은 단백질 코딩 유전자가 764.8 bp, tRNA가 62.4 bp, rRNA가 1,131.0 bp의 크기로 각각 51.6%, 1.8%, 5.8%의 비율로 분포되어 있으며, 이러한 결과는 다른 Solanum 종들과 매우 유사한 수준이었다(Table 1).

Fig. 2. Gene map of the S. jamesii chloroplast genome. Genes on the outside of the map are transcribed in the clockwise direction and genes on the inside of the map are transcribed in the counterclockwise direction

엽록체의 계통수 작성과 전장유전체 비교

S. jamesii의 계통수 작성은 총 17종 가지과의 엽록체 전장 유전체 코딩 서열을 기반으로 실행되었다(Fig. 3). 그 결과, S. jamesii는 S. tuberosum 뿐만 아니라 다수의 가지속(Solanum) 종들과 같은 그룹에 존재함을 확인하였으며, 유연관계가 그중 S. cardiophyllum과 가장 가까웠으며, 상대적으로 까마중(S. nigrum), 고추(C. annuum), 토마토(S. lycopersicum)와는 다소 먼 것으로 확인되었다.

Fig. 3. Maximum-likelihood phylogenetic tree of S. jamesii with 17 Solanaceae family members based on chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. The data are partially adopted from Park (2023a)

S. jamesii 엽록체의 전체 염기서열을 7종의 근연야생종과 재배종 감자의 엽록체 전체 염기서열과 ClustalW2 (EMBL; https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 다중 정렬한 결과 S. jamesii 특이적인 2개의 InDel과 11개의 SNP를 구명하였다(Fig. 4). 상대적으로 S. jamesii 특이적 InDel과 SNP의 수가 매우 적은 편이었는데, 이는 다중 정렬에 S. jamesii의 엽록체 전체 염기서열과 유사도가 매우 높은 S. cardiophyllum이 포함되어 나타난 결과로 보인다. 하지민, 다양한 유전적 요인에 의한 변이 발생으로 인해 S. jamesii 특이적인 InDel과 SNP가 존재하며, 이를 이용하여 S. jamesii 특이적 분자마커를 개발할 수 있었다(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021, 2022a, 2022b, 2023a, 2023b). 2개의 InDel은 각각 유전자 간 및 내 영역에 존재하고 있었으며, 11개의 SNP 중 8개는 유전자 간 영역에 3개는 유전자 내 영역에 위치하고 있었다.

Fig. 4. Multiple alignment of the sequences from the intergenic or intragenic regions containing InDels and SNPs used to develop the PCR-based markers. The chloroplast genome sequences of S. cardiophyllum (SC1-9: MK690622), S. jamesii (SJ8: MK690624), S. bulbocastanum (Sblb: DQ347958), S. berthaultii (Sber: KY419708), S. tuberosum (Stub: KM489056), S. verrucosum (SV1-4: MK690625), S. hougasii (SH2-10: MF471372), S. hjertingii (SH1-16: MK690623), and S. commersonii (Scmr: KM489054) were used and are listed from top to bottom in each region of the InDels and SNPs. The InDel and SNP regions detected from S. jamesii are bold, highlighted and underlined

S. jamesii 특이적 분자마커 개발

S. jamesii를 포함한 총 9개 Solanum 종의 엽록체 전체 염기서열의 다중 정렬 결과로 확인된 S. jamesii 특이적 InDel과 SNP는 S. jamesii 특이적인 분자마커 개발에 활용되었다. InDel은 InDel 영역에서 특이적인 primer를 제작하여 PCR을 통해 다양성의 차이가 나타나는 S. jamesii 특이적 또는 비특이적인 3개의 SCAR (Sequence Characterized Amplified Region) 마커를 개발할 수 있었다(Cho et al. 2015; Garcia-Lor et al. 2013; Yamaki et al. 2013)(Table 2, Fig. 5A, 5B, 5C). SNP는 11개 중 3개의 영역을 대상으로 S. jamesii 특이적 SNP 위치를 기준으로 SNP가 포함된 DNA 단편과 SNP 위치을 대상으로 S. jamesii 특이적이거나 혹은 S. jamesii를 제외한 Solanum 종들에 특이적으로 DNA를 증폭할 수 있는 tetra-primer ARMS-PCR 방법을 적용하여 primer를 제작하였다(Collins and Ke 2012; Ye et al. 2001)(Table 2). 이러한 방법은 PCR로 염기서열이 매우 유사한 SNP를 대상으로 primer의 제작이 어려운 종 또는 SNP가 존재하는 계통 간의 차이를 비교적 손쉽게 확인할 수 있다는 장점이 있어 널리 활용되고 있으며, 본 연구에서도 Solanum 종간의 비교 결과로 나타난 SNP를 활용한 PCR 기반의 S. jamesii 특이적이거나 (Fig. 5D, 5E, 5F) 혹은 비특이적으로(Fig. 5D, 5E, 5F) 나타나는 3개의 분자마커를 개발하였다(Han et al. 2016; Kou et al. 2017; Mahmoudi et al. 2019; Zou et al. 2018). 최종적으로 본 연구에서는 InDel과 SNP 정보를 기반으로 한 S. jamesii 특이적 분자마커가 각각 3개씩 개발되었다. SJ8_InDel1 (Fig. 4, Fig. 5A, 5B)과 SJ8_InDel2 (Fig. 4, Fig. 5C)은 각각 trnL 유전자 내 및 petA와 psbJ 유전자 사이에 존재하는 SCAR 마커로 개발되었으며, SJ8_SNP1 (Fig. 4, Fig. 5D), SJ8_SNP3 (Fig. 4, Fig. 5E)과 SJ8_SNP5 (Fig. 4, Fig. 5F)는 각각 atpF 유전자 내, atpH와 atpI 유전자 사이 및 psaA 유전자 내에 존재하는 SNP 기반의 마커로 개발되었다.

Fig. 5. PCR-based markers for the discrimination of S. jamesii from other Solanum species. A: SJ8_InDel1(a). B: SJ8_InDel1(b). C: SJ8_InDel2. D: SJ8_SNP1. E: SJ8_SNP3. F: SJ8_SNP5. The markers SJ8_InDel1(a) and SJ8_InDel2 are positively specific to S. jamesii. The marker SJ8_InDel1(b) is negatively specific to S. jamesii. The markers SJ8_SNP1, SJ8_SNP3 and SJ8_SNP5 are both positively and negatively specific to S. jamesii. SJ6, SJ8 and SJ11 indicate three different lines of S. jamesii (PI578326). M, DS, DJ, SM, SA, SB2, SC1, SC2, SH1, SH2, SK, SM1, SN, SS, SV1 and SV2 indicate a size marker ladder, potato varieties ‘Daeseo’, ‘Daeji’, ‘Sumi’, S. acaule (PI310970), S. brevicaule (PI205394), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. hjertingii (PI186559), S. hougasii (PI161174), S. kurtzianum (PI578236), S. mochiquense (PI338616), a line of S. nigrum selected in Daegu, South Korea, S. stoloniferum (PI160224), S. verrucosum (PI160228) and S. vernei (PI230468), respectively. Red and yellow arrows indicate positive and negative bands on S. jamesii, respectively

Table 2 . Information of primers used to generate S. jamesii-specific and non-specific markers

InDel/SNPStrandPrimer sequence (5’ → 3’)Tm (°C)Size
SJ8_InDel1(a)Forward primerAAACGTATATACATACTATATC56°C735 bp (delete sequence 11bp specific to S. jamesii)
Reverse primerTTTCAGTCCTCTGCTCTAC
SJ8_InDel1(b)Forward primerAAACGTATATACATACGTATTG58°C746 bp (delete sequence 11bp non-specific to S. jamesii)
Reverse primerTTTCAGTCCTCTGCTCTAC
SJ8_InDel2Forward primerAGTATAGAAAGGATTAGATTAG60°C777 bp (insert sequence ‘ATTAGATTAGTATAGAAAGG’ specific to S. jamesii)
Reverse primerTATCAGCAATGCAGTTCATC
SJ8_SNP1Forward inner primerCCTATCTTCTCTTCTTTGTTCATATTTCC60°C396 bp (from two outer primers), 217 bp (C allele specific to S. jamesii), 238 bp (A allele non-specific to S. jamesii)
Reverse inner primerTTGGTCTTACATTAGTTTCGATATCTTCTT
Forward outer primerTCAAGATCCTCTGTTTTCGATTATCTAA
Reverse outer primerGTAAATTGTAAAAACAGGGATTTTACCC
SJ8_SNP3Forward inner primerAATTCTCTTGAGCCACCCACCATATGCC56°C300 bp (from two outer primers), 178 bp (C allele specific to S. jamesii), 210 bp (A allele non-specific to S. jamesii)
Reverse inner primerTTTTAGCTTAGCCCACAGCAATGTATAGAT
Forward outer primerTGAAGGAAAGGGGAATTTTAGGAAAAAGAT
Reverse outer primerGTTCCTATACCTGTCATGCTCCTTGGATT
SJ8_SNP5Forward inner primerCTGAATAGAAACATTAAACTAAAAGCCTAG58°C390 bp (from two outer primers), 243 bp (T allele specific to S. jamesii), 204 bp (G allele non-specific to S. jamesii)
Reverse inner primerCTTTTTTTCCTAGGTGCTCATTTTATA
Forward outer primerTACTGCAATAATTCTTGCTAAGAAGAAT
Reverse outer primerGTAAGTGATCAAGGGGTAGTAACTCATA

감자의 신품종 육성을 위해 다양한 유용한 특성을 지니고 있는 근연야생종을 이용한 연구가 계속해서 수행되고 있으나, 교배육종을 통한 유용 형질의 도입은 다수의 근연야생종이 재배종 감자와의 EBN과 배수성 차이로 인해 어려움을 겪기 때문에, 체세포융합을 이용한 체세포잡종의 육성이 활용되고 있으며, 이에 따라 유전자형 확인이 필수적이다. 분자마커를 통한 유전자형의 확인은 단순히 염색체 조합만을 확인하는 것이 아니라 엽록체 및 미토콘드리아 유전체의 전달 확인도 필요하다. 특히 Solanum 속에 속하는 다양한 식물종의 경우, 체세포융합이나 재분화 과정에서 핵 내 및 미토콘드리아 유전체는 재조합 빈도가 높다는 것이 알려져 있으며, 엽록체 유전체의 경우에는 한 쪽 친의 엽록체 유전체가 무작위적으로 전달되는 것 외에도 양친의 유전체가 모두 전달되는 경우도 있었다(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Wang et al. 2011; Xiang et al. 2004). 이에 따라, 본 연구에서 개발된 분자마커는 체세포융합을 통한 체세포잡종의 육성 과정에서 특히 S. jamesii와 S. tuberosum 유래의 엽록체 유전체의 유전자형 구별에 이용이 될 것이며, 이러한 분자마커는 감자 육성 과정에서 신품종의 개발 및 진화학적 연구에 기여할 수 있을 것이다.

적 요

Go to

멕시코 북서부부터 미국 남서부까지 자생하는 감자 야생종 중 하나인 Solanum jamesii는 Phytophthora infestans에 대한 저항성으로 감자 육종에 훌륭한 재료이다. 그러나 S. jamesii는 이배체이며 EBN 값이 1로, 이는 S. jamesii와 재배용 감자 간 교배가 불가능하다. 이 문제를 극복하기 위해 체세포융합을 이용할 수 있다. 이후에는 분자마커를 사용하여 효율적으로 융합체를 선발하는 것이 필수적이다. 본 연구에서는 차세대 유전체 기술을 사용하여 S. jamesii의 엽록체 전장 유전체 서열을 확보하고, 이를 다른 8개의 가지과에 속한 종과 비교하여 S. jamesii 특이적 마커를 개발하였다. S. jamesii의 엽록체 유전체의 총 서열 길이는 155,576 bp이며, 그 구조는 다른 Solanum 종과 유사하다. 17개의 다른 Solanaceae 종과의 계통수 분석 결과, S. jamesii는 S. cardiophyllum과 가장 밀접한 유연관계를 가졌다. 8개의 다른 Solanum 종의 엽록체 전장 유전체 서열 비교에서 S. jamesii에 특이한 2개의 InDel 및 11개의 SNP가 확인되었다. 이러한 InDel 및 SNP를 기반으로 S. jamesii를 다른 Solanum 종과 구별하는 6개의 PCR 기반 분자마커가 개발되었다. 본 연구의 결과는 Solanum 종 중에서 S. Jamesii를 구별하고 S. Jamesii를 활용한 감자 신품종 개발에 기여할 것이다.

REFERENCES

Go to
  1. Bamberg J, Kielar A, del Rio A, Douches D (2021) Making hybrids with the wild potato Solanum jamesii. Am J Potato Res 98:187-193
    CrossRef
  2. Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46:366-373
    Pubmed CrossRef
  3. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
    Pubmed CrossRef
  4. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29:154-161
  5. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
    Pubmed CrossRef
  6. Cho KS, Park TH (2014) Potato breeding via protoplast fusion. J Plant Biotechnol 41:65-72
    CrossRef
  7. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57:69-78
    CrossRef
  8. Cho KS, Yun BK, Yoon YH, Hong SY, Mekapogu M, Kim KH, Yang TJ (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
    Pubmed KoreaMed CrossRef
  9. Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25:1369-1379
    Pubmed CrossRef
  10. Collins A, Ke X (2012) Primer1: Primer design web service for tetra-primer ARMS-PCR. Open Bioinformatics J 6:55-58
    CrossRef
  11. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112:1503-1518
    Pubmed CrossRef
  12. Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111:1-19
    Pubmed KoreaMed CrossRef
  13. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop 107
  14. Han E-H, Cho K-M, Goo Y-M, Kim M-B, Shin Y-W, Kim Y-H, Lee S-W (2016) Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species, Cynanchum wilfordii, Cynanchum auriculatum, and Polygonum multiflorum. Mol Biol Rep 43:323-332
    Pubmed CrossRef
  15. Hanneman RE (1994) The testing and release of transgenic potatoes in the North American Center of diversity. AF Krattiger, A Rosemarin, (Eds.). biosafety for sustainable agriculture: sharing biotechnology regulatory experience of the western hemisphere. ISAAA: Ithaca and SEI. Stockholm 47-67
  16. Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. London, UK, Belhaven Press
    CrossRef
  17. Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C (2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids. Plant Sci 190:62-73
    Pubmed CrossRef
  18. Kim KJ, Choi KS, Jansen RK (2005) Two chloroplast DNA inversion originated simultaneously during the early evolution of the sunflower family (Asteraceae). Mol Biol Evol 22:1783-1792
    Pubmed CrossRef
  19. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
    CrossRef
  20. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46:79-87
    CrossRef
  21. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140
    CrossRef
  22. Kim S, Park T-H (2020b) Development of Solanum hougasii-specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47:141-149
    CrossRef
  23. Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM (2005) Bacterial wilt resistance in the progenies of the fusion hybrids between haploid of potato and Solanum commersonii. Amer J Potato Res 82:129-137
    CrossRef
  24. Kou M, Xu J-I, Li Q, Liu Y-J, Wang X, Tang W, Yan H, Zhang Y-G, Ma D-F (2017) Development of SNP markers using RNA-seq technology and tetra-primer ARMS-PCR in sweetpotato. J Integr Agric 16:464-470
    CrossRef
  25. Kozlov VA, Chashinskij AV, Rusetskij NV, Zhuromskij GK, Rajko AM (2007) Wild species of potato as sources of resistance to pathogens. Zashchita Rastenij (Belarus) 31:191-203
  26. Lohse M, Drechsel O, Bock R (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52:267-274
    Pubmed CrossRef
  27. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116:221-230
    CrossRef
  28. Machida-Hirano R (2015) Diversity of potato genetic resources. Breed Sci 65:26-40
    Pubmed KoreaMed CrossRef
  29. Mahmoudi S, Badali H, Rezaie S, Azarnezhad A, Barac A, Kord M, Ahmadikia K, Aala F, Askari FA, Meis JF, Khodavaisy S (2019) A simple and low cost tetra-primer ARMS-PCR method for detection triazole-resistant Aspergillus fumigatus. Mol Biol Rep 46:4537-4543
    Pubmed CrossRef
  30. Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17:814-818
    Pubmed CrossRef
  31. Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60:105-113
    CrossRef
  32. Palmer JD (1991) Plastid chromosomes: structure and evolution. L. Bogorad, K. Vasil, (Eds.). The molecular biology of plastids. Academic Press. San Diego, USA 5-53
    KoreaMed CrossRef
  33. Park T-H (2021) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48:18-25
    CrossRef
  34. Park T-H (2022a) Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 49:30-38
    CrossRef
  35. Park T-H (2022b) PCR-based markers to select plastid genotypes of Solanum acaule. J Plant Biotechnol 49:178-186
    CrossRef
  36. Park T-H (2023a) Development of PCR-based markers for selecting plastid genotypes of Solanum hjertingii. J Plant Biotechnol 50:34-44
    CrossRef
  37. Park T-H (2023b) Chloroplast genome sequence and PCR-based markers for S. cardiophyllum. J Plant Biotechnol 50:45-55
    CrossRef
  38. Raubeson LA, Jansen RK (2005) Chloroplast genomes of plants. H. Henry, (Ed.). Diversity and evolution of plants: Genotypic and phenotypic variation in higher plants. CABI Publishing. Wallingford, UK 45-68
    CrossRef
  39. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59:309-322
    Pubmed CrossRef
  40. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
    Pubmed KoreaMed CrossRef
  41. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35:1345-1358
    Pubmed KoreaMed CrossRef
  42. Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot Rev 80:283-383
    CrossRef
  43. Srivastava A, Bhardwaj V, Singh BP, Khurana SMP (2016) Potato diversity and its genetic enhancement. V. Rajpal, S. Rao, S. Raina, (Eds.). Gene pool diversity and crop improvement. Sustainable development and biodiversity, vol 10. Springer. Cham 187-226
    CrossRef
  44. Sugiura M, Hirose T, Sugita M (1998) Evolution and mechanism of translation in chloroplast. Annu Rev Genet 32:437-459
    Pubmed CrossRef
  45. Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022-3027
    Pubmed KoreaMed CrossRef
  46. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S. (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45:W6-W11
    Pubmed KoreaMed CrossRef
  47. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30:1811-1821
    Pubmed CrossRef
  48. Watanabe KN, Kikuchi A, Shimazaki T, Asahina M (2011) Salt and drought stress tolerances in transgenic potatoes and wild species. Potato Res 54:319-324
    CrossRef
  49. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688
    Pubmed CrossRef
  50. Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T, Kubo T, Kurata N, Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63:246-254
    Pubmed KoreaMed CrossRef
  51. Ye S, Dhillon S, Ke X, Collins AR, Day INM (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res 29:e88
    Pubmed KoreaMed CrossRef
  52. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34:5-22
  53. Zou Z, Liu F, Fernando WGD (2018) Rapid detection of Leptosphaeria maculans avirulence gene AvrLm4-7 conferring the avirulence/virulence specificity on Brassica napus using a tetra-primer ARMS-PCR. Eur J Plant Pathol 152:515-520
    CrossRef

Article

Research Article

J Plant Biotechnol 2024; 51(1): 143-151

Published online May 29, 2024 https://doi.org/10.5010/JPB.2024.51.015.143

Copyright © The Korean Society of Plant Biotechnology.

Solanum jamesii의 엽록체 전장 유전체 분석 및 이를 활용한 S. jamesii 특이적 PCR기반의 분자마커 개발

조주련･박태호

대구대학교 원예학과

Received: 18 April 2024; Revised: 20 May 2024; Accepted: 20 May 2024; Published: 29 May 2024.

Complete chloroplast genome of Solanum jamesii and development of PCR-based markers to discriminate between S. jamesii and other Solanum species

Ju-Ryeon Jo ･Tae-Ho Park

Department of Horticulture, Daegu University, Gyeongsan 38453, South Korea

Correspondence to:e-mail: thzoo@daegu.ac.kr

Received: 18 April 2024; Revised: 20 May 2024; Accepted: 20 May 2024; Published: 29 May 2024.

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Solanum jamesii is a wild Solanum species with a native range from northwestern Mexico to southwestern United States. It is a resource for potato breeding due to its resistance to late blight. However, S. jamesii is diploid and has an endosperm balanced number (EBN) of one, which hampers the sexual hybridization between S. jamesii and cultivated potatoes. To overcome this problem, somatic fusion can be performed. After fusion, molecular markers are necessary to select fusion products efficiently. In this study, therefore, the chloroplast genome of S. jamesii was sequenced using next-generation sequencing (NGS) technology and was compared with those of eight other Solanaceae species to develop specific markers for S. jamesii. The total length of the chloroplast genome sequence of S. jamesii is 155,576 bp. The structural organization of the chloroplast genome is almost identical to those of other Solanum species. Phylogenetic analysis with 17 other Solanaceae species showed that S. jamesii is most closely related to S. cardiophyllum. Detailed analysis of the chloroplast genome sequence of nine Solanum species identified two S. jamesii-specific InDels and 11 S. jamesii-specific SNPs. Based on these results, six S. jamesii-specific PCR-based markers were developed. The results of this study can be used to identify S. jamesii from other Solanum species and will contribute to the development of new potato varieties using S. jamesii.

Keywords: cpDNA, PCR-based marker, Potato, SNPs, Solanum jamesii

서 론

재배되고 있는 감자(Solanum tuberosum L.)의 야생종 중 하나인 S. jamesii는 멕시코의 북서부부터 미국의 남서부 지역까지 자생하며, 재배종 감자와 같이 괴경을 형성하는 반면 배수성이 2배체로 재배종 감자의 4배체와는 차이가 있다(Hanneman 1994; Hawkes 1990). S. jamesii는 풋마름병, 더뎅이병, 감자역병, 콜로라도감자잎벌레, 뿌리혹선충, 감자바이러스X, Y (PVX, PVY)와 함께 건조한 환경에도 강한 것으로 알려져 있어 신품종 감자를 육성하는데 중요한 재료로 활용될 수 있다(Bamberg et al. 2021; Kim-Lee et al. 2005; Kozlov et al. 2007; Machida-Hirano 2015; Srivastava et al. 2016; Watanabe et al. 2011). 저항성과 같은 유용 형질을 재배종 감자에 도입하여 감자 신품종을 육성하기 위해서는 전통적인 교배육종 방법을 이용할 수 있으나 S. jamesii의 EBN (Endosperm Balanced Number)은 1로 EBN이 4인 재배종 감자와의 차이가 있어 교배육종이 불가능하다(Cho et al. 1997; Hawkes 1990; Ortiz and Ehlenfeldt 1992; Spooner et al. 2014). 이러한 생리적 교잡 불화합성을 극복하기 위해서는 형질전환에 의한 유전자

도입(genetic modification, GM), 순차적 교배(bridge crosses), 체세포잡종(somatic hybridization) 등이 제시되고 있다(Cho and Park 2014). S. jamesii를 이용한 감자 신품종 육성을 위해 순차적 교배 방법이 시도된 바 있으나(Bamberg et al. 2021), S. jamesii와 S. tuberosum을 체세포융합 방법을 이용하여 체세포잡종 계통을 육성하고자 하는 시도는 아직 이루어진 바가 없어 연구가 진행중에 있으며, 향후 체세포잡종 계통을 확보하였을 때, 체세포잡종 계통에서의 엽록체 DNA의 구성을 확인하기 위한 목적으로 S. jamesii 전체 엽록체 유전체의 염기서열 정보를 구명하고 이를 이용하여 S. jamesii 특이적인 분자마커를 개발하였다.

속씨식물의 엽록체 유전체는 일반적으로 4분할의 원형 이중가닥 분자구조로 한 쌍의 inverted repeats (IRs) 영역과 각각 하나의 small single copy (SSC) 및 large single copy (LSC) 영역으로 구성되어 있다(Yurina and Odintosova 1998). 앞서 보고된 바와 같이 재배종 감자와 근연야생종의 엽록체 전체 염기서열과 그 구조는 서로 매우 유사하였다(Palmer 1991; Raubeson and Jansen 2005; Saski et al. 2005; Sugiura et al. 1998)(Table 1). 이러한 유사성에도 불구하고, 이들 엽록체 유전체에서는 유전자 역위나 재배열 등과 같은 구조적 변화에 의한 변이가 발생하여 엽록체 유전체 전체를 비교하면 식물체 종 특이적인 InDel이나 SNP를 발견할 수 있다(Calsa Junior et al. 2004; Cho et al. 2015; Jheng et al. 2012; Kim et al. 2005, 2018; Kim and Park 2019, 2020a, 2020b; Park 2021, 2022a, 2022b, 2023a, 2023b; Saski et al. 2005). 따라서, 본 연구에서는 S. jamesii의 엽록체 전장유전체를 구명하여 이에 대한 정보를 제공하고, 전장유전체의 염기서열 정보를 이용하여 개발한 PCR기반의 S. jamesii 특이적 분자마커에 대한 결과를 제공하고자 한다.

Table 1 . Results of comparative analysis of the chloroplast genome sequence of S. jamesii with those of 14 Solanaceae species.

SpeciesAccession no.Total length (bp)GC content (%)Total no. of genesNo. of tRNAsNo. of rRNAsReference
S. jamesiiMK690624155,57637.90134364This study
S. hjertingiiMK690623155,54537.88134364Park (2023a)
S. cardiophyllumMK690622155,57037.90134364Park (2023b)
S. acauleMK036506155,57037.84135364Park (2022b)
S. brevicauleMK036507155,53137.87135364Park (2022a)
S. demissumMK036508155,55837.87135364Park (2021)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*The data have been partially adopted from Park (2023b)..

재료 및 방법

식물재료 및 DNA 분리

S. jamesii (PI578326) 엽록체의 전장유전체 분석에는 S. jamesii 계통 중 하나인 SJ-8이 이용되었으며, S. jamesii 특이적 분자마커 개발을 위해 S. jamesii의 SJ-6과 SJ-11 계통이 추가되었다. 이외에 3개의 재배종 감자 품종과 12종의 가지속(Solanum) 이용되었으며, 자체적으로 대구에서 수집한 S. nigrum (SN)을 제외한 모든 식물재료는 국립식량과학원 고령지농업연구소에서 분양 받아 기내식물체로 유지 및 증식하여 이용하였다. 실험에 이용된 재배종 감자의 품종은 ‘대지’(DJ), 대서’(DS), ‘수미’(SM)이고, S. nigrum 이외 11개의 야생종 계통은 S. acaule (PI310970, SA), S. brevicaule (PI205394, SB2), S. hougasii (PI161174, SH2), S. cardiophyllum (PI341233, SC1), S. commersonii (PI558050, SC2), S. hjertingii (PI186559, SH1), S. stoloniferum (PI160224, SS), S. kurtzianum (PI578236, SK), S. mochiquense (PI338616, SM1), S. verrucosum (PI160228, SV1), S. vernei (PI230468, SV2)이다.

DNA 분리는 Genomic DNA Extraction kit (Plants)(RBC, New Taipei City, Taiwan)를 이용하여 모든 식물체를 대상으로 계대배양 한 후 약 3주 이내 유식물체의 약 100 mg을 채취하여 진행하였다.

S. jamesii 엽록체 전장유전체의 구명 및 분석

S. jamesii의 엽록체 전장유전체 분석은 S. jamesii 계통 SJ-8을 대상으로 진행하였다. 전체 염기서열 정보(raw data)는 Macrogen (Macrogen, Seoul, South Korea)의 MiSeq (Illumina, SanDiego, CA, USA) 플랫폼을 통해 확보하였으며, 염기서열의 분석과 조립은 파이젠(http://phyzen.com)에서 제공하는 de novo assembly가 이용되었다(Cho et al. 2015). 그 과정에서 전처리(trimming), high-quality 염기서열 추출(Phred score 20 이상), dnaLCW 방법으로 조립 등은 CLC quality trim, CLC de novo assemble 등의 프로그램이 이용되었으며, 이들 프로그램은 CLC genome assembler package version 4.2.1 (CLC Inc, Rarhus, Denmark)에서 제공된 것이다. 이후 조립된 염기서열 중, 엽록체 유전체 유래의 contig를 선발하고, gap-filling에 의한 확장과 통합을 통해 엽록체 유전체를 완성하였다. 전처리된 염기서열 전체를 완성된 엽록체 전장 유전체 서열에 mapping하여 각각의 영역별 read depth를 계산하였고, reference 종과 유전체의 구조 및 염기서열을 비교하였다. 또한, 엽록체 전장 유전체 서열을 이용하여 BLASTN을 수행하였으며, homology가 높은 종의 엽록체 전장 유전체 서열을 확인하고 BLASTZ (Schwartz et al. 2003) 분석을 실시하였다.

완성된 S. jamesii 엽록체 전장 유전체의 유전자는 Geseq 프로그램을 통해 확인하고, BLAST search를 기반으로 한 manual curation을 통해 최종적으로 유전자와 유전자의 위치를 결정하였다(Tillich et al. 2017). 이들은 OGDraw 프로그램을 통해 원형의 유전자지도 상에 표시되었다(Lohse et al. 2007).

엽록체 유전체의 비교와 분자마커 개발

S. jamesii와 유사종들과의 유전관계 분석을 위해 NCBI (National Center for Biotechnology Information)에 등록되어 있는 재배종 감자 S. tuberosum (NC008096 및 KM489056), 가지과의 까마중 S. nigrum (KM489055), 고추 Capsicum annuum (JX270811), 토마토 S. lycopersicum (NC007898), 감자의 근연야생종 12종 S. acaule (MK036506), S. brevicaule (MK036507), S. berthaultii (KY419708), S. bulbocastanum (DQ347958), S. demissum (MK036508), S. cardiophyllum (MK690622), S. stoloniferum (MF471373), S. chacoense (MF471371), S. commersonii (KM489054), S. hjertingii (MK690623), S. hougasii (MF471372), S. verrucosum (MK690625) 등 총 18개의 엽록체 전체 염기서열을 확보하여, 여기에 존재하는 단백질 코딩 서열을 MEGA11 프로그램을 이용하여 분석하였으며, 이 프로그램은 1,000번의 Bootstrap 옵션이 적용되었고 GTR (General Time Reversible)모델 기반의 Maximum Likelihood 방법이 이용되었다(Tamura et al. 2021).

분자마커의 개발은 S. jamesii의 엽록체 전체 염기서열과 NCBI로부터 얻은 S. verrucosum (MK690625), S. cardiophyllum (MK690622), S. bulbocastanum (DQ347958), S. berthaultii (KY419708), S. hjertingii (MK690623), S. tuberosum (KM489056), S. commersonii (KM489054), S. hougasii (MF471372)의 엽록체 전체 염기서열을 ClustalW2 (EMBL: http://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 다중정렬 하였고, 이를 통해 S. jamesii에 특이적으로 나타나는 InDel과 SNP를 확보할 수 있었다. InDel의 경우 InDel이 있는 영역에 primer를 제작하여 allele 특이적 분자마커를 개발하고자 하였으며, SNP의 경우 tetra-primer ARMS (Amplification Refractory Mutation System)-PCR 기술을 이용하여 primer를 제작하였다(Collins and Ke 2012; Ye et al. 2001). S. jamesii와 S. tuberosum을 포함한 총 18개의 계통, S. jamesii (SJ6, SJ8 및 SJ11), S. tuberosum (감자품종 ‘대지’(DJ), ‘수미’(SM), ‘대서’(DS)), S. acaule (SA), S. cardiophyllum (SC1), S. brevicaule (SB2), S. commersonii (SC2), S. hjertingii (SH1), S. hougasii (SH2), S. mochiquense (SM1), S. kurtzianum (SK), S. nigrum (SN), S. stoloniferum (SS), S. verrucosum (SV1), S. vernei (SV2)를 대상으로 PCR을 수행하였다. InDel 기반의 분자마커 개발은 위한 PCR의 경우, 총 20 ul (약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로, SNP 기반의 분자마커 개발을 위한 PCR의 경우, 총 20 ul (약 20 ng genomic DNA, 0.5 mM dNTPs, 10 pMol each inner primer, 1 pMol each outer primer, 1 U Taq polymerase (Genetbio, Daejeon, South Korea))으로 Thermocycler (Biometra, Göttingen, Germany)을 이용하였다. PCR의 결과는 핵산 염색용액인 StaySafe (RBC, New Taipei City, Taiwan)를 이용하여 1.5% agarose gel에서 확인하였다.

결과 및 고찰

S. jamesii의 엽록체 유전체

S. jamesii의 엽록체 전체 염기서열은 NGS 기술을 이용하여 완성되었다. NGS 기반으로 얻은 데이터는 평균 301.0 bp 길이의 총 염기서열 약 1.5 Gbp로, 이는 5,267,110 read를 통해 생산되었다. 이중 약 90.79%를 이용하여 전처리 및 Phred score 20 이상의 데이터 추출과정을 거쳐 high-quality 총 염기서열 정보 약 1.3 Gbp를 얻었으며, 평균 길이는 283.6 bp로 확인되었다. 이는 전체 raw data의 약 85.55%였으며, S. cardiophyllum 의 전체 엽록체 염기서열과 비교했을 때 사용된 총 염기서열이 약 0.3 Gbp 적었지만, 총 생산된 데이터 대비 추출 염기서열의 비율은 비슷한 수준이었다(Park 2023a, 2023b). 또한, de novo assembly와 엽록체 유래의 contig를 선발하고, gap-filling 과정을 통한 확장과 통합 등을 거쳐 총 염기서열은 155,576 bp의 S. jamesii 엽록체 전장 유전체가 완성되다. 최종적으로 aligned read의 개수는 435,578개, 전체 유전체에 대한 평균 coverage는 약 789.54x, 전체 trimmed read를 완성된 전체 유전체 서열에 mapping한 결과로 나타난 read depth는 최소 378 이상이었다. 구조적으로는 원형 이중가닥 분자 구조로 다른 식물의 엽록체 유전체와 동일한 형태였으며, 한 쌍의 25,596 bp의 IRa/IRb, 18,394 bp의 SSC, 85,990 bp의 LSC 영역으로 구성되어 있었다. S. bulbocastanum의 엽록체 전체 염기서열(DQ347958)과의 비교와 BLASTZ 분석의 결과로도 그 유사성을 확인할 수 있었다(Daniell et al. 2006; Schwartz et al. 2003) (Fig. 1). S. jamesii의 엽록체 전체 염기서열을 대상으로 NCBI의 BLASTN 분석 결과 S. pinnatisectum (MZ233590), S. cardiophyllum (MK690622)과 99.95%의 높은 염기서열 일치도를 보였으며, GC 비율 또한 37.90%로 매우 유사하였다(Table 1).

Figure 1. Assembly of the complete chloroplast genome sequence of S. jamesii. The four representative contigs for the chloroplast genome of S. jamesii and comparison with the corresponding regions of the S. bulbocastanum chloroplast genome (DQ347958) are combined. Blue and yellow bars indicate contigs matching the reference sequence in forward and reverse orientation, respectively

S. jamesii의 엽록체 전장 유전체에는 105개의 단백질 코딩, 45개의 tRNA, 8개의 rRNA를 포함는 총 158개의 유전자가 존재하고 있는데, 이중 11개의 단백질 코딩 유전자, 9개의 tRNA, 4개의 rRNA가 한 쌍의 Ira 및 IRb 영역에 역배열로 중복되어 있었다(Table 1, Fig. 2). 전체 염기서열 중 코딩 영역의 비율은 59.2%로 나타났으며, 158개 유전자의 평균 길이는 약 583.4 bp, 이중 각각의 평균은 단백질 코딩 유전자가 764.8 bp, tRNA가 62.4 bp, rRNA가 1,131.0 bp의 크기로 각각 51.6%, 1.8%, 5.8%의 비율로 분포되어 있으며, 이러한 결과는 다른 Solanum 종들과 매우 유사한 수준이었다(Table 1).

Figure 2. Gene map of the S. jamesii chloroplast genome. Genes on the outside of the map are transcribed in the clockwise direction and genes on the inside of the map are transcribed in the counterclockwise direction

엽록체의 계통수 작성과 전장유전체 비교

S. jamesii의 계통수 작성은 총 17종 가지과의 엽록체 전장 유전체 코딩 서열을 기반으로 실행되었다(Fig. 3). 그 결과, S. jamesii는 S. tuberosum 뿐만 아니라 다수의 가지속(Solanum) 종들과 같은 그룹에 존재함을 확인하였으며, 유연관계가 그중 S. cardiophyllum과 가장 가까웠으며, 상대적으로 까마중(S. nigrum), 고추(C. annuum), 토마토(S. lycopersicum)와는 다소 먼 것으로 확인되었다.

Figure 3. Maximum-likelihood phylogenetic tree of S. jamesii with 17 Solanaceae family members based on chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. The data are partially adopted from Park (2023a)

S. jamesii 엽록체의 전체 염기서열을 7종의 근연야생종과 재배종 감자의 엽록체 전체 염기서열과 ClustalW2 (EMBL; https://www.ebi.ac.uk/Tools/msa/clustalw2)를 이용하여 다중 정렬한 결과 S. jamesii 특이적인 2개의 InDel과 11개의 SNP를 구명하였다(Fig. 4). 상대적으로 S. jamesii 특이적 InDel과 SNP의 수가 매우 적은 편이었는데, 이는 다중 정렬에 S. jamesii의 엽록체 전체 염기서열과 유사도가 매우 높은 S. cardiophyllum이 포함되어 나타난 결과로 보인다. 하지민, 다양한 유전적 요인에 의한 변이 발생으로 인해 S. jamesii 특이적인 InDel과 SNP가 존재하며, 이를 이용하여 S. jamesii 특이적 분자마커를 개발할 수 있었다(Cho and Park 2016; Chung et al. 2006; Kim et al. 2018; Kim and Park 2019, 2020a, 2020b; Park 2021, 2022a, 2022b, 2023a, 2023b). 2개의 InDel은 각각 유전자 간 및 내 영역에 존재하고 있었으며, 11개의 SNP 중 8개는 유전자 간 영역에 3개는 유전자 내 영역에 위치하고 있었다.

Figure 4. Multiple alignment of the sequences from the intergenic or intragenic regions containing InDels and SNPs used to develop the PCR-based markers. The chloroplast genome sequences of S. cardiophyllum (SC1-9: MK690622), S. jamesii (SJ8: MK690624), S. bulbocastanum (Sblb: DQ347958), S. berthaultii (Sber: KY419708), S. tuberosum (Stub: KM489056), S. verrucosum (SV1-4: MK690625), S. hougasii (SH2-10: MF471372), S. hjertingii (SH1-16: MK690623), and S. commersonii (Scmr: KM489054) were used and are listed from top to bottom in each region of the InDels and SNPs. The InDel and SNP regions detected from S. jamesii are bold, highlighted and underlined

S. jamesii 특이적 분자마커 개발

S. jamesii를 포함한 총 9개 Solanum 종의 엽록체 전체 염기서열의 다중 정렬 결과로 확인된 S. jamesii 특이적 InDel과 SNP는 S. jamesii 특이적인 분자마커 개발에 활용되었다. InDel은 InDel 영역에서 특이적인 primer를 제작하여 PCR을 통해 다양성의 차이가 나타나는 S. jamesii 특이적 또는 비특이적인 3개의 SCAR (Sequence Characterized Amplified Region) 마커를 개발할 수 있었다(Cho et al. 2015; Garcia-Lor et al. 2013; Yamaki et al. 2013)(Table 2, Fig. 5A, 5B, 5C). SNP는 11개 중 3개의 영역을 대상으로 S. jamesii 특이적 SNP 위치를 기준으로 SNP가 포함된 DNA 단편과 SNP 위치을 대상으로 S. jamesii 특이적이거나 혹은 S. jamesii를 제외한 Solanum 종들에 특이적으로 DNA를 증폭할 수 있는 tetra-primer ARMS-PCR 방법을 적용하여 primer를 제작하였다(Collins and Ke 2012; Ye et al. 2001)(Table 2). 이러한 방법은 PCR로 염기서열이 매우 유사한 SNP를 대상으로 primer의 제작이 어려운 종 또는 SNP가 존재하는 계통 간의 차이를 비교적 손쉽게 확인할 수 있다는 장점이 있어 널리 활용되고 있으며, 본 연구에서도 Solanum 종간의 비교 결과로 나타난 SNP를 활용한 PCR 기반의 S. jamesii 특이적이거나 (Fig. 5D, 5E, 5F) 혹은 비특이적으로(Fig. 5D, 5E, 5F) 나타나는 3개의 분자마커를 개발하였다(Han et al. 2016; Kou et al. 2017; Mahmoudi et al. 2019; Zou et al. 2018). 최종적으로 본 연구에서는 InDel과 SNP 정보를 기반으로 한 S. jamesii 특이적 분자마커가 각각 3개씩 개발되었다. SJ8_InDel1 (Fig. 4, Fig. 5A, 5B)과 SJ8_InDel2 (Fig. 4, Fig. 5C)은 각각 trnL 유전자 내 및 petA와 psbJ 유전자 사이에 존재하는 SCAR 마커로 개발되었으며, SJ8_SNP1 (Fig. 4, Fig. 5D), SJ8_SNP3 (Fig. 4, Fig. 5E)과 SJ8_SNP5 (Fig. 4, Fig. 5F)는 각각 atpF 유전자 내, atpH와 atpI 유전자 사이 및 psaA 유전자 내에 존재하는 SNP 기반의 마커로 개발되었다.

Figure 5. PCR-based markers for the discrimination of S. jamesii from other Solanum species. A: SJ8_InDel1(a). B: SJ8_InDel1(b). C: SJ8_InDel2. D: SJ8_SNP1. E: SJ8_SNP3. F: SJ8_SNP5. The markers SJ8_InDel1(a) and SJ8_InDel2 are positively specific to S. jamesii. The marker SJ8_InDel1(b) is negatively specific to S. jamesii. The markers SJ8_SNP1, SJ8_SNP3 and SJ8_SNP5 are both positively and negatively specific to S. jamesii. SJ6, SJ8 and SJ11 indicate three different lines of S. jamesii (PI578326). M, DS, DJ, SM, SA, SB2, SC1, SC2, SH1, SH2, SK, SM1, SN, SS, SV1 and SV2 indicate a size marker ladder, potato varieties ‘Daeseo’, ‘Daeji’, ‘Sumi’, S. acaule (PI310970), S. brevicaule (PI205394), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. hjertingii (PI186559), S. hougasii (PI161174), S. kurtzianum (PI578236), S. mochiquense (PI338616), a line of S. nigrum selected in Daegu, South Korea, S. stoloniferum (PI160224), S. verrucosum (PI160228) and S. vernei (PI230468), respectively. Red and yellow arrows indicate positive and negative bands on S. jamesii, respectively

Table 2 . Information of primers used to generate S. jamesii-specific and non-specific markers.

InDel/SNPStrandPrimer sequence (5’ → 3’)Tm (°C)Size
SJ8_InDel1(a)Forward primerAAACGTATATACATACTATATC56°C735 bp (delete sequence 11bp specific to S. jamesii)
Reverse primerTTTCAGTCCTCTGCTCTAC
SJ8_InDel1(b)Forward primerAAACGTATATACATACGTATTG58°C746 bp (delete sequence 11bp non-specific to S. jamesii)
Reverse primerTTTCAGTCCTCTGCTCTAC
SJ8_InDel2Forward primerAGTATAGAAAGGATTAGATTAG60°C777 bp (insert sequence ‘ATTAGATTAGTATAGAAAGG’ specific to S. jamesii)
Reverse primerTATCAGCAATGCAGTTCATC
SJ8_SNP1Forward inner primerCCTATCTTCTCTTCTTTGTTCATATTTCC60°C396 bp (from two outer primers), 217 bp (C allele specific to S. jamesii), 238 bp (A allele non-specific to S. jamesii)
Reverse inner primerTTGGTCTTACATTAGTTTCGATATCTTCTT
Forward outer primerTCAAGATCCTCTGTTTTCGATTATCTAA
Reverse outer primerGTAAATTGTAAAAACAGGGATTTTACCC
SJ8_SNP3Forward inner primerAATTCTCTTGAGCCACCCACCATATGCC56°C300 bp (from two outer primers), 178 bp (C allele specific to S. jamesii), 210 bp (A allele non-specific to S. jamesii)
Reverse inner primerTTTTAGCTTAGCCCACAGCAATGTATAGAT
Forward outer primerTGAAGGAAAGGGGAATTTTAGGAAAAAGAT
Reverse outer primerGTTCCTATACCTGTCATGCTCCTTGGATT
SJ8_SNP5Forward inner primerCTGAATAGAAACATTAAACTAAAAGCCTAG58°C390 bp (from two outer primers), 243 bp (T allele specific to S. jamesii), 204 bp (G allele non-specific to S. jamesii)
Reverse inner primerCTTTTTTTCCTAGGTGCTCATTTTATA
Forward outer primerTACTGCAATAATTCTTGCTAAGAAGAAT
Reverse outer primerGTAAGTGATCAAGGGGTAGTAACTCATA

감자의 신품종 육성을 위해 다양한 유용한 특성을 지니고 있는 근연야생종을 이용한 연구가 계속해서 수행되고 있으나, 교배육종을 통한 유용 형질의 도입은 다수의 근연야생종이 재배종 감자와의 EBN과 배수성 차이로 인해 어려움을 겪기 때문에, 체세포융합을 이용한 체세포잡종의 육성이 활용되고 있으며, 이에 따라 유전자형 확인이 필수적이다. 분자마커를 통한 유전자형의 확인은 단순히 염색체 조합만을 확인하는 것이 아니라 엽록체 및 미토콘드리아 유전체의 전달 확인도 필요하다. 특히 Solanum 속에 속하는 다양한 식물종의 경우, 체세포융합이나 재분화 과정에서 핵 내 및 미토콘드리아 유전체는 재조합 빈도가 높다는 것이 알려져 있으며, 엽록체 유전체의 경우에는 한 쪽 친의 엽록체 유전체가 무작위적으로 전달되는 것 외에도 양친의 유전체가 모두 전달되는 경우도 있었다(Chen et al. 2013; Cho et al. 2016; Lössl et al. 2000; Mohapatra et al. 1998; Smyda-Dajmund et al. 2016; Wang et al. 2011; Xiang et al. 2004). 이에 따라, 본 연구에서 개발된 분자마커는 체세포융합을 통한 체세포잡종의 육성 과정에서 특히 S. jamesii와 S. tuberosum 유래의 엽록체 유전체의 유전자형 구별에 이용이 될 것이며, 이러한 분자마커는 감자 육성 과정에서 신품종의 개발 및 진화학적 연구에 기여할 수 있을 것이다.

적 요

멕시코 북서부부터 미국 남서부까지 자생하는 감자 야생종 중 하나인 Solanum jamesii는 Phytophthora infestans에 대한 저항성으로 감자 육종에 훌륭한 재료이다. 그러나 S. jamesii는 이배체이며 EBN 값이 1로, 이는 S. jamesii와 재배용 감자 간 교배가 불가능하다. 이 문제를 극복하기 위해 체세포융합을 이용할 수 있다. 이후에는 분자마커를 사용하여 효율적으로 융합체를 선발하는 것이 필수적이다. 본 연구에서는 차세대 유전체 기술을 사용하여 S. jamesii의 엽록체 전장 유전체 서열을 확보하고, 이를 다른 8개의 가지과에 속한 종과 비교하여 S. jamesii 특이적 마커를 개발하였다. S. jamesii의 엽록체 유전체의 총 서열 길이는 155,576 bp이며, 그 구조는 다른 Solanum 종과 유사하다. 17개의 다른 Solanaceae 종과의 계통수 분석 결과, S. jamesii는 S. cardiophyllum과 가장 밀접한 유연관계를 가졌다. 8개의 다른 Solanum 종의 엽록체 전장 유전체 서열 비교에서 S. jamesii에 특이한 2개의 InDel 및 11개의 SNP가 확인되었다. 이러한 InDel 및 SNP를 기반으로 S. jamesii를 다른 Solanum 종과 구별하는 6개의 PCR 기반 분자마커가 개발되었다. 본 연구의 결과는 Solanum 종 중에서 S. Jamesii를 구별하고 S. Jamesii를 활용한 감자 신품종 개발에 기여할 것이다.

Fig 1.

Download
Figure 1.Assembly of the complete chloroplast genome sequence of S. jamesii. The four representative contigs for the chloroplast genome of S. jamesii and comparison with the corresponding regions of the S. bulbocastanum chloroplast genome (DQ347958) are combined. Blue and yellow bars indicate contigs matching the reference sequence in forward and reverse orientation, respectively
Journal of Plant Biotechnology 2024; 51: 143-151https://doi.org/10.5010/JPB.2024.51.015.143

Fig 2.

Download
Figure 2.Gene map of the S. jamesii chloroplast genome. Genes on the outside of the map are transcribed in the clockwise direction and genes on the inside of the map are transcribed in the counterclockwise direction
Journal of Plant Biotechnology 2024; 51: 143-151https://doi.org/10.5010/JPB.2024.51.015.143

Fig 3.

Download
Figure 3.Maximum-likelihood phylogenetic tree of S. jamesii with 17 Solanaceae family members based on chloroplast protein-coding sequences of each chloroplast genome. The numbers on each node indicate the bootstrap values from 1,000 replicates. The data are partially adopted from Park (2023a)
Journal of Plant Biotechnology 2024; 51: 143-151https://doi.org/10.5010/JPB.2024.51.015.143

Fig 4.

Download
Figure 4.Multiple alignment of the sequences from the intergenic or intragenic regions containing InDels and SNPs used to develop the PCR-based markers. The chloroplast genome sequences of S. cardiophyllum (SC1-9: MK690622), S. jamesii (SJ8: MK690624), S. bulbocastanum (Sblb: DQ347958), S. berthaultii (Sber: KY419708), S. tuberosum (Stub: KM489056), S. verrucosum (SV1-4: MK690625), S. hougasii (SH2-10: MF471372), S. hjertingii (SH1-16: MK690623), and S. commersonii (Scmr: KM489054) were used and are listed from top to bottom in each region of the InDels and SNPs. The InDel and SNP regions detected from S. jamesii are bold, highlighted and underlined
Journal of Plant Biotechnology 2024; 51: 143-151https://doi.org/10.5010/JPB.2024.51.015.143

Fig 5.

Download
Figure 5.PCR-based markers for the discrimination of S. jamesii from other Solanum species. A: SJ8_InDel1(a). B: SJ8_InDel1(b). C: SJ8_InDel2. D: SJ8_SNP1. E: SJ8_SNP3. F: SJ8_SNP5. The markers SJ8_InDel1(a) and SJ8_InDel2 are positively specific to S. jamesii. The marker SJ8_InDel1(b) is negatively specific to S. jamesii. The markers SJ8_SNP1, SJ8_SNP3 and SJ8_SNP5 are both positively and negatively specific to S. jamesii. SJ6, SJ8 and SJ11 indicate three different lines of S. jamesii (PI578326). M, DS, DJ, SM, SA, SB2, SC1, SC2, SH1, SH2, SK, SM1, SN, SS, SV1 and SV2 indicate a size marker ladder, potato varieties ‘Daeseo’, ‘Daeji’, ‘Sumi’, S. acaule (PI310970), S. brevicaule (PI205394), S. cardiophyllum (PI341233), S. commersonii (PI558050), S. hjertingii (PI186559), S. hougasii (PI161174), S. kurtzianum (PI578236), S. mochiquense (PI338616), a line of S. nigrum selected in Daegu, South Korea, S. stoloniferum (PI160224), S. verrucosum (PI160228) and S. vernei (PI230468), respectively. Red and yellow arrows indicate positive and negative bands on S. jamesii, respectively
Journal of Plant Biotechnology 2024; 51: 143-151https://doi.org/10.5010/JPB.2024.51.015.143

Table 1 . Results of comparative analysis of the chloroplast genome sequence of S. jamesii with those of 14 Solanaceae species.

SpeciesAccession no.Total length (bp)GC content (%)Total no. of genesNo. of tRNAsNo. of rRNAsReference
S. jamesiiMK690624155,57637.90134364This study
S. hjertingiiMK690623155,54537.88134364Park (2023a)
S. cardiophyllumMK690622155,57037.90134364Park (2023b)
S. acauleMK036506155,57037.84135364Park (2022b)
S. brevicauleMK036507155,53137.87135364Park (2022a)
S. demissumMK036508155,55837.87135364Park (2021)
S. hougasiiMF471372155,54937.87135364Kim and Park (2020b)
S. stoloniferumMF471373155,56737.87135364Kim and Park (2020a)
S. chacoenseMF471371155,53237.89136364Kim and Park (2019)
S. berthaultiiKY419708155,53337.88137394Kim et al. (2018)
S. commersoniiKM489054155,52537.88133334Cho et al. (2016)
S. nigrumKM489055155,43237.90139394Cho and Park (2016)
S. tuberosumKM489056155,31237.88130304Cho et al. (2016)
S. bulbocastanumDQ347958155,37137.88133304Daniell et al. (2006)
S. tuberosumNC008096155,29637.88131364Gargano et al. (2005)

*The data have been partially adopted from Park (2023b)..

Table 2 . Information of primers used to generate S. jamesii-specific and non-specific markers.

InDel/SNPStrandPrimer sequence (5’ → 3’)Tm (°C)Size
SJ8_InDel1(a)Forward primerAAACGTATATACATACTATATC56°C735 bp (delete sequence 11bp specific to S. jamesii)
Reverse primerTTTCAGTCCTCTGCTCTAC
SJ8_InDel1(b)Forward primerAAACGTATATACATACGTATTG58°C746 bp (delete sequence 11bp non-specific to S. jamesii)
Reverse primerTTTCAGTCCTCTGCTCTAC
SJ8_InDel2Forward primerAGTATAGAAAGGATTAGATTAG60°C777 bp (insert sequence ‘ATTAGATTAGTATAGAAAGG’ specific to S. jamesii)
Reverse primerTATCAGCAATGCAGTTCATC
SJ8_SNP1Forward inner primerCCTATCTTCTCTTCTTTGTTCATATTTCC60°C396 bp (from two outer primers), 217 bp (C allele specific to S. jamesii), 238 bp (A allele non-specific to S. jamesii)
Reverse inner primerTTGGTCTTACATTAGTTTCGATATCTTCTT
Forward outer primerTCAAGATCCTCTGTTTTCGATTATCTAA
Reverse outer primerGTAAATTGTAAAAACAGGGATTTTACCC
SJ8_SNP3Forward inner primerAATTCTCTTGAGCCACCCACCATATGCC56°C300 bp (from two outer primers), 178 bp (C allele specific to S. jamesii), 210 bp (A allele non-specific to S. jamesii)
Reverse inner primerTTTTAGCTTAGCCCACAGCAATGTATAGAT
Forward outer primerTGAAGGAAAGGGGAATTTTAGGAAAAAGAT
Reverse outer primerGTTCCTATACCTGTCATGCTCCTTGGATT
SJ8_SNP5Forward inner primerCTGAATAGAAACATTAAACTAAAAGCCTAG58°C390 bp (from two outer primers), 243 bp (T allele specific to S. jamesii), 204 bp (G allele non-specific to S. jamesii)
Reverse inner primerCTTTTTTTCCTAGGTGCTCATTTTATA
Forward outer primerTACTGCAATAATTCTTGCTAAGAAGAAT
Reverse outer primerGTAAGTGATCAAGGGGTAGTAACTCATA

References

  1. Bamberg J, Kielar A, del Rio A, Douches D (2021) Making hybrids with the wild potato Solanum jamesii. Am J Potato Res 98:187-193
    CrossRef
  2. Calsa Junior T, Carraro DM, Benatti MR, Barbosa AC, Kitajima JP, Carrer H (2004) Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr Genet 46:366-373
    Pubmed CrossRef
  3. Chen L, Guo X, Xie C, He L, Cai X, Tian L, Song B, Liu J (2013) Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance. Theor Appl Genet 126:1861-1872
    Pubmed CrossRef
  4. Cho HM, Kim-Lee HY, Om YH, Kim JK (1997) Influence of endosperm balance number (EBN) in interploidal and interspecific crosses between Solanum tuberosum dihaploids and wild species. Korean J Breed 29:154-161
  5. Cho KS, Cheon KS, Hong SY, Cho JH, Im JS, Mekapogu M, Yu YS, Park TH (2016) Complete chloroplast genome sequences of Solanum commersonii and its application to chloroplast genotype in somatic hybrids with Solanum tuberosum. Plant Cell Rep 35:2113-2123
    Pubmed CrossRef
  6. Cho KS, Park TH (2014) Potato breeding via protoplast fusion. J Plant Biotechnol 41:65-72
    CrossRef
  7. Cho KS, Park TH (2016) Complete chloroplast genome sequence of Solanum nigrum and Development of markers for the discrimination of S. nigrum. Hort Environ Biotechnol 57:69-78
    CrossRef
  8. Cho KS, Yun BK, Yoon YH, Hong SY, Mekapogu M, Kim KH, Yang TJ (2015) Complete chloroplast genome sequence of tartary Buckwheat (Fagopyrum tataricum) and comparative analysis with common Buckwheat (F. esculentum). PloS One 10:e0125332
    Pubmed KoreaMed CrossRef
  9. Chung HJ, Jung JD, Park HW, Kim JH, Cha HW, Min SR, Jeong WJ, Liu JR (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25:1369-1379
    Pubmed CrossRef
  10. Collins A, Ke X (2012) Primer1: Primer design web service for tetra-primer ARMS-PCR. Open Bioinformatics J 6:55-58
    CrossRef
  11. Daniell H, Lee S-B, Grevich J, Saski C, Quesada-Vargas T, Guda C, Tomkins J, Jansen PK (2006) Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor Appl Genet 112:1503-1518
    Pubmed CrossRef
  12. Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P (2013) A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species. Ann Bot 111:1-19
    Pubmed KoreaMed CrossRef
  13. Gargano D, Vezzi A, Scotti N, Gray JC, Valle G, Grillo S, Cardi T (2005) complete nucleotide sequence genome of potato (Solanum tuberosum cv. Desiree) chloroplast DNA. In the abstract of the 2nd Solanaceae Genome Workshop 107
  14. Han E-H, Cho K-M, Goo Y-M, Kim M-B, Shin Y-W, Kim Y-H, Lee S-W (2016) Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species, Cynanchum wilfordii, Cynanchum auriculatum, and Polygonum multiflorum. Mol Biol Rep 43:323-332
    Pubmed CrossRef
  15. Hanneman RE (1994) The testing and release of transgenic potatoes in the North American Center of diversity. AF Krattiger, A Rosemarin, (Eds.). biosafety for sustainable agriculture: sharing biotechnology regulatory experience of the western hemisphere. ISAAA: Ithaca and SEI. Stockholm 47-67
  16. Hawkes JG (1990) The potato: Evolution, biodiversity and genetic resources. London, UK, Belhaven Press
    CrossRef
  17. Jheng C-F, Chen T-C, Lin J-Y, Chen T-C, Wu W-L, Chang C-C (2012) The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids. Plant Sci 190:62-73
    Pubmed CrossRef
  18. Kim KJ, Choi KS, Jansen RK (2005) Two chloroplast DNA inversion originated simultaneously during the early evolution of the sunflower family (Asteraceae). Mol Biol Evol 22:1783-1792
    Pubmed CrossRef
  19. Kim S, Cho K-S, Park T-H (2018) Development of PCR-based markers for discriminating Solanum berthaultii using its complete chloroplast genome species. J Plant Biotechnol 45:207-216
    CrossRef
  20. Kim S, Park T-H (2019) PCR-based markers developed by comparison of complete chloroplast genome sequences discriminate Solanum chacoense from other Solanum species. J Plant Bioechnol 46:79-87
    CrossRef
  21. Kim S, Park T-H (2020a) Comparison of the complete chloroplast genome sequences of Solanum stoloniferum with other Solanum species generate PCR-based markers specific for Solanum stoloniferum. J Plant Bioechnol 47:131-140
    CrossRef
  22. Kim S, Park T-H (2020b) Development of Solanum hougasii-specific markers using the complete chloroplast genome sequences of Solanum species. J Plant Bioechnol 47:141-149
    CrossRef
  23. Kim-Lee H, Moon JS, Hong YJ, Kim MS, Cho HM (2005) Bacterial wilt resistance in the progenies of the fusion hybrids between haploid of potato and Solanum commersonii. Amer J Potato Res 82:129-137
    CrossRef
  24. Kou M, Xu J-I, Li Q, Liu Y-J, Wang X, Tang W, Yan H, Zhang Y-G, Ma D-F (2017) Development of SNP markers using RNA-seq technology and tetra-primer ARMS-PCR in sweetpotato. J Integr Agric 16:464-470
    CrossRef
  25. Kozlov VA, Chashinskij AV, Rusetskij NV, Zhuromskij GK, Rajko AM (2007) Wild species of potato as sources of resistance to pathogens. Zashchita Rastenij (Belarus) 31:191-203
  26. Lohse M, Drechsel O, Bock R (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52:267-274
    Pubmed CrossRef
  27. Lössl A, Götz A, Braun A, Wenzel G (2000) Molecular markers for cytoplasm in potato: male sterility and contribution of different plastid-mitochondrial configurations to starch production. Euphytica 116:221-230
    CrossRef
  28. Machida-Hirano R (2015) Diversity of potato genetic resources. Breed Sci 65:26-40
    Pubmed KoreaMed CrossRef
  29. Mahmoudi S, Badali H, Rezaie S, Azarnezhad A, Barac A, Kord M, Ahmadikia K, Aala F, Askari FA, Meis JF, Khodavaisy S (2019) A simple and low cost tetra-primer ARMS-PCR method for detection triazole-resistant Aspergillus fumigatus. Mol Biol Rep 46:4537-4543
    Pubmed CrossRef
  30. Mohapatra T, Kirti PB, Dinesh Kumar V, Prakash S, Chopra VL (1998) Random chloroplast segregation and mitochondrial genome recombination in somatic hybrid plants of Diplotaxis catholica + Brassica juncea. Plant Cell Rep 17:814-818
    Pubmed CrossRef
  31. Ortiz R, Ehlenfeldt MK (1992) The importance of endorsperm balance number in potato breeding and the evolution of tuber-bearing Solanum species. Euphytica 60:105-113
    CrossRef
  32. Palmer JD (1991) Plastid chromosomes: structure and evolution. L. Bogorad, K. Vasil, (Eds.). The molecular biology of plastids. Academic Press. San Diego, USA 5-53
    KoreaMed CrossRef
  33. Park T-H (2021) PCR-based markers for discriminating Solanum demissum were developed by comparison of complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 48:18-25
    CrossRef
  34. Park T-H (2022a) Development of PCR-based markers specific to Solanum brevicaule by using the complete chloroplast genome sequences of Solanum species. J Plant Biotechnol 49:30-38
    CrossRef
  35. Park T-H (2022b) PCR-based markers to select plastid genotypes of Solanum acaule. J Plant Biotechnol 49:178-186
    CrossRef
  36. Park T-H (2023a) Development of PCR-based markers for selecting plastid genotypes of Solanum hjertingii. J Plant Biotechnol 50:34-44
    CrossRef
  37. Park T-H (2023b) Chloroplast genome sequence and PCR-based markers for S. cardiophyllum. J Plant Biotechnol 50:45-55
    CrossRef
  38. Raubeson LA, Jansen RK (2005) Chloroplast genomes of plants. H. Henry, (Ed.). Diversity and evolution of plants: Genotypic and phenotypic variation in higher plants. CABI Publishing. Wallingford, UK 45-68
    CrossRef
  39. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59:309-322
    Pubmed CrossRef
  40. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13:103-107
    Pubmed KoreaMed CrossRef
  41. Smyda-Dajmund P, Śliwka J, Wasilewicz-Flis I, Jakuczun H, Zimnoch-Guzowska E (2016) Genetic composition of interspecific potato somatic hybrids and autofused 4x plants evaluated by DArT and cytoplasmic DNA markers. Plant Cell Rep 35:1345-1358
    Pubmed KoreaMed CrossRef
  42. Spooner DM, Ghislain M, Simon R, Jansky SH, Gavrilenko T (2014) Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot Rev 80:283-383
    CrossRef
  43. Srivastava A, Bhardwaj V, Singh BP, Khurana SMP (2016) Potato diversity and its genetic enhancement. V. Rajpal, S. Rao, S. Raina, (Eds.). Gene pool diversity and crop improvement. Sustainable development and biodiversity, vol 10. Springer. Cham 187-226
    CrossRef
  44. Sugiura M, Hirose T, Sugita M (1998) Evolution and mechanism of translation in chloroplast. Annu Rev Genet 32:437-459
    Pubmed CrossRef
  45. Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022-3027
    Pubmed KoreaMed CrossRef
  46. Tillich M, Lehwark P, Pellizzer T, Ulbricht-Jones ES, Fischer A, Bock R, Greiner S. (2017) GeSeq - versatile and accurate annotation of organelle genomes. Nucleic Acids Res 45:W6-W11
    Pubmed KoreaMed CrossRef
  47. Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and characterization of interspecific somatic hybrids between Brassica oleracea var. botrytis and B. nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep 30:1811-1821
    Pubmed CrossRef
  48. Watanabe KN, Kikuchi A, Shimazaki T, Asahina M (2011) Salt and drought stress tolerances in transgenic potatoes and wild species. Potato Res 54:319-324
    CrossRef
  49. Xiang F, Xia G, Zhi D, Wang J, Nie H, Chen H (2004) Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica. Genome 47:680-688
    Pubmed CrossRef
  50. Yamaki S, Ohyangi H, Yamasaki M, Eiguchi M, Miyabayashi T, Kubo T, Kurata N, Nonomura K (2013) Development of INDEL markers to discriminate all genome types rapidly in the genus Oryza. Breeding Sci 63:246-254
    Pubmed KoreaMed CrossRef
  51. Ye S, Dhillon S, Ke X, Collins AR, Day INM (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res 29:e88
    Pubmed KoreaMed CrossRef
  52. Yurina NP, Odintsova MS (1998) Comparative structural organization of plant chloroplast and mitochondrial genomes. Russ J Genet 34:5-22
  53. Zou Z, Liu F, Fernando WGD (2018) Rapid detection of Leptosphaeria maculans avirulence gene AvrLm4-7 conferring the avirulence/virulence specificity on Brassica napus using a tetra-primer ARMS-PCR. Eur J Plant Pathol 152:515-520
    CrossRef
JPB
Vol 51. 2024
Current Issue Archives

Stats or Metrics

Share this article on

  • line

Related articles in JPB

Journal of

Plant Biotechnology

pISSN 1229-2818
eISSN 2384-1397
qr-code Download